perk/erk STAT5B
|
|
|
- Sabrina Ryan
- 5 years ago
- Views:
Transcription
1 pakt/akt relative to saline (fold) control perk/erk relative to saline (fold) p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+) p=.7 db/+ D serum leptin (pg/ml) NCD HFD E relative to control STAT5 Ctrl DM Suppl Figure Hsp6 reduction is associated with central insulin resistance (A) Densitometric analysis of AKT and ERK activation after insulin stimulation in the hypothalamus of control and mice (n=-5). () Western blot and densitometric analysis of Hsp6 of isolated mitochondria from hypothalami of db/+ and mice (each n=6). VDAC served as loading control for mitochondrial content. (C) Western blot and densitometric analysis of cytoplasmic Hsp6 of hypothalami from db/+ and mice (each n=6). served as loading control. (D) Serum leptin levels of mice fed a NCD or HFD for 4 weeks (n=4-5). (E) Gene expression analysis of STAT5 of hypothalami from control and type diabetes mellitus patients (n=-4). Displayed values are means ± S.E.M.;, p.5;, p.
2 A Hsp6 KD Hsp6 KD C Citrate Synthase Hsp6 KD Ctrl Hsp6 KD Suppl Figure Hsp6 knockdown causes mitochondrial dysfunction, Electron microscopic pictures of mitochondria from control and Hsp6 KD in two different neuronal cell lines (A) N5/ (Total magnification :4655) and () GT-7 (Total magnification :45) (C) Western blot and densitometric analysis of citrate synthase in control and Hsp6 KD cells (each n=). served as a loading control. Displayed values are means ± S.E.M.;, p.5.
3 Saline Leptin Hsp6 relative to saline (%) Saline Leptin Suppl Figure Hypothalamic Hsp6 expression in C57l/6 mice (A) Western blot and densitometric analysis of Hsp6 of hypothalami from mice treated with saline or leptin for h (each n=-6). served as a loading control. Displayed values are means ± S.E.M.;, p.5.
4 5 5 nm IGF- pirs- Y6 pakt AKT perk ERK Hsp6KD pirs/actin fold stimulation pakt/actin fold stimulation perk/actin fold stimulation p=.6 p=.5 p= time (min) 5 5 time (min) 5 5 basal Vit C basal Vit C Hsp6KD pirs- Ser7 IRS- pirs Ser7/IRS relative to basal control (%) basal Vit C basal Vit C Hsp6KD Suppl Figure 4 Insulin and IGF- resistance in Hsp6 KD cells. (A) Western blot and densitometric analysis of nm IGF- stimulated phosphorylation of IRS-, AKT and ERK in control and Hsp6 KD cells (n=5). () Western blot and densitometric analysis of phosphorylated IRS Ser7 of control and Hsp6 KD cells treated with vitamin C. Displayed values are means ± S.E.M.;, p.5.
5 body weight (g) lood glucose (mg/dl) % of initial A 4 4 C males 5 5 time (weeks) males Hsp6 +/- 5 6 males Hsp6 +/- Hsp6 +/- body weight (g) lood glucose (mg/dl) % of initial time (weeks) Hsp6 +/- 5 6 Hsp6 +/ Hsp6 +/- D E F G Ctrl Hsp6 +/- Ctrl Hsp6 +/- Ctrl Hsp6 +/- Males Females Ctrl Hsp6 +/- Ctrl Hsp6 +/- males blood glucose (mg/dl) Insulin (ng/ml) Insulin (ng/ml) average food intake/day (g) Leptin (ng/ml) Ctrl Hsp6 +/- Suppl Figure 5 Metabolic phenotype of Hsp6 heterozygous mice. (A) ody weight curve of control and Hsp6 +/- male and female mice over the time of weeks (n=-). () Glucose tolerance test of -week old control and Hsp6 +/- male and female mice (n=-). (C) Insulin tolerance test of 6-week old control and Hsp6 +/- male and female mice (n=5-9). (D) Random blood glucose levels of -week old control and Hsp6+/- male and female mice (n=5-8). (E) Serum insulin levels of 6-week old control and Hsp6+/- male and female mice (n=-6). (F) Average food intake of - week old control and Hsp6 +/- male mice (n=5-). (G) Serum leptin levels of 6-week old control and Hsp6+/- male mice (n=).
6 H 5 5 POMC Hsp6 +/- Agrp Hsp6 +/- NPY Hsp6 +/- I CIII-core CIV-I CV-alpha Hsp6 +/- J relative to control C IV- I Hsp6 +/ CV-alpha Hsp6 +/ CIII-core Hsp6 +/- Suppl Figure 5 Metabolic phenotype of Hsp6 heterozygous mice. (H) Hypothalamic expression of anorexigenic and orexigenic neuropeptides in control and Hsp6 +/- mice (n=6-8). (I) Western blot analysis of mitochondrial proteins CV alpha, CIV-I and CIII-core of dissected hypothalami of control and Hsp6 +/- mice (each n=). served as a loading control. (J) Densitometry of western blot analysis. Values are means ± S.E.M.;, p.5.
7 relative to control in % ER stress markers Hsp6KD XP XPs CHOP PDI relative to control in % apoptotic markers ax ak Hsp6KD C cleaved Caspase Caspase Hsp6KD Suppl Figure 6 Acute downregulation of Hsp6 in the hypothalamus does not induce ER stress or apoptosis. (A) Gene expression analysis of ER stress and () pro-apoptotic markers in hypothalamic samples of control and Hsp6 KD mice (n=7-8). (C) Western blot analysis of cleaved and total caspase in hypothalamic samples control and Hsp6 KD mice (n=7-8).
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
Insulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl
P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
THE ROLE OF INSULIN RECEPTOR SIGNALING IN THE BRAIN. COGS 163 By: Pranav Singh Alexandra Villar
THE ROLE OF INSULIN RECEPTOR SIGNALING IN THE BRAIN COGS 163 By: Pranav Singh Alexandra Villar INTRODUCTION Insulin is a hormone produced in the pancreas by the islets of Langerhans that regulates the
Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk
EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
CNS Control of Food Intake. Adena Zadourian & Andrea Shelton
CNS Control of Food Intake Adena Zadourian & Andrea Shelton Controlling Food Intake Energy Homeostasis (Change in body adiposity + compensatory changes in food intake) Background Information/Review Insulin
Expanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
Supplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Hormones. Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6
Hormones Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6 Tel. 030-8385-6920 (Sekret.) 030-8385-6922 (direkt) e-mail: vhaucke@chemie.fu-berlin.de http://userpage.chemie.fu-berlin.de/biochemie/aghaucke/teaching.html
Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Central insulin action regulates peripheral glucose and fat metabolism in mice
Research article Central insulin action regulates peripheral glucose and fat metabolism in mice Linda Koch, 1 F. Thomas Wunderlich, 1 Jost Seibler, 2 A. Christine Könner, 1 Brigitte Hampel, 1 Sigrid Irlenbusch,
Hypothalamic IKKb/NF-kBandER Stress Link Overnutrition to Energy Imbalance and Obesity
Hypothalamic IKKb/NF-kBandER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, 1,4 Guo Zhang, 1,4 Hai Zhang, 1,2,4 Michael Karin, 3 Hua Bai, 1 and Dongsheng Cai 1, * 1 Department
Leptin-Insulin Signaling in the Brain. BY TEAM CEPHALIC Aman Hamdard, Kevin Artiga, Megan Imreh, Ronald Baldonado, and Sharri Mo
Leptin-Insulin Signaling in the Brain BY TEAM CEPHALIC Aman Hamdard, Kevin Artiga, Megan Imreh, Ronald Baldonado, and Sharri Mo Agenda Leptin in the Hypothalamus: Pathways and Roles Cross-talk between
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake
Plum et al., Supplementary online material The Oesity Suseptiility Gene Caroxypeptidase E Links FoxO1 Signaling in Hypothalami Pro opiomelanoortin Neurons with Regulation of Food Intake Leona Plum, Hua
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Bi156 lecture 2, 1/6/12. Eating and weight regulation
Bi156 lecture 2, 1/6/12 Eating and weight regulation Introduction: weight regulation in an affluent society In our society much effort and money is expended on regulation of weight. Failure to maintain
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
! acts via the autonomic nervous system. ! maintaining body weight within tight limits. ! ventromedial (VMN) ! arcuate (ARC) ! neuropeptide Y (NPY)
Brain Regulates energy homeostatis Glucose Sensing in the Brain Seminar 2012 Gareth Price! acts in response to circulating signals of nutrient states! acts via the autonomic nervous system Ensures a balance
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
BIK BIM NOXA PUMA MCL-1. p53
HT116 cells A IK IM NOXA PUMA ML-1 p53 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 Procaspase 3 PARP leaved Product 12 8 4 24 hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors.
Early Life Effects on Hypothalamic Circuitry. By: The Mystery Gang
Early Life Effects on Hypothalamic Circuitry By: The Mystery Gang Hypothalamic Circuits Controlling Energy Balance ARH (Arcuate nucleus of the Hypothalamus) Subgroup of Neurons 1: coexpress Neuropeptide
BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
SORCS1 and SORCS3 control energy balance and orexigenic peptide production
Article SORCS1 and SORCS3 control energy balance and orexigenic peptide production Aygul Subkhangulova 1,*, Anna R Malik 1, Guido Hermey 2, Oliver Popp 1, Gunnar Dittmar 1,3,, Thomas Rathjen 1, Matthew
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
MST1 is a key regulator of beta cell apoptosis and dysfunction in diabetes
a r t i c l e s is a key regulator of beta cell apoptosis and dysfunction in diabetes Amin Ardestani, Federico Paroni,, Zahra Azizi,, Supreet Kaur,, Vrushali Khobragade, Ting Yuan, Thomas Frogne, Wufan
Obesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
Pathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
THE ROLE OF AMP-ACTIVATED PROTEIN KINASE IN ALLEVIATING INSULIN RESISTANCE IN HYPOTHALAMIC NEURONS
THE ROLE OF AMPACTIVATED PROTEIN KINASE IN ALLEVIATING INSULIN RESISTANCE IN HYPOTHALAMIC NEURONS by Jonathan Menchella A thesis submitted in conformity with the requirements for the degree of Master of
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
ER Stress in Retinal Degeneration in S334ter Rho Rats
ER Stress in Retinal Degeneration in S334ter Rho Rats Vishal M. Shinde 1., Olga S. Sizova 1., Jonathan H. Lin 2, Matthew M. LaVail 3, Marina S. Gorbatyuk 1 * 1 Department of Cell Biology and Anatomy, University
Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF
SH2B1 Regulates Insulin Sensitivity and Glucose Homeostasis by Multiple Mechanisms. David L. Morris
SH2B1 Regulates Insulin Sensitivity and Glucose Homeostasis by Multiple Mechanisms by David L. Morris A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Supplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Anti-Apoptotic Effects of Cellular Therapy
Anti-Apoptotic Effects of Cellular Therapy Jason Lapetoda 1, Lee K Landeen, PhD 1, George K Michalopoulos, MD 2, Patricia W Bedard, PhD 1 1 Vital Therapies, Inc., San Diego, CA, USA 2 University of Pittsburgh
Proteinmicroarrays - Antikörper im analytischen Einsatz
Proteinmicroarrays - Antikörper im analytischen Einsatz Dr. Markus Ehrat Zeptosens A Division of Bayer Schweiz AG APPLICA 2009 17. Juni 2009 What are Microarrays? A powerful technology to measure thousands
Diabetic silkworms for evaluation of therapeutically effective drugs
Supplementary information Diabetic silkworms for evaluation of therapeutically effective drugs against type II diabetes. Yasuhiko Matsumoto, Masaki Ishii, Yohei Hayashi, Shinya Miyazaki, Takuya Sugita,
letters to nature ... AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus
... AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus Yasuhiko Minokoshi 1, Thierry Alquier 1, Noboru Furukawa 1, Young-Bum Kim 1, Anna Lee 1, Bingzhong
3-D culture of BRAF- and KRAS-mutated Erdheim-Chester. disease tissues: impact of kinase inhibitors
3-D culture of BRAF- and KRAS-mutated Erdheim-Chester disease tissues: impact of kinase inhibitors Marina Ferrarini, MD Division of Experimental Oncology San Raffaele Scientific Institute, Milano 5 th
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF
shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)
Supplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression. through inhibition of Hsp90
Supplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression through inhibition of Hsp90 Dicoumarol-Sepharose co-precipitation. Hsp90 inhibitors can co-precipitate
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
Hypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction Laura Gunter The Brain as the Regulatory Center for Appetite The brain is the integration center
AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
Bortezomib blocks the catabolic process of. autophagy via a cathepsin-dependent mechanism, affects endoplasmic reticulum stress, and
Autophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20 Bortezomib blocks the catabolic process of autophagy via a cathepsin-dependent mechanism, affects
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Figure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control
Leptin Deficiency Introduction The leptin/melanocortin pathway plays a key role in the hypothalamic control of food intake. It is activated following the systemic release of the adipokine leptin (LEP)
TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
![TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]](/thumbs/89/99233308.jpg "TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]")
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
Growth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
Alzheimer-associated Ab oligomers impact the central nervous system to induce peripheral metabolic deregulation
Research Article Alzheimer-associated Ab oligomers impact the central nervous system to induce peripheral metabolic deregulation Julia R Clarke 1,2,, Natalia M Lyra e Silva 1,, Claudia P Figueiredo 2,
Activation of AMPK in rat hypothalamus participates in cold-induced resistance to nutrient-dependent anorexigenic signals
J Physiol 568.3 (2005) pp 993 1001 993 Activation of AMPK in rat hypothalamus participates in cold-induced resistance to nutrient-dependent anorexigenic signals Erika A. Roman 1,Maristela Cesquini 1,Graziela
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells
Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,