Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines
|
|
|
- Amie Perry
- 5 years ago
- Views:
Transcription
1 Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines Dra Martha Robles Flores Department of Biochemistry Facultad de Medicina Universidad Nacional Autónoma de México
2 Tissue anatomy of the colonic epithelium TGF-β, BMP Differentiation Cell cycle arrest Wnt Stem cell renewal Proliferation
3 Canonical Wnt Signaling Wnt LRP 5/6 Frizzled P P P Dvl P N P P P C β catenin Proteosomal Degradation β catenin acummulation Nuclei HDAC TLE- LEF/TCF Nuclei OFF ON LEF/TCF Lgs/Bcl-9 Pygo
4 Canonical Wnt Signaling (Wnt/ β -catenin) Non-canonical Wnt Signaling (Wnt/Ca++) LRP5/6 Wnt3a Fz RoR Wnt5a Fz G Protein GSK3-β/ Axin/APC Dvl Dvl? DAG PLC IP3 β-catenin Ca ++ mobilization TCF/LEF PKC? CAMK Wnt gene target transcription Planar cell polarity Negative modulation of TCF actions
5 PKC Isoform APC MIN mice model Colon cell lines References PKCα Protein levels Cellular differentiation (IEC-8) Frey 997, Hizli, 26, Black 2. PKCβ I Protein levels Cellular differentiation (SW-48) Goldstein, 995, Assert, 999. PKCδ Protein and mrna levels Apoptosis (CaCo-2) Black, 2, Cerda et al, 26. PKCβ II Protein and mrna levels Cancer cell lines proliferation and migration Yu, 23, Murray, et al, 999 PKCε Protein levels Cellular proliferation, migration (HT-29) Heider et al, 24; Perletti, 998
6 NON MALIGNANT CELL LINES IEC-8 (rat) 2-CoN (human) COLON CARCINOMA CELL LINES RKO (human) SW-48 (human) COMPLETE APC COMPLETE APC COMPLETE APC TRUNCATED APC Normal Wnt signaling Normal Wnt signaling Normal Wnt signaling Altered Wnt signaling (constitutively active) APC Truncated APC PKCδ
7 Comparative expression profile of PKC isoforms in colon cultured cell linesde colon Normal Malignant PKC 2 CoN HT-29 RKO α.2 ±.5 β I.5 ±.4 δ βii ε η ζ μ DOWN-REGULATED. ±.66 3 ±.7 2 ±.3 4± 4±.77 4±..±.22 4±.5 5±.9. ±.2 2±. 6±.2 UP-REGULATED
8 IEC-8n IEC-8n RKO RKO GSK-3 PKC-ζ Merge β-cat PKC-ζ Merge WB PKC-ζ IP: GSK-3 PKC ζ IP: β-catenin GSK-3 β-cat HT-29c RKOc IEC-8n HT-29c RKOc IEC-8n
9 IP: APC WB: 25 APC IEC-8 (N) 5 75 PKCα HT-29 ( C ) 5 APC PKCα Merge IP: APC 25 APC IEC-8 (N) 75 5 PKCδ HT-29 ( C ) APC PKCδ Merge
10 GOALS What is the biological meaning of PKCα/δ interaction with APC? What is the biological meaning of β-catenin interaction with PKCζ? Can PKC modulate canonical Wnt signaling?
11 TCF-sensitive Trancriptional activity (Fold) TOPFlash (functional TCF sites) FOPFlash (mutated TCF sites) IEC-8 (Normal) RKO SW48.2 RKO.8.6 FOP TOP.4.2 Control Wnt5a Wnt3a
12 PKCζ selective inhibitor blocks β-catenin-mediated transcriptional activity in both RKO and SW48 colon carcinoma cell lines SW48 RKO Wnt 3a FOPFLASH TOPFLASH PKCζ i (2μM)
13 PKCζ knockdown blocks in a dose-dependent manner the β-catenin-mediated transcriptional activity Normalized luciferase activity psuper.pkcz.rnai (μg) 2 WB: PKCζ Actin Psuper PKC RNAi (μg) 2
14 Effect of PKCζ knockdown on cell proliferation and Wnt target gene expression (c-myc) 2 SW48 cells WB: Proliferatiom (% MTT Reduction) PKCζi (2 μm) c-myc actin PCR PKCζ i (2 μm) + c-myc GAPDH +
15 Effect of PKCδ inhibition on β-catenin-mediated transcriptional activity SW-48 Normalized Luciferase Activity Control Vehicle Rottlerin 3uM FOP TOP
16 Effect of PKCδ inhibition on β catenin mediated transcriptional activity Normalized Luciferase Activity Control Wnt3 Rottlerin 3uM+ Wnt3 FOP TOP Normalized Luciferase Activity RKO Wnt3a Rottlerin - 3μM 4μM 6μM μm
17 SUMMARY PKC isoforms associate in vivo with key Wnt canonical proteins: PKCζ, upregulated in malignant cells, interacts with GSK3β and with β-catenin mainly in cancerous cells. PKCδ, downregulated in malignant cells, interacts with APC in both normal and malignant cells. Pharmacological inhibition of PKCζ, or its decreased expression blocked in a dose-dependent manner canonical Wnt activation in cancer cell lines, suggesting that PKCζ modulates ina positive waycanonical Wntactivation. Pharmacological inhibition of PKCδ or its decreased expression, improved in a dose-dependent way canonical Wnt activation in RKO cancer cells, suggesting that PKCδ modulates in a negative way canonical Wnt activation. Altogether, our results indicate that PKC isoforms play an essential role in the regulation of canonical Wnt pathway.
18
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen
CHAPTER 6 SUMMARIZING DISCUSSION
CHAPTER 6 SUMMARIZING DISCUSSION More than 20 years ago the founding member of the Wnt gene family, Wnt-1/Int1, was discovered as a proto-oncogene activated in mammary gland tumors by the mouse mammary
Wnt/β-catenin s regulatory role in embryonic stem cell pluripotency and differentiation
Wnt/β-catenin s regulatory role in embryonic stem cell pluripotency and differentiation Wim de Jonge 3361039 Supervisor: Prof. Dr. S.J.L. van den Heuvel Group: Developmental Biology, Faculty of Science,
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
WNT signalling pathways as therapeutic targets in cancer
WNT signalling pathways as therapeutic targets in cancer Jamie N. Anastas 1,2,3,4 and Randall T. Moon 1,2,4 Abstract Since the initial discovery of the oncogenic activity of WNT1 in mouse mammary glands,
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Summary and Concluding Remarks
Summary and Concluding Remarks Chapter 6 The intestinal epithelium provides an excellent model system for investigating molecular mechanisms regulating cell lineage establishment, stem cell proliferation,
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
T Cell Effector Mechanisms I: B cell Help & DTH
T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide
Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Wnt Signaling Pathway and AD
Center for Cell Regulation and Pathology Joaquín V. Luco (CRCP), Millennium Institute (MIFAB) Center for Aging and Regeneration (CARE). Wnt Signaling Pathway and AD Nibaldo C. Inestrosa European Union
Effects of Retinoic Acid on Beta-Catenin Transcriptional Activity in Melanoma Cells
Marshall University Marshall Digital Scholar Theses, Dissertations and Capstones 1-1-2007 Effects of Retinoic Acid on Beta-Catenin Transcriptional Activity in Melanoma Cells Fung Chan michael_chan2011@hotmail.com
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Understandably, the search for these cross connections has been largely postponed until the operations of each primary pathway are elucidated.
Understandably, the search for these cross connections has been largely postponed until the operations of each primary pathway are elucidated. RA Weinberg, The Biology of Cancer, 2007, p202. Genetic Variation
A class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation.
Tumor Suppressor Genes A class of genes that normally suppress cell proliferation. p53 and Rb..ect Mutations that inactivate the tumor suppressor gene products can release cells from growth suppression
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors
Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Hippocampal protein kinase C signaling mediates the short-term memory
Hippocampal protein kinase C signaling mediates the short-term memory impairment induced by delta9-tetrahydrocannabinol Arnau usquets-garcia* 1,2, Maria Gomis-González* 1, Victòria Salgado-Mendialdúa 1,
Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.
Figure 1 pβcat552 β-cat pgsk3β GSK3β 110 110 pgsk3β/du -cad/ TL 20 µm 20 µm pkt473 pankt pkt473 pankt (days) 0 1 2 3 4 (h) 0 1 3 6 9 12 pβ-cat552/nuclei ensitometricanalysis (Pixel intensity) F ensitometricanalysis
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
Wnt signaling. Ramray Bhat.
Wnt signaling Ramray Bhat ramray@mrdg.iisc.ernet.in Starting with animal biology and viral infections The discovery of certain laboratory murine strains that were highly susceptible to mammary gland cancer.
Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1
Supplementary Tale S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort TCGA Case ID Gene-1 Gene-2 Chr. # of Gene 1 Chr. # of Gene 2 Genomic coordiante of Gene 1 at fusion junction Genomic
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Targeting of Noncanonical Wnt5a Signaling by AP-1 Blocker Dominant-Negative Jun When It Inhibits Skin Carcinogenesis
Original Article Targeting of Noncanonical Wnt5a Signaling by AP-1 Blocker Dominant-Negative Jun When It Inhibits Skin Carcinogenesis Genes & Cancer 3(1) 37 50 The Author(s) 2012 Reprints and permission:
Prostaglandin E2 alters Wnt-dependent migration and proliferation in neuroectodermal stem cells: implications for autism spectrum disorders
Wong et al. Cell Communication and Signaling 2014, 12:19 RESEARCH Open Access Prostaglandin E2 alters Wnt-dependent migration and proliferation in neuroectodermal stem cells: implications for autism spectrum
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Neoplasia 18 lecture 6. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 6 Dr Heyam Awad MD, FRCPath ILOS 1. understand the role of TGF beta, contact inhibition and APC in tumorigenesis. 2. implement the above knowledge in understanding histopathology reports.
Supplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
From crypt stem cell to colorectal cancer
19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0321-05 ( 510405) Wnt Notch BMP R735.35; R730.21 A From crypt stem cell to colorectal cancer WEN Bin*, CHEN Weiwen
A Theoretical Model of the Wnt Signaling Pathway in the Epithelial Mesenchymal Transition
Gasior et al. Theoretical Biology and Medical Modelling (2017) 14:19 DOI 10.1186/s12976-017-0064-7 RESEARCH Open Access A Theoretical Model of the Wnt Signaling Pathway in the Epithelial Mesenchymal Transition
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
Aberrant nuclear localization of EBP50 promotes colorectal carcinogenesis in xenotransplanted mice by modulating TCF-1 and β-catenin interactions
Research article Aberrant nuclear localization of EBP50 promotes colorectal carcinogenesis in xenotransplanted mice by modulating TCF-1 and β-catenin interactions Yu-Yu Lin, 1,2 Yung-Ho Hsu, 3 Hsin-Yi
Biochemistry of Cancer
4/6/15 Biochemistry of Cancer Tumor Suppressor Genes 1 Tumor Suppressor Genes Recessive phenotype Oncogenes (viral or cellular) dominate a phenotype i.e. acfvafon of cancer like behaviors. Ras, Myc, Erb
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
A molecular mechanism that links Hippo signalling to the inhibition of Wnt/b-catenin signalling
The EMBO Journal (212) 31, 119 1122 & 212 European Molecular Biology Organization All Rights Reserved 261-4189/12 www.embojournal.org A molecular mechanism that links Hippo signalling to the inhibition
Oncogenic Function of ATDC in Pancreatic Cancer through Wnt Pathway Activation and b-catenin Stabilization
Article Oncogenic Function of through Wnt Pathway Activation and b-catenin Stabilization Lidong Wang, 1 David G. Heidt, 1 Cheong J. Lee, 1 Huibin Yang, 1 Craig D. Logsdon, 5 Lizhi Zhang, 6 Eric R. Fearon,
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Falk Symposium No :30-9:00 am, Saturday, October 1, 2005 Maritim Hotel, Berlin Of mice and man: Mouse models for colon carcinogenesis
Falk Symposium No. 149 8:30-9:00 am, Saturday, October 1, 2005 Maritim Hotel, Berlin Of mice and man: Mouse models for colon carcinogenesis Makoto Mark Taketo, M.D., Ph.D. Department of Pharmacology, Graduate
Development of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
Supplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
Beta-catenin cleavage enhances transcriptional activation
www.nature.com/scientificreports Received: 11 May 2017 Accepted: 11 December 2017 Published: xx xx xxxx OPEN Beta-catenin cleavage enhances transcriptional activation Tatiana Goretsky 1, Emily M. Bradford
FoxM1 Promotes b-catenin Nuclear Localization and Controls Wnt Target-Gene Expression and Glioma Tumorigenesis
Article and Controls Wnt Target-Gene Expression and Glioma Tumorigenesis Nu Zhang, 1,5,9 Ping Wei, 1,6,9 Aihua Gong, 1 Wen-Tai Chiu, 1 Hsueh-Te Lee, 1 Howard Colman, 2 He Huang, 8 Jianfei Xue, 1 Mingguang
Principles of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
Frizzled Activation by Wnt-l Is Required for j3 -Catenin-T Cell Factor Dependent Transcription in Esophageal Cancer
75 Wnt-l activate TCF transcription Frizzled Activation by Wnt-l Is Required for j3 -Catenin-T Cell Factor Dependent Transcription in Esophageal Cancer Takaaki Mizushima, Koji Ochi, Yasuyuki Emori, Hiroaki
Canonical Wnt Signaling in Osteoblasts Is Required for Osteoclast Differentiation
Canonical Wnt Signaling in Osteoblasts Is Required for Osteoclast Differentiation DONALD A. GLASS, II AND GERARD KARSENTY Department of Molecular and Human Genetics, Bone Disease Program of Texas, Baylor
In canonical Wnt signaling, Dishevelled (Dvl) is a critical
Published Online: 17 March, 2008 Supp Info: http://doi.org/10.1083/jcb.200710050 Downloaded from jcb.rupress.org on September 11, 2018 JCB: ARTICLE Nuclear Dvl, c-jun, -catenin, and TCF form a complex
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model
Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model Averi Leahy, Andrea Foote, Tomoya Uchimura, Li Zeng, PhD. Tufts University, Boston, MA, USA. Disclosures: A. Leahy: None.
Targeting methyltransferase PRMT5 eliminates leukemia stem cells in chronic myelogenous leukemia
Targeting methyltransferase PRMT5 eliminates leukemia stem cells in chronic myelogenous leukemia Yanli Jin,, Ruibao Ren, Jingxuan Pan J Clin Invest. 2016;126(10):3961-3980. https://doi.org/10.1172/jci85239.
Wnt5a Signaling A New and Attractive Target for Specific Anticancer Therapy
Clin Oncol Cancer Res (2010) 7: 1-6 DOI 10.1007/s11805-010-0001-6 1 Wnt5a Signaling A New and Attractive Target for Specific Anticancer Therapy Xiao-hong SHEN 1 Dong LI 1 Hong-yue LI 1 Qiang LI 2 1 Medical
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Bee Ling Tan 1, Mohd Esa Norhaizan 1,2,3*, Ky Huynh 4, Sulaiman Rahman Heshu 5, Swee Keong Yeap 4, Hamzah Hazilawati 5 and Karim Roselina 6
Tan et al. BMC Complementary and Alternative Medicine (2015) 15:205 DOI 10.1186/s12906-015-0730-4 RESEARCH ARTICLE Open Access Water extract of brewers rice induces apoptosis in human colorectal cancer
Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer
Research article Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer Punita Dhawan, 1 Amar B. Singh, 2 Natasha G. Deane, 1,3 YiRan No, 1 Sheng-Ru Shiou, 1 Carl Schmidt,
Discovery of a Small Molecule Inhibitor of the Wnt Pathway as a Potential Disease Modifying Treatment for Knee Osteoarthritis
Discovery of a Small Molecule Inhibitor of the Wnt Pathway as a Potential Disease Modifying Treatment for Knee Osteoarthritis Charlene Barroga, Ph.D., Yong Hu, Ph.D., Vishal Deshmukh, Ph.D., and John Hood,
A GENETIC SCREEN FOR WNT SIGNALING FACTORS THAT REGULATE DROSOPHILA MELANOGASTER NOCICEPTION. A Thesis By PAUL RICHARD FREEMAN
A GENETIC SCREEN FOR WNT SIGNALING FACTORS THAT REGULATE DROSOPHILA MELANOGASTER NOCICEPTION A Thesis By PAUL RICHARD FREEMAN Submitted to the Graduate School At Appalachian State University in partial
Autolysosomal b-catenin degradation regulates Wnt-autophagy-p62 crosstalk
The EMBO Journal (2013) 32, 1903 1916 www.embojournal.org Autolysosomal b-catenin degradation regulates Wnt-autophagy-p62 crosstalk THE EMBO JOURNAL Katy J Petherick 1, Ann C Williams 1,6, Jon D Lane 2,6,
Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region
Identification and Characterization of Stem-like Cells in Human Esophageal Adenocarcinoma and Normal Epithelial Cell Lines No disclosures / conflict of interest Alan G. Casson FRCSC Professor of Surgery
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Introduction. Oncotarget, November, Vol.1, No 7
/ Oncotarget, November, Vol.1, No 7 The Class I Hdac Inhibitor Mgcd13 Induces Cell Cycle Arrest and Apoptosis in Colon Cancer Initiating Cells by Upregulating Dickkopf-1 and Non-Canonical Wnt Signaling
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Wnt-signalling pathways and micrornas network in carcinogenesis: experimental and bioinformatics approaches
Onyido et al. Molecular Cancer (2016) 15:56 DOI 10.1186/s12943-016-0541-3 REVIEW Open Access Wnt-signalling pathways and micrornas network in carcinogenesis: experimental and bioinformatics approaches
High-Throughput Screen to Identify Small Molecule Inhibitors of the Canonical Wnt Signaling Pathway
High-Throughput Screen to Identify Small Molecule Inhibitors of the Canonical Wnt Signaling Pathway by Stephen J Perusini A thesis submitted in conformity with the requirements for the degree of Masters
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Supplemental Figure 1
mrn/ mirn expression 3.5 3.5.5.5 +Jagged mir-5+jagged Supplemental Figure HS mir-5 Z H HS mir-5 Z H HS mir-5 Z H HM MF PT HM JG HS Percentage of 4-44 + cells (%) mrn/mirn 8 6 4.5.5.5 mir-5 sh-jg +Jagged
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
C. elegans Embryonic Development
Autonomous Specification in Tunicate development Autonomous & Conditional Specification in C. elegans Embryonic Development Figure 8.36 Bilateral Symmetry in the Egg of the Tunicate Styela partita Fig.
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
Disease Models & Mechanisms DMM Accepted manuscript
First posted online on 20 February 2015 as 10.1242/dmm.018887 Access the most recent version at http://dmm.biologists.org/lookup/doi/10.1242/dmm.018887 2015. Published by The Company of Biologists Ltd.
c-jun N-terminal kinase 1 interacts with and negatively regulates Wnt/b-catenin signaling through GSK3b pathway
Carcinogenesis vol.29 no.12 pp.2317 2324, 2008 doi:10.1093/carcin/bgn239 Advance Access publication October 24, 2008 c-jun N-terminal kinase 1 interacts with and negatively regulates Wnt/b-catenin signaling
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Cancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
The impact of Wnt5a signaling and tumor associated macrophages in breast cancer
The impact of Wnt5a signaling and tumor associated macrophages in breast cancer Hagerling, Catharina 2012 Link to publication Citation for published version (APA): Hagerling, C. (2012). The impact of Wnt5a
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
Secreted Frizzled Related Proteins: Implications in Cancers
Accepted Manuscript Secreted Frizzled Related Proteins: Implications in Cancers Rohit Surana, Sakshi Sikka, Wanpei Cai, Eun Myoung Shin, Sudha R. Warrier, Hong Jie Gabriel Tan, Frank Arfuso, Simon A. Fox,
PDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/166982
Title : The interaction of wnt-11 and signalling cascades in prostate cancer. Name : Sarah Koushyar
Title : The interaction of wnt-11 and signalling cascades in prostate cancer Name : Sarah Koushyar This is a digitised version of a dissertation submitted to the University of Bedfordshire. It is available
Wnt signalling in osteoblasts regulates expression of the receptor activator of NF B ligand and inhibits osteoclastogenesis in vitro
Research Article 1283 Wnt signalling in osteoblasts regulates expression of the receptor activator of NF B ligand and inhibits osteoclastogenesis in vitro Gary J. Spencer 1, *, Jennifer C. Utting 2, Sharon
Wnt signaling in right ventricular remodeling
Wnt signaling in right ventricular remodeling Inaugural Dissertation submitted to the Faculty of Medicine in partial fulfillment of the requirements for the PhD-Degree of the Faculties of Veterinary Medicine
Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer
Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics TMPRSS2-ERG
in colorectal cancer cells
Molecular Pharmacology This article has not Fast been Forward. copyedited and Published formatted. The on final May version 1, 2012 may differ as doi:10.1124/mol.112.078535 from this version. MOL#78535
Posttranslational modifications on protein kinase c isozymes. Effects of epinephrine and phorbol esters
Available online at www.sciencedirect.com Biochimica et Biophysica Acta 1783 (2008) 695 712 www.elsevier.com/locate/bbamcr Posttranslational modifications on protein kinase c isozymes. Effects of epinephrine
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
Supplementary Information
Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina
EMT: Epithelial Mesenchimal Transition
EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis