Supplemental Figure 1
|
|
|
- Bruno Webster
- 5 years ago
- Views:
Transcription
1 mrn/ mirn expression Jagged mir-5+jagged Supplemental Figure HS mir-5 Z H HS mir-5 Z H HS mir-5 Z H HM MF PT HM JG HS Percentage of cells (%) mrn/mirn mir-5 sh-jg +Jagged HM MF PT Z mir-5+jagged Percentage of cells in cell cycle phase (%) sh-mir5 Sub-G G S G/M Supplemental figure S. Jagged promotes MT and stem cell phenotype through downregulation of mir- 5. () mir-5/mrn expression and () the percentage of population of primary human mammary epithelial cells (HM), MF and human primary breast tumor cells (PT) under treatment of 4µM control peptide or Jagged peptide for day along with expression of the control vector or mir-5. () Protein (left) and mir- 5/Z mrn expression (right) of MF cells expressing and sh-jg (n=3, asterisk indicates P<.5). () orrelation between the percentage of population and the endogenous mir-5 expression level of HM, MF and PT cells (n=3, asterisk indicates P<.5). () The percentage of cells in each cell cycle phase of MF cells expressing and shmir-5. rror bars denote ±S.
2 Supplemental Figure mrn expression sh-mir5 : NOTH : NOTH4 3: YS 4: SMO 5: SUZ 6: WNT5 7: WNT 8: HIF 9: V : SOX4 : XIN : L 3: F 4: T 5: KLF 6: FZ MF sh-mir-5 M-M-3 mir-5 T-549 mir-5 NOTH NOTH NI-NOTH NI-NOTH NI-NOTH4 NI-NOTH4 Supplemental figure S. Validation of NOTH as an mir-5 target. () mrn expression of putative mir-5 target genes identified by in silico analysis in MF cells expressing and sh-mir-5 (n=3, asterisk indicates P<.5). rror bars denote ±S. () Protein expression of NOTH (full length and NI) and NOTH4 in MF cells that stably expressed or sh-mir-5. () Protein expression of NOTH (full length and NI) and NOTH4 in breast cancer cells M-M-3 and T-549 that stably expressed the control vector or mir-5.
3 Supplemental Figure 3 M-M-3-Vec M-M-3-miR5 T549-Vec T549-miR5 PT-Vec PT-miR5 9±4 39±5 Sphere number/ cells 3±5 33±8 Sphere number/ cells 77±5 8±8 Sphere number/ cells mrn/ mirn expression mir-5 mir-5 Z mir-5 Z mir-5 Z T-549 M-M-3 PT mrn/mirn sc si-noth NOTH NI-NOTH HS mir-5 Z F mrn/mirn HS mir-5 Z NOTH NI-NOTH Supplemental figure S3. ctivation of mir-5 signaling suppresses MT and stemness phenotype in breast cancer cells. The number of primary spheres per cells from the control vector- and mir-5- expressed () M-M-3 cells, () T549 cells, and () human primary breast tumor cells (PT). () xpression of mir-5/mrns in M-M-3, T549, and PT cells that stably expressed mir-5. xpression of mir-5/mrns in () T549 cells expressing si-noth or (F) T549 cells treated with 5µM for day (n=3, asterisk indicates P<.5). Insets showing full length NOTH and NI-NOTH protein expression levels in () : T549-sc, : T549-siNOTH; (F) : T549-, : T549-. rror bars denote ±S.
4 Human primary breast tumor stem cells Supplemental Figure 4 44 Numb Merge mir-5 S 4±4% 6%±5 ivision (S) symmetric ivision () S ommitment (S) mir-5+ mir-5+noth-ni 5%±3 P=. 6%±3 NI- NOTH 5%±4 39%±5 38%±5 57%±6 45%±7 mir-5+ mir-5+z 5%±4 6%±3 39%±5 33%±6 54%±3 45%±7 45%±7 3%± P=. Z mrn expression Sox9 Nanog Llgl Llgl mir-5+ mir-5+noth-ni mir-5+z Supplemental figure S4. xpression of mir-5 suppresses symmetric division of human primary breast tumor stem cells. () onfocal fluorescence images showing 44 (red) and Numb (green) intracellular distribution during first cell division of the 4-44 high population that was isolated from human primary breast tumor cells cultured in suspension with the blebbistatin treatment (scale bar: µm). () Pie chart showing the percentage of the symmetric vs. asymmetric cell division patterns of the cells expressing control vector and mir-5 (n=3, 7- cells were counted per sample, asterisk indicates P<.5). () Pie chart (left) showing the percentage of the symmetric vs. asymmetric cell division, () NOTH/Z protein expression (right), and () mrn expression levels of stemness-related or polarity genes of the cells expressing control vector or mir-5 co-expressing NI-NOTH or Z (n=3, asterisk indicates P<.5).
5 Supplemental Figure 5 Z-R Z-R Llgl Llgl + + ound/input (%) 5 5 α-z α-igg Llgl Llgl Llgl Llgl luciferase activity.5.5 Llgl- Llgl- Z: WT MUT WT MUT 7±3% sh-llgl+sh-llgl 8±5% ivision (S) 45±5% ±% symmetric ivision () ommitment (S) Llgl Llgl : : sh-llgl+sh-llgl Supplemental figure S5. Z transcriptionally represses polarity genes Llgl and Llgl, leading to suppression of asymmetric division and promotion of symmetric division of mammary stem cells. () iagram showing the promoter regions of Llgl and Llgl with the putative Z response elements (Z-R:, in Llgl;, in Llgl). () hart showing the hip-pr result with the percentage of the bound chromatin/input chromatin using Z antibody targeting Z binding elements (,,, ) in MF cells. IgG was used as a negative control. (n=3, asterisk indicates P<.5). () Fold change in luciferase activity driven by the wild-type or mutant Llgl and Llgl reporters (with mutated or, respectively) under expression of Z in MF cells (n=3, asterisk indicates P<.5). () The percentage of the symmetric vs. asymmetric cell division (upper) and protein expression of Llgl and Llgl (lower) of the 4-44 high -MF cells expressing or sh- Llgl+sh-Llgl (n=3, 7- cells counted per sample, asterisk indicates P<.5).
6 Supplemental Figure 6 mir-5 NOTH H& sh-mir-5 Percentage of lin high (%) arcinoma foci (%) Number of tumor sphere per cells Figure S6. In vivo treatment suppresses the development of mouse mammary premalignant and malignant lesions caused by downregulation of mir-5. () Representative mir-5/noth staining with H& of the cropped regions of the control and mir-5 knock-down mammary tissues, and () the percentage of lin high population treated with or for weeks at three weeks after virus introduction (black scale bar: µm, blue scale bar: 3µm, n=5/group). () Representative NOTH staining (scale bar: 5 µm), () the percentage of observed mammary carcinoma, and () the number of tumor spheres per cells isolated from mir-5 knock-down mammary tumors treated with or for weeks at three months after virus introduction (n=5/group, asterisk indicates P<.5). rror bars denote ±S.
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
MicroRNA-205 signaling regulates mammary stem cell fate and tumorigenesis
Research article MicroRNA-205 signaling regulates mammary stem cell fate and tumorigenesis Chi-Hong Chao, 1,2 Chao-Ching Chang, 1,2 Meng-Ju Wu, 1,2 How-Wen Ko, 3,4,5 Da Wang, 3 Mien-Chie Hung, 3,4,6 Jer-Yen
Expanded View Figures
Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-15-1-0644 TITLE: Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells PRINCIPAL INVESTIGATOR: Chun-Ju Chang CONTRACTING ORGANIZATION: Purdue University West Lafayette,
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
TITLE: Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells
AWARD NUMBER: W81XWH-15-1-0644 TITLE: Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells PRINCIPAL INVESTIGATOR: Chun-Ju Chang CONTRACTING ORGANIZATION: Purdue University West Lafayette,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Supplementary Materials
Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different
TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN!
Yuan et al., Supplemental Figure 1, related to Figure 1! EY2 modulates the transcriptional activity of ERb, but not ERa!! B! -DPN! +DPN! * ERb GPDH MCF7 MD-MB-231 Primary BC - KD - KD #1 #2 #3 Relative
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
Supplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells
Supplementary Information Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells Stefan Schoenfelder, * Tom Sexton, * Lyubomira Chakalova, * Nathan
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Expanded View Figures
MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect
P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplementary Figure 1
S U P P L E M E N TA R Y I N F O R M AT I O N DOI: 10.1038/ncb2896 Supplementary Figure 1 Supplementary Figure 1. Sequence alignment of TERB1 homologs in vertebrates. M. musculus TERB1 was derived from
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
Supplemental Figures Legends and Supplemental Figures. for. pirna-guided slicing of transposon transcripts enforces their transcriptional
Supplemental Figures Legends and Supplemental Figures for pirn-guided slicing of transposon transcripts enforces their transcriptional silencing via specifying the nuclear pirn repertoire Kirsten-ndré
Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling
Developmental Cell Supplemental Information Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling Francesc R. Garcia-Gonzalo, Siew Cheng Phua, Elle C. Roberson, Galo Garcia
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas
Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling
TMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis
SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian
injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines
Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines Dra Martha Robles Flores Department of Biochemistry Facultad de Medicina Universidad Nacional Autónoma de México Tissue anatomy of the
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10353 Supplementary Figure 1. Mutations of UBQLN2 in patients with ALS and ALS/dementia. (a) A mutation, c.1489c>t (p.p497s), was identified in F#9975. The pedigree is shown on the left
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
RNA interference (RNAi)
RN interference (RNi) Natasha aplen ene Silencing Section Office of Science and Technology Partnerships Office of the Director enter for ancer Research National ancer Institute ncaplen@mail.nih.gov Plants
Supplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Supplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.
Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular
Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:
Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng,
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally
Developmental Cell, Volume 22 Supplemental Information Kinesin-1 Prevents Capture of the Oocyte Meiotic Spindle by the Sperm Aster Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R.
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Cluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,
A Transcriptome (RNA-seq) Transcriptome (RNA-seq) 3. 2.5 2..5..5...5..5 2. 2.5 3. 2.5 2..5..5...5..5 2. 2.5 Cluster Dendrogram RS_ES3.2 RS_ES3. RS_SHS5.2 RS_SHS5. PS_SHS5.2 PS_SHS5. RS_LJ3 PS_LJ3..4 _SHS5.2
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,