A molecular mechanism that links Hippo signalling to the inhibition of Wnt/b-catenin signalling

Transcription

1 The EMBO Journal (212) 31, & 212 European Molecular Biology Organization All Rights Reserved /12 A molecular mechanism that links Hippo signalling to the inhibition of Wnt/b-catenin signalling THE EMBO JOURNAL Masamichi Imajo 1,2, Koichi Miyatake 1, Akira Iimura 1, Atsumu Miyamoto 1 and Eisuke Nishida 1,2, 1 Department of Cell and Developmental Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan and 2 JST, CREST, Tokyo, Japan The Hippo signalling pathway has emerged as a key regulator of organ size, tissue homeostasis, and patterning. Recent studies have shown that two effectors in this pathway, YAP/TAZ, modulate Wnt/b-catenin signalling through their interaction with b-catenin or Dishevelled, depending on biological contexts. Here, we identify a novel mechanism through which Hippo signalling inhibits Wnt/b-catenin signalling. We show that YAP and TAZ, the transcriptional co-activators in the Hippo pathway, suppress Wnt signalling without suppressing the stability of b-catenin but through preventing its nuclear translocation. Our results show that YAP/TAZ binds to b-catenin, thereby suppressing Wnt-target gene expression, and that the Hippo pathway-stimulated phosphorylation of YAP, which induces cytoplasmic translocation of YAP, is required for the YAP-mediated inhibition of Wnt/b-catenin signalling. We also find that downregulation of Hippo signalling correlates with upregulation of b-catenin signalling in colorectal cancers. Remarkably, our analysis demonstrates that phosphorylated YAP suppresses nuclear translocation of b-catenin by directly binding to it in the cytoplasm. These results provide a novel mechanism, in which Hippo signalling antagonizes Wnt signalling by regulating nuclear translocation of b-catenin. The EMBO Journal (212) 31, doi:1.138/ emboj ; Published online 1 January 212 Subject Categories: signal transduction; development Keywords: Hippo signalling; subcellular localization; TAZ; Wnt/b-catenin signalling; YAP Introduction In multicellular organisms, cell growth, proliferation, and death must be coordinated in order to attain proper organ size during development and to maintain tissue homeostasis in adult life. Recent studies have identified the Hippo signalling pathway as a key mechanism that controls organ size by impinging on cell growth, proliferation, and apoptosis (Edgar, 26; Harvey and Tapon, 27; Pan, 21; Zhao et al, 21; Corresponding author. Department of Cell and Developmental Biology, Graduate School of Biostudies, Kyoto University, Sakyo-ku, Kyoto , Japan. Tel.: þ ; Fax: þ ; nishida@lif.kyoto-u.ac.jp Received: 11 July 211; accepted: 6 December 211; published online: 1 January 212 Halder and Johnson, 211). Central to this pathway is a kinase cascade comprising four types of tumour suppressors: the Ste2-like kinases MST1/2 (Hippo in Drosophila) (Harvey et al, 23; Jia et al, 23; Pantalacci et al, 23; Udan et al, 23; Wu et al, 23), its regulatory protein WW45 (Salvador) (Kango-Singh et al, 22; Tapon et al, 22), the NDR family kinases LATS1/2 (Warts) (Justice et al, 1995; Xu et al, 1995) and its regulatory protein MOB (Mats) (Lai et al, 25). The MST1/2 WW45 complex phosphorylates and activates LATS1/2 MOB complex (Wu et al, 23; Wei et al, 27), which in turn phosphorylates oncogenic proteins YAP (Yorkie) and TAZ (Huang et al, 25; Dong et al, 27; Zhao et al, 27; Lei et al, 28), which normally function in the nucleus as a co-activator for the TEAD/TEF family transcription factors (Scalloped) to promote cell growth, proliferation, and survival (Goulev et al, 28; Wu et al, 28; Zhang et al, 28; Zhao et al, 28). Phosphorylation of YAP (Yorkie) and TAZ promotes their interaction with proteins and results in their cytoplasmic retention. Thus, the Hippo pathway activation inhibits transcriptional activity of YAP (Yorkie) and TAZ. This Hippo pathway-dependent regulation of YAP (Yorkie) and TAZ plays a crucial role in organ size control and tissue homeostasis both in Drosophila and in mammals. For instance, inactivation of the Hippo pathway, which is a tumour suppressive pathway, or overexpression of YAP (Yorkie) oncoprotein results in massive tissue overgrowth characterized by excessive cell proliferation and diminished apoptosis, ultimately leading to rapid progression of tumourigenesis (Huang et al, 25; Camargo et al, 27; Dong et al, 27; Zhao et al, 27; Zhou et al, 29). Moreover, recent studies have also shown that the Hippo pathway components also regulate other divergent physiological processes, including cell differentiation, stem cell self-renewal, reprogramming, and patterning (Hong et al, 25; Nishioka et al, 29; Lian et al, 21; Pan, 21). A key issue regarding the Hippo pathway is how this pathway cooperates with other signalling pathways in regulating a variety of processes. The canonical Wnt signalling pathway regulates many biological processes, including cell proliferation, cell fate decision, axis formation, and organ development during embryonic development and tissue homeostasis (Moon et al, 24; Nusse, 25; Clevers, 26). The key effector protein in this pathway is the transcriptional activator b- catenin. In the absence of a Wnt signal, cytoplasmic b-catenin is phosphorylated and degraded by a multiprotein degradation complex, which comprises GSK3b, adenomatous polyposis coli (APC), and axin. Upon Wnt stimulation, a cascade of events is activated, and the degradation complex is destabilized. Thus, b-catenin is stabilized, and stabilized b- catenin then enters the nucleus and activates transcription of downstream target genes via the TCF/LEF family transcription factors. This Wnt/b-catenin pathway contributes to the self-renewal of stem cells and/or progenitor cells in a variety of tissues; and thus, deregulated activation of this pathway has been implicated in a number of cancers (Clevers, 26). & 212 European Molecular Biology Organization The EMBO Journal VOL 31 NO

2 Recent studies have shown that the Hippo pathway genetically and functionally interacts with Wnt/b-catenin signalling. For instance, Varelas et al (21) have shown that cytoplasmic (transcriptionally inactive) Yorkie and TAZ bind to Dishevelled and inhibit Wnt signalling. Consistently, knockdown of TAZ or its upstream regulators in the Hippo pathway promotes Wnt/b-catenin signalling in cultured cells (Varelas et al, 21), and TAZ-deficient mice develop polycystic kidneys with enhanced cytoplasmic and nuclear b-catenin. In Drosophila, depletion of Hippo or Warts promotes Wingless target gene expression, whereas overexpression of Yorkie suppresses it (Varelas et al, 21). Contradictory to this report, Heallen et al (211) have shown that nuclear YAP cooperates with b-catenin to promote expression of several genes involved in heart development. Thus, knockdown of the Hippo pathway components in the developing mouse heart promotes nuclear accumulation of b- catenin and Wnt-target gene expression, and thus induces the cardiomyocyte overgrowth phenotype, which can be rescued by heterozygous deletion of b-catenin (Heallen et al, 211). In addition to these reports, the Hippo pathway has also been shown to regulate Wnt/Wg signalling by affecting the transcription of the glypicans Dally and Dally-like, which act to modulate Wnt/Wg-Fz signalling at the cell membrane (Baena-Lopez et al, 28). These reports suggest that the Hippo pathway regulates Wnt/b-catenin signalling through multiple mechanisms, depending on biological contexts. Independently of these reports, we also found that the Hippo pathway negatively regulates Wnt signalling. Unexpectedly, subsequent analyses showed that the Hippo pathway activation could suppress the action of even the stabilized form of b-catenin. This suggests that the Hippo pathway should act directly on b-catenin. In fact, our studies then have demonstrated that the Hippo pathway effectors YAP and TAZ bind to b-catenin and retain it in the cytoplasm to suppress Wnt/b-catenin signalling. Here, we describe these findings. Results YAP and TAZ suppress TCF transcriptional activity without suppressing the stability of b-catenin To examine the interaction between the Hippo and Wnt signalling pathways, we first investigated the effect of overexpression of YAP or TAZ on b-catenin/tcf transcriptional activity. We performed the reporter assay with the construct expressing luciferase under the control of tandem repeats of a TCF binding site (TOPFlash) or a mutated one (FOPFlash) (Korinek et al, 1997). The TOPFlash activity, but not the FOPFlash activity, was markedly enhanced by the addition of b-catenin (Figure 1A). Overexpression of YAP suppressed the b-catenin-stimulated activation of the TOPFlash reporter in a dose-dependent manner (Figure 1A). Overexpression of TAZ also had the similar effect on the reporter activity (Figure 1A). Remarkably, overexpression of YAP or TAZ did not inhibit expression of b-catenin protein; it rather increased b-catenin protein levels (Figure 1B). These results show that overexpression of YAP and TAZ suppresses b-catenin-induced activation of TCF without decreasing b-catenin protein levels. This is contradictory to a previous report that TAZ suppresses stabilization of b-catenin (Varelas et al, 21). We then used two mutants of b-catenin (S33Y and S37A), both of which are derived from tumour cells and shown to be stabilized by the mutation in the GSK3b-phosphorylation sites. Expression of these b-catenin mutants markedly enhanced the TOPFlash activity, and the enhanced activity was significantly suppressed by overexpression of YAP (Figure 1C). This suggests that YAP suppresses the activity of even the stabilized forms of b-catenin. To further examine the effect of YAP overexpression on the stability of b-catenin, we performed the cycloheximide-chase experiment. The results showed that b-catenin is more stable in cells overexpressing YAP than in control cells (Figure 1D). Collectively, these results demonstrate that, under our experimental condition, overexpression of YAP and TAZ suppresses b-catenin-stimulated TCF activity without suppressing the stability of b-catenin. We then examined whether endogenous YAP regulates expression of Wnt-target genes. We used Caco-2 colorectal cancer (CRC) cells, in which b-catenin is stabilized by the mutations in APC and thereby Wnt-target genes are constitutively activated (Mariadason et al, 21). We infected Caco- 2 cells with a lentivirus expressing a control shrna (shlacz) or shrnas against YAP (shyap #1 and #2). In cells expressing the YAP shrnas, the YAP expression levels were reduced to 1 2% of control at mrna levels (Figure 1E), and accordingly, expression levels of an endogenous TEAD-target gene, connective tissue growth factor (CTGF), were decreased significantly (Figure 1E). Importantly, expression levels of Wnt-target genes, such as CD44, c-myc, ENC1, EphB2, Pla2g2a, Sox9, and WISP1 were significantly upregulated in these YAP-downregulated cells (Figure 1E). Similar results were obtained in another CRC cell line, HT-29, which also harbours an APC mutation and displays the increased b-catenin/tcf activity (Supplementary Figure S1). These results demonstrate that endogenous YAP negatively regulates expression of most of Wnt-target genes. It should be noted that the expression level of a Wnt-target gene, CCND1 was decreased by the YAP knockdown (Figure 1E). This is probably because CCND1 is a target of the YAP/TEAD complex in these cells (Camargo et al, 27; Cao et al, 28). Thus, a fraction of Wnt-target genes are targets of TEAD in CRC cells, and, on the promoter region of these genes, YAP might cooperate with b-catenin, as in the case of mouse cardiomyocytes. YAP and TAZ bind to b-catenin To gain insight into the mechanism by which YAP and TAZ suppress the apparent TCF activity, we examined whether YAP and TAZ physically interact with b-catenin. Flag YAP2 and HA b-catenin were expressed in 293T cells and subjected to immunoprecipitation with an anti-flag antibody. HA bcatenin was co-precipitated with Flag YAP2 (Figure 2A), suggesting that YAP interacts with b-catenin. Similarly, TAZ was also co-precipitated with b-catenin (Figure 2B). We then investigated the binding between endogenous YAP and b- catenin in Caco-2 cells, and found that endogenous b-catenin was co-precipitated with endogenous YAP (Figure 2C). This suggests the interaction between the endogenous proteins. To examine whether YAP directly binds to b-catenin, we assayed the binding by using purified proteins. Recombinant YAP (1 291 a.a.) was bacterially expressed, purified, and subjected to pulldown assays with GST or GST b-catenin. The purified YAP was co-precipitated with GST b-catenin but not with GSTalone (Figure 2D). This result indicates that YAP 111 The EMBO Journal VOL 31 NO & 212 European Molecular Biology Organization

3 A Relative luciferase activity YAP2 Relative luciferase activity TAZ B FOPFlash TOPFlash HA β-catenin Flag YAP2 Flag TAZ α-α-tubulin C Relative luciferase activity 2 1 D HA β-catenin Flag YAP2 CHX (h) YAP2 WT S33Y S37A α-α-tubulin E 5 Relative mrna level Relative mrna level shlacz shyap#1 shyap#2 YAP CTGF CCND1 CD44 c-myc ENC1 EphB2 Pla2g2a Sox9 WISP1 Figure 1 YAP and TAZ suppress Wnt signalling without suppressing the stability of b-catenin. (A) Transcriptional activation of reporter plasmids expressing luciferase under the control of tandem repeats of a TCF binding site (TOPFlash) or a mutated one (FOPFlash) was evaluated in 293T cells transfected with an empty vector, or expression plasmids for HA b-catenin, Flag YAP2, and/or Flag TAZ (mean±s.e.m., n ¼ 3). Significant differences between indicated samples are marked by asterisks (Po.5, Student s t-test). (B) Expression levels of HA b-catenin, Flag YAP2, and/or Flag TAZ in 293T cells were analysed by immunoblotting with indicated antibodies. (C) Transcriptional activation of the TOPFlash reporter plasmid was evaluated in 293T cells expressing wild-type (WT) or mutant forms of HA b-catenin (S33Y and S37A), and/or Flag-YAP2 (mean±s.e.m., n ¼ 3). Po.5. (D) The effect of YAP overexpression on the stability of b-catenin. HA b-catenin and Flag YAP2 were expressed as in (B). Cells were treated with cycloheximide (CHX) (2 mg/ml) for the indicated hours. (E) Knockdown of YAP promotes expression of Wnt-target genes in Caco-2 colorectal cancer cells. Expression levels of indicated mrnas in cells infected with a lentivirus expressing a control shrna (shlacz) or shrnas against YAP (shyap#1 or #2) were analysed by quantitative RT PCR (mean±s.e.m., n ¼ 3). Po.5. directly binds to b-catenin. Previously, Heallen et al (211) reported that, in mouse cardiomyocytes, YAP and b-catenin are recruited to Sox2 and Snai2 genes through TEAD and TCF transcription factors, respectively, and that YAP and b-catenin can be co-precipitated from mouse heart lysates (Heallen et al, 211). However, it was not known whether YAP directly binds to b-catenin. Our results here demonstrate that YAP directly binds to b-catenin. Since YAP has been shown to be phosphorylated by Lats1/2, we inquired whether the phosphorylated YAP binds to b- catenin. To this end, recombinant YAP was phosphorylated in vitro by Lats2, which was expressed in 293T cells and purified, and then the resultant phosphorylated form of YAP was subjected to the pulldown assay with GST b-catenin. The phosphorylated YAP was co-precipitated with GST b-catenin but not with GST alone (Figure 2E). This indicates that the phosphorylated YAP is able to bind to b-catenin. We next investigated which region of YAP is responsible for its binding to b-catenin. We generated deletion mutants of YAP2, which lack the TEAD-binding domain (1 153 a.a., DTEAD-BD), two WW domains ( a.a., DWW), and the C-terminal domain ( a.a., DC), respectively (Figure 3A, left). Co-immunoprecipitation assays with these mutants demonstrated that YAP2-DWW and -DC, but not YAP2-DTEAD-BD, bind to b-catenin (Figure 3A, right). Therefore, TEAD-BD of YAP should be responsible for binding to b-catenin. We then determined which region of b-catenin is required for its binding to YAP. Co-immunoprecipitation assays with N- and C-terminus deletion mutants of b-catenin (Figure 3B, left) demonstrated that an N-terminal & 212 European Molecular Biology Organization The EMBO Journal VOL 31 NO

4 A Flag YAP2 HA β-catenin B Flag TAZ HA β-catenin C IgG IP α-yap IP IP: Flag Total lysate IP: Flag Total lysate α- α-yap YAP IgG D Pulldown GST GST β-catenin E Kinase assay: HA Lats2 α-pyap (Ser127) α-yap α-yap α-gst (GST β-catenin) α-gst (GST) α-pyap (Ser127) α-gst (GST β-catenin) α-gst (GST) Pulldown GST GST β-catenin Figure 2 YAP binds to b-catenin. (A, B) b-catenin is co-precipitated with YAP and TAZ. Lysates from 293Tcells expressing HA b-catenin, Flag YAP2 (A), and/or Flag TAZ (B) were subjected to immunoprecipitation with an anti-flag antibody. (C) Interaction between endogenous YAP and b-catenin. Caco-2 cell lysates were subjected to immunoprecipitation with an anti-yap antibody. (D) Interaction between purified YAP and b-catenin proteins. Bacterially expressed and purified YAP protein (1 291 a.a.) was subjected to the in-vitro pulldown assay with GSTor GST bcatenin. (E) Binding of phosphorylated YAP (Ser127) to b-catenin. Purified recombinant YAP was phosphorylated in vitro by Lats2. Efficient phosphorylation of YAP on Ser127 was confirmed by immunoblotting with an anti-phospho-yap (Ser127) antibody. The resultant phosphorylated form of YAP was used for the pulldown assay with GST or GST b-catenin. A Human YAP2 TEAD-BD WW domain TAD Flag YAP2 ΔTEAD-BD ΔWW ΔC HA β-catenin S127 ΔTEAD-BD IP: Flag ΔWW ΔC Total lysate B Armadillo repeat Human ΔC ΔN1 HA β-catenin Flag YAP2 ΔC HA β-catenin ΔN1 ΔN2 Flag YAP2 IP: Flag IP: Flag ΔN2 Total lysate Total lysate Figure 3 The TEAD-binding domain of YAP binds to the N-terminal region of b-catenin. (A) (Left) Schematic representation of YAP2 deletion mutants. (Right) Co-immunoprecipitation assays with HA b-catenin and the deletion mutants of Flag YAP2. (B) (Left) Schematic representation of b-catenin deletion mutants. (Right) Co-immunoprecipitation assays with Flag YAP2 and the deletion mutants of HA b-catenin. HA bcatenin-dc, but not HA b-catenin-dn1 and -DN2, was co-precipitated by Flag YAP The EMBO Journal VOL 31 NO & 212 European Molecular Biology Organization

5 A B C Relative luciferase activity YAP2 TOPFlash S33Y S33Y ΔN1 ΔN1 Flag YAP2 HA β-catenin WT E66A IP: Flag Total lysate Relative luciferase activity TEAD1 YAP2 WT S94A E66A D Flag Flag DAPI E Flag YAP2 WT E66A HA Dvl3 Flag YAP2-WT IP: Flag Flag YAP2-E66A α-pyap (S127) Flag HA Flag HA DAPI Total lysate HA Lats2 Flag YAP2-WT Flag YAP2-E66A F Relative luciferase activity TOPFlash YAP2 WT E66A HA β-catenin Flag-YAP2 α-α-tubulin WT E66A Figure 4 YAP binding to b-catenin plays a crucial role in suppressing Wnt/b-catenin signalling. (A) Transcriptional activation of the TOPFlash reporter plasmid was evaluated in 293Tcells transfected with an empty vector, or expression plasmids for b-catenin mutants (S33Yor DN1) and YAP2 (mean±s.e.m., n ¼ 3). (B) Co-immunoprecipitation assays with HA b-catenin and either wild-type Flag YAP2 or Flag YAP2-E66A. (C) Transcriptional activation of a reporter plasmid expressing luciferase under the control of tandem repeats of a TEAD binding site was evaluated in 293T cells transfected with an empty vector, or expression plasmids for TEAD1, wild-type YAP2, YAP2-S94A, and/or YAP2-E66A (mean±s.e.m., n ¼ 2). (D) Subcellular localization of YAP2-E66A is indistinguishable from that of wild-type YAP2. Preconfluent Caco-2 cells were transfected with expression plasmids for wild-type Flag YAP2, Flag YAP2-E66A, and/or HA Lats2, and stained by using anti-flag (green) and anti-ha (red) antibodies. (E) Co-immunoprecipitation assays with HA Dvl3, wild-type Flag YAP2, and/or Flag YAP2-E66A. (F) Transcriptional activation of the TOPFlash reporter plasmid was evaluated in 293T cells expressing HA b-catenin, wild-type Flag YAP2, and/or Flag YAP2-E66A (mean±s.e.m., n ¼ 5). Po.5. The expression levels of wild-type- and E66A-YAP2 in these cells were similar, as shown by immunoblotting (right). region of b-catenin ( 99 a.a.) is required for its binding to YAP (Figure 3B, middle and right). YAP binding to b-catenin plays a crucial role in suppressing Wnt/b-catenin signalling The above results led us to the idea that YAP binding to b-catenin should be central to the mechanism for YAPmediated suppression of Wnt/b-catenin signalling. Consistent with this idea, overexpression of YAP2 did not suppress the TOPFlash activity stimulated by the N-terminusdeleted mutant of b-catenin (b-catenin-dn1) (Figure 4A), which is incapable of binding to YAP (see Figure 3B) but capable of binding to TCF and promoting its transcriptional activity (Figure 4A). Remarkably, overexpression of YAP inhibited the TOPFlash activity induced by the stabilized form of b-catenin (S33Y-b-catenin) (Figure 4A). This indicates that YAP suppresses Wnt/b-catenin signalling independently of the stability of b-catenin protein. To further verify the importance of YAP-b-catenin binding in the suppression of Wnt signalling, we tried to generate a YAP mutant that was incapable of binding to b-catenin. We made several YAP2 mutants (YAP2-D6A, -D64A, -E66A, -K76A, -S94A, -D111A, -S127A, and -S131A), which harbour a point mutation at polar amino acids that are located in the TEAD-binding domain and are conserved between YAP and TAZ, and investigated their ability to bind to b-catenin. Among these YAP2 mutants, a mutant (YAP2-E66A), in which Glu66 was replaced by alanine, had a reduced ability to bind to b-catenin (Figure 4B). The other mutations in YAP2 did not significantly affect the interaction between YAP and b- catenin (Supplementary Figure S2). Before examining the action of the YAP2-E66A mutant on Wnt signalling, we compared it with wild-type YAP2 in well-known YAP functions. We first examined their function as a co-activator of TEAD. In the reporter assay with the construct expressing luciferase under the control of tandem repeats of a TEAD binding site, YAP2-E66A promoted transcriptional activity of TEAD1 as potently as wild-type YAP2 (Figure 4C). We next investigated their intracellular distribution. When overexpressed alone in Caco-2 cells, both wild-type YAP2 and & 212 European Molecular Biology Organization The EMBO Journal VOL 31 NO

6 YAP2-E66A were localized to both the nucleus and cytoplasm (Figure 4D). Overexpression of Lats2 promoted cytoplasmic localization of both wild-type YAP2 and YAP2-E66A (Figure 4D). As TAZ has been reported to bind to Dishevelled (Dvl), we examined whether wild-type YAP2 and YAP2-E66A bind to Dvl. The results showed that wildtype YAP2 and YAP2-E66A bind to Dvl to almost the same degree (Figure 4E). Remarkably, YAP2-E66A was phosphorylated at Ser127, which is a Lats1/2-mediated phosphorylation site, to the same extent as wild-type YAP2 (Figure 4E). Taken together, these results suggest that YAP2-E66A is indistinguishable from wild-type YAP2 in the TEAD co-activator function, subcellular localization, the Hippo pathway-dependent phosphorylation and distribution changes, and the ability to bind to Dvl, but has a reduced ability to bind to b-catenin as compared with wild-type YAP2. We then examined the effect of this mutant YAP on b-catenin signalling. The reporter assay showed that YAP2-E66A had a significantly reduced activity to suppress the b-catenin-induced activation of TCF (Figure 4F). This also indicates that YAP binding to b-catenin plays a crucial role in the suppression of Wnt/bcatenin signalling. The Hippo pathway suppresses Wnt/b-catenin signalling through inducing phosphorylation of YAP Activation of the Hippo pathway induces Lats1/2-mediated phosphorylation of YAP at Ser127 and subsequent cytoplasmic translocation of YAP. We then examined the role of the phosphorylation of YAP in its ability to suppress b-catenin signalling. We first used a mutant form of YAP (YAP2-S127A), in which Ser127 is replaced by alanine. It should be noted that YAP2-S127A has the ability to bind to b-catenin (Supplementary Figure S3). In contrast to wild-type YAP2, however, overexpression of YAP2-S127A did not suppress the b-catenin-induced activation of TCF in the reporter assay (Figure 5A), suggesting that phosphorylation of YAP at Ser127 is required for YAP to suppress b-catenin signalling. We then inquired whether upstream regulators of YAP in the Hippo pathway are also involved in the regulation of b-catenin signalling. Our reporter assays showed that overexpression of MST1 strongly suppressed the b-catenin-induced activation of TCF (Figure 5B), and that shrnamediated knockdown of WW45 or Lats2 significantly enhanced endogenous b-catenin/tcf activity in Caco-2 CRC cells (Figure 5C). The strong inhibitory effect of MST1 on the b-catenin activity might reflect the strong activity of MST1 to induce cytoplasmic translocation of YAP, or it might suggest the existence of additional mechanisms for the b-catenin inhibition. Remarkably, the knockdown of YAP did not significantly affect the TCF activity in WW45-knockdown cells, in which YAP should be localized to the nucleus (Figure 5C). This suggests that nuclear YAP is not required for global TCF activity in these cells, though YAP might be required for expression of common target genes of TCF and TEAD, such as CCND1 (see Figure 1E). Collectively, these results demonstrate that activation of the Hippo pathway suppresses nuclear b-catenin signalling probably through inducing phosphorylation of YAP at Ser127. Previous studies reported that the Hippo pathway is often inactivated in a number of cancers (Harvey and Tapon, 27; Pan, 21; Zhao et al, 21; Halder and Johnson, 211). We thus examined whether b-catenin signalling is activated in these cancers. To this end, we analysed published microarray data sets about human CRCs. We classified CRC samples into two categories based on the expression levels of several TEAD-target genes (CTGF, AREG, and BCL2L1). Hippo-Low was defined as a category of samples, in which the expression levels of TEAD-target genes were upregulated compared with those in normal colon; and therefore, the Hippo pathway signalling activity was assumed to be low, and the other samples were classified as the other category, termed as Hippo-High (Figure 5D). We then investigated expression profiles of the genes which have been identified as b-catenin/tcf-target genes in human colorectal adenomas and carcinomas (Van der Flier et al, 27; Supplementary Table S2). Our analysis showed that the expression levels of most of the b-catenin/tcf-target genes were increased in Hippo-Low CRCs, compared with those in normal colon and Hippo-High CRCs (Figure 5E). The percentage of the b-catenin/tcf-target genes, whose expression levels were upregulated in Hippo- Low CRCs as compared with those in Hippo-High, was significantly higher than that of the other genes (P ¼ 7.6e 62, Fisher s exact test; Figure 5F). We also found that the expression levels of several b-catenin/tcf-target genes (ENC1, MYC, SOX9, CD44, LGR5, and ASCL2), which play a crucial role in controlling intestinal homeostasis (Fujita et al, 21; van de Wetering et al, 22; Blache et al, 24; Lakshman et al, 25; Muncan et al, 26; Barker et al, 27; van der Flier et al, 29; de Lau et al, 211), were upregulated in Hippo-Low CRCs as compared with those in normal colon and Hippo-High CRCs (Figure 5G). These results suggest that downregulation of the Hippo pathway correlates with upregulation of b-catenin signalling in human CRCs. We then examined whether these events are associated with cancer progression in another microarray data set with information on cancer stages (Reid et al, 29). It was also observed in this data set that downregulation of the Hippo pathway is accompanied by upregulation of b-catenin signalling (Supplementary Figure S4A). Notably, downregulation of the Hippo pathway was observed at similar frequencies (about 5%) throughout all stages of CRCs (Supplementary Figure S4B). Thus, it is likely that inhibition of the Hippo pathway, which is accompanied by activation of b-catenin signalling, occurs in a subset of cancers, independently of their stages. It should be noted that these data do not necessarily imply that downregulation of the Hippo pathway is a cause of upregulation of b-catenin signalling in these cancers, as mutations in Wnt/b-catenin signalling components, which often occur in CRCs and activate b-catenin signalling, might affect the Hippo pathway activity. Thus, the effect of the Hippo signalling inhibition on b-catenin signalling in these cancers should be examined further. Hippo signalling activity suppresses Wnt/b-catenin signalling in Xenopus embryos To examine the role of YAP in the regulation of Wnt signalling in a more physiological context, we used developing Xenopus embryos, in which Wnt signalling determines patterning along the dorsoventral axis (Funayama et al, 1995). Ectopic expression of b-catenin in the ventral region of four-cell embryos results in axis duplication (see Figure 6A). Under the conditions used, the majority (about 8%) of the embryos displayed a complete duplication of the dorsoventral axis (Figure 6A). Co-expression of wild-type YAP2 significantly 1114 The EMBO Journal VOL 31 NO & 212 European Molecular Biology Organization

7 A Relative luciferase activity FOPFlash TOPFlash B Relative luciferase activity FOPFlash TOPFlash C Relative luciferase activity 2 1 Relative luciferase activity 2 1 YAP2 D WT S127A MST1 E shgfp shlats2 CRC shgfp shww45 shyap Relative mrna level _s_at _at BCL2L _s_at _at CTGF 25239_at AREG Normal colon CRC (Hippo-High) CRC (Hippo-Low) Normal colon Hippo-High Hippo-Low -3 3 TEAD target /TCF-target genes genes F /TCF-target genes (117) 6.% G % Other genes (19 728) Increased Unchanged Decreased Relative mrna level Normal colon CRC (Hippo-High) CRC (Hippo-Low) 15.2% 22.3% ENC1 MYC SOX9 CD44 LGR5 ASCL2 62.5% P = 7.6e 62 Figure 5 The Hippo pathway activation suppresses Wnt/b-catenin signalling through inducing phosphorylation of YAP. (A, B) Transcriptional activation of the TOPFlash and FOPFlash reporter plasmids was evaluated in 293Tcells expressing HA b-catenin, wild-type YAP2, YAP2-S127A (A), and/or MST1 (B) (mean±s.e.m., n ¼ 3). Po.5. (C) Transcriptional activation of the TOPFlash reporter plasmid was evaluated in Caco- 2 cells expressing a control shrna (shgfp), or shrnas against WW45, Lats2, and/or YAP (mean±s.e.m., n ¼ 3). Po.5. (D) The mrna expression levels of TEAD-target genes, BCL2L1, CTGF, and AREG, in normal colon (n ¼ 8), Hippo-Low CRCs (n ¼ 6), and Hippo-High CRCs (n ¼ 9). As for BCL2L1, there were three probe sets. Hippo-Low was defined as a category of samples, in which the average of the expression signals of the TEAD-target genes was upregulated by 42-fold compared with that in normal colon samples, and the other samples were classified as the other category Hippo-High. (E) Expression profiles of the b-catenin/tcf-target genes and the TEAD-target genes in normal colon (n ¼ 8), Hippo-Low CRCs (n ¼ 6), and Hippo-High CRCs (n ¼ 9). Each horizontal line displays the expression data for one gene. (F) The percentages of the b-catenin/tcf-target genes (n ¼ 117) and the other genes (n ¼ ) whose expression levels in Hippo-Low CRCs are increased (red) or decreased (green) by 41.5-fold, as compared with those in Hippo-High CRCs, are shown. (G) The mrna expression levels of TCF-target genes, ENC1, MYC, SOX9, CD44, LGR5, and ASCL2, in normal colon, Hippo-Low CRCs, and Hippo-High CRCs. suppressed the b-catenin-induced axis duplication (Figure 6A). Notably, YAP2-E66A had a significantly reduced activity to suppress the b-catenin-induced axis duplication (Figure 6A). These results suggest that YAP suppresses Wnt/b-catenin signalling through binding to b-catenin not only in cultured cells but also in Xenopus embryos. We thus explored whether & 212 European Molecular Biology Organization The EMBO Journal VOL 31 NO

8 A Uninjected P =6.9e 49 P =1.3e 6 n =44n =57 n =53 n =6 1 8 YAP2-WT YAP2-E66A % Of embryos Axis duplication Normal Partial Complete YAP2 WT E66A B EGFP YAP 1 Dorsal bending P = 5.e 17 Lats1 YAP Lats1 % Of embryos P = 1.2e 14 P = 7.7e 4 C Lateral view Dorsal view EGFP (n =43) YAP (n =51) Lats1 (n =53) YAP Lats1 (n =5) Uninjected P = 5.2e 3 n =32 n =32 n =32 1 Control MO β-catenin % Of embryos Axis duplication Normal Partial Complete Lats1 MO β-catenin MO Cont. Lats1 Figure 6 Hippo signalling activity suppresses Wnt/b-catenin signalling in Xenopus embryos. (A) Xenopus embryos were injected ventrally at the four-cell stage with b-catenin mrna in the presence or absence of wild-type YAP2 mrna or YAP2-E66A mrna. The injection of b-catenin mrna induced a duplication of the dorsoventral axis, which was suppressed by co-injection of wild-type YAP2 mrna. Note that, compared with wild-type YAP2, YAP2-E66A displays significantly reduced activity to suppress the b-catenin-induced axis duplication. (Right) Quantification of the different phenotypes from four independent experiments. Three categories: complete secondary axis (with cement gland), partial secondary axis (i.e., incomplete secondary axis, such as an axis lacking the cement gland and an axis-like posterior protrusion), and normal (only one axis). P-values are according to Pearson s w 2 -test for count data. (B) The indicated mrnas were injected into the dorsal region of four-cell stage embryos. Overexpression of YAP and Lats1 induced axis elongation defects and dorsal bending. (Right) Quantification of the percentages of embryos exhibiting dorsal bending. P-values are according to Pearson s w 2 -test for count data. (C) A low dose of the b- catenin mrna was injected into the ventral region of four-cell stage embryos in combination with either control morpholino oligonucleotides (MOs) or Lats1 MO. Injection of b-catenin with Lats1 MO more strongly induced axis duplication than injection of b-catenin with control MO. Black arrowheads indicate secondary axes. (Right) The results were quantified and statistical analyses were performed as in (A). manipulation of the Hippo pathway activity affects endogenous Wnt/b-catenin signalling in Xenopus embryos. To this end, YAP and/or Lats1 were ectopically expressed in the dorsal region of the embryos. Ectopic expression of YAP alone weakly induced axis elongation defects and dorsal bending (Figure 6B), the phenotypes resembling those caused by the inhibition of Wnt signalling (Angers et al, 26; Lyons et al, 29). Ectopic expression of Lats1 caused these phenotypes more strongly (Figure 6B). The severest phenotypes were observed when both YAP and Lats1 were expressed (Figure 6B). Since ectopic 1116 The EMBO Journal VOL 31 NO & 212 European Molecular Biology Organization

9 expression of YAP and Lats1 might have divergent effects, it would be difficult to conclude that these phenotypes result solely from the inhibition of Wnt/b-catenin signalling. However, these results are in good agreement with the idea that Hippo signalling activation suppresses Wnt/b-catenin signalling. To further examine the involvement of the Hippo pathway in regulating Wnt/b-catenin signalling, we next inquired whether inhibition of endogenous Hippo signalling activity results in enhancement of Wnt/b-catenin signalling. To this end, we injected a low dose of the b-catenin mrna with either control- or Lats1-antisense morpholino oligonucleotides (MOs), which downregulates Xenopus Lats1. While injection of b-catenin with control MO only weakly induced axis duplication (Figure 6C), injection of b-catenin with Lats1 MO more strongly induced axis duplication (Figure 6C). This result suggests that the endogenous Hippo pathway activity has a potential to regulate Wnt/b-catenin signalling in Xenopus embryos. Hippo pathway activation suppresses nuclear translocation of b-catenin Since the Hippo pathway-induced phosphorylation of YAP results in its cytoplasmic localization, we hypothesized that phosphorylated YAP retains b-catenin in the cytoplasm through directly binding to it. To test this, we firstly examined whether endogenous YAP colocalizes with b-catenin in Caco- 2 CRC cells. When cells were plated at low density, YAP was predominantly localized to the nucleus in most cells (about 9%) (Figure 7A, upper). In a minor population of cells, YAP was localized to both the cytoplasm and the nucleus, or to the cytoplasm (Figure 7A, lower). Remarkably, while b-catenin was localized to both the nucleus and the cell cell junctions in cells exhibiting nuclear YAP, nuclear localization of b- catenin was reduced in cells exhibiting cytoplasmic YAP (Figure 7A and B). These results are consistent with the idea that YAP regulates subcellular localization of b-catenin. To further examine this idea, we used a mutant form of YAP2, in which a nuclear localization signal of the simian virus 4 T antigen was fused to the N-terminus of YAP2 (NLS-YAP2). When expressed in 293T cells, NLS-YAP2 was strongly localized to the nucleus (Figure 7C). Remarkably, the expression of NLS-YAP2 markedly promoted nuclear localization of b-catenin (Figure 7C and D), suggesting the physical interaction of YAP with b-catenin in cells. We then examined whether the Hippo pathway activation affects subcellular distribution of b-catenin. To this end, Lats2 was expressed in preconfluent Caco-2 cells. Consistent with previous reports, expression of Lats2 induced cytoplasmic translocation of YAP (Supplementary Figure S5A). Importantly, in the cells expressing Lats2, nuclear accumulation of b-catenin was markedly reduced, and concomitantly, cytoplasmic localization of b-catenin (including b-catenin in cell cell junctions) was increased (Figure 7E, left; Figure 7F, lanes 1 and 2). Similar results were obtained in 293T cells (Supplementary Figure S5B). Remarkably, knockdown of YAP by an shrna significantly suppressed the Lats2-promoted cytoplasmic localization of b-catenin (Figure 7E and F). The effect of the YAP knockdown was slightly enhanced by additional knockdown of TAZ (Figure 7E and F). These results suggest that activation of the Hippo pathway promotes cytoplasmic localization of b-catenin through YAP and TAZ. To examine this idea, we generated a phospho-mimetic mutant of YAP2 (YAP2-S127D), in which a Lats-mediated phosphorylation site (Ser127) was replaced by aspartic acid. When expressed at low to moderate levels in Caco-2 cells, YAP2-S127D was preferentially localized to the cytoplasm (Figure 7G). When highly overexpressed, YAP2-S127D was distributed throughout the cell (data not shown). We then examined the effect of YAP-S127D expression on the intracellular distribution of b-catenin. Immunofluorescent images showed that YAP2- S127D expression promoted cytoplasmic localization of b-catenin (Figure 7G and H). Notably, introducing the E66A mutation, which reduces the ability of YAP to bind to b- catenin (see Figure 4B), abrogated the ability of YAP2-S127D to promote cytoplasmic localization of b-catenin (Figure 7G and H). Collectively, these results strongly suggest that phosphorylated YAP retains b-catenin in the cytoplasm by binding to it. Discussion The Hippo pathway plays a key role in regulating organ size, tissue homeostasis, and patterning (Edgar, 26; Harvey and Tapon, 27; Pan, 21; Zhao et al, 21; Halder and Johnson, 211). A key issue regarding the Hippo pathway is how this pathway cooperates with other signalling pathways in regulating a variety of biological processes. Remarkably, recent studies have shown that the Hippo pathway genetically and functionally interacts with Wnt/b-catenin signalling (Varelas et al, 21; Heallen et al, 211). However, molecular bases for this interaction have not been fully understood. In this study, we have identified a novel mechanism through which activation of the Hippo pathway inhibits Wnt/b-catenin signalling. Our initial observation is that YAP and TAZ suppress b-catenin-stimulated expression of Wnt-target genes without suppressing the stability of b-catenin. We then demonstrate that both YAP and TAZ have the ability to bind to b-catenin, and show that the TEAD-binding domain of YAP binds to the N-terminal region of b-catenin. By generating a YAP mutant (YAP2-E66A) and a b-catenin mutant (DN1), both of which are defective in the binding, we then demonstrate that YAP-bcatenin binding plays a key role in the YAP-dependent suppression of b-catenin signalling. Importantly, the Hippo pathway-dependent phosphorylation of YAP at Ser127, which induces cytoplasmic translocation of YAP, is required for the suppression of b-catenin signalling. Moreover, our results show that phosphorylated YAP retains b-catenin in the cytoplasm through its binding to b-catenin. Taken together, these results show that, upon activation of the Hippo pathway, YAP and TAZ suppress Wnt signalling by retaining b-catenin in the cytoplasm (see Figure 8). Varelas et al (21) reported that TAZ binds to Dishevelled (Dvl) and suppresses its phosphorylation, an event that precedes b-catenin stabilization in Wnt signalling (Varelas et al, 21). Our result that YAP also binds to Dvl suggests an analogous function of YAP, though the role of Dvl phosphorylation in Wnt signalling is yet to be fully elucidated (Gao and Chen, 21). Importantly, our results here demonstrate that the Hippo signalling pathway suppresses the action of even the stabilized form of b-catenin and that the Hippo pathway suppresses Wnt signalling even in CRC cells, in which b-catenin is constitutively stabilized by a mutation in APC. These findings cannot be explained by the suppression of Dvl & 212 European Molecular Biology Organization The EMBO Journal VOL 31 NO

10 A YAP DAPI B 1 P = 9.4e 38 C % Of cells N < C N = C N > C NLS-YAP2 YAP N > C N = C or N < C DAPI NLS-YAP2 D P = 1.9e 2 E DsRed DAPI HA-Lats2 DAPI 1 8 DsRed shlacz HA Lats2 shyap % Of cells 6 4 N < C N = C N > C HA Lats2 DAPI HA Lats2 DAPI 2 NLS-YAP2 HA Lats2 shlacz HA Lats2 shyap shtaz F P = 4.e 4 P = 1.8e 5 P =.3 1 G DsRed DsRed DAPI H P =1.9e 4 P =4.3e 4 1 % Of cells N < C N = C N > C YAP2-S127D YAP2 DAPI % Of cells N < C N = C N > C HA Lats2 shyap shtaz shlacz YAP2-S127D/ E66A YAP2 S127D S127D/ E66A Figure 7 The Hippo pathway activation suppresses nuclear translocation of b-catenin. (A) Subcellular localization patterns of endogenous YAP (red) and b-catenin (green) in preconfluent Caco-2 CRC cells are shown. (B) Quantitative analysis of the results in (A). Subcellular localization of b-catenin was scored as follows: N4C, predominantly nuclear; n ¼ C, evenly distributed between the nucleus and the cytoplasm; NoC, predominantly cytoplasmic. P-values are according to Pearson s w 2 -test for count data. (C, D) Overexpression of NLS-YAP2 promotes nuclear localization of b-catenin in 293Tcells. (C) Subcellular localization patterns of HA b-catenin (green) in cells transfected with a control plasmid or an expression plasmid for Flag NLS-YAP2 (red) are shown. Arrowheads indicate cells expressing HA b-catenin with or without NLS-YAP2. (D) Quantification of the results in (C) was performed as in (B). (E, F) Overexpression of Lats2 promotes cytoplasmic localization of b-catenin in a YAP/TAZ-dependent manner in Caco-2 cells. (E) Subcellular localization patterns of endogenous b-catenin in cells expressing DsRed or HA Lats2 are shown (green). Cells were also transfected with control shrna (shlacz), YAP shrna, and/or TAZ shrna. Arrowheads indicate cells expressing DsRed or HA Lats2 (red). (F) Quantification of the results in (E) was performed as in (B). (G, H) Overexpression of the phospho-mimetic mutant of YAP promotes cytoplasmic localization of b-catenin. (G) Subcellular localization patterns of endogenous b-catenin (green) in Caco-2 cells expressing DsRed, Flag YAP2-S127D, or Flag YAP2-S127D-E66A (red) are shown. Note that expression of Flag YAP2-S127D but not that of YAP2-S127D-E66A inhibits nuclear localization of b-catenin. (H) Quantification of the results in (G) was performed as in (B). phosphorylation. Thus, we can speculate that another mechanism should also operate to suppress Wnt signalling. In this study, we show that the Hippo signalling pathway suppresses Wnt signalling through preventing nuclear translocation of b- catenin. This mechanism is consistent with all the observations above and all the previous findings, in which the Hippo pathway inactivation promotes nuclear accumulation of b-catenin as well as expression of Wnt-target genes in mice and fruit flies (Varelas et al, 21; Heallen et al, 211). Therefore, this mechanism may play an important role in the Hippo pathway-dependent suppression of Wnt/b-catenin signalling. It should be noted that, in mouse cardiomyocytes, nuclear YAP binds to and cooperates with b-catenin to promote expression of several genes involved in heart development; and thus, the Hippo pathway-induced cytoplasmic translocation of YAP suppresses expression of these genes (Heallen et al, 1118 The EMBO Journal VOL 31 NO & 212 European Molecular Biology Organization

11 Frizzled Ck1δ/ε Wnt P Dvl TCF/LEF TCF-target genes P YAP/TAZ TCF/LEF Dvl P YAP/TAZ YAP/TAZ TEAD P YAP/TAZ TCF/TEAD common-target genes YAP/TAZ TEAD TEAD-target genes Hippo signalling YAP/TAZ Figure 8 Schematic representation of the interactions between the Hippo and Wnt/b-catenin signalling pathways, based on Varelas et al (21), Heallen et al (211) and this study. The Hippo pathway activation induces phosphorylation and subsequent cytoplasmic translocation of YAP and TAZ, thereby suppressing TEAD-target gene transcription. At the same time, phosphorylated YAP and TAZ in the cytoplasm bind to Dvl and suppress its phosphorylation (Varelas et al, 21). Moreover, YAP and TAZ bind to b-catenin and suppress its nuclear translocation (this study). In cardiomyocytes, YAP and b-catenin are recruited to common target genes (including Sox2 and Snai2) through TEAD and TCF transcription factors, respectively, and cooperatively activate these genes (Heallen et al, 211). The Hippo pathway activation-induced cytoplasmic translocation of YAP suppresses expression of these genes (Heallen et al, 211). Thus, the Hippo pathway activation suppresses Wnt/bcatenin signalling through multiple mechanisms. 211). This mechanism might operate in many biological processes. Our result that cyclin D1 (CCND1) is a common target of YAP and b-catenin in colon cancer cells is consistent with this idea. Thus, the Hippo pathway might inhibit multiple steps in Wnt/b-catenin signalling: (1) Dvl phosphorylation, (2) nuclear accumulation of b-catenin, and (3) transcription of b-catenin/ TCF-targetgenes(seeFigure8).Importantly,thephysiological role of the interaction between YAP/TAZ and b-catenin has been shown only in the embryonic mouse heart and not in any other tissues. This issue should be addressed in future studies. YAP and TAZ have been shown to act as a transcriptional co-activator of TEAD transcription factors to promote cell proliferation and survival in many tissues (Goulev et al, 28; Wu et al, 28; Zhang et al, 28; Zhao et al, 28). The Hippo pathway activation results in the inhibition of the transcriptional activity of YAP and TAZ to prevent excessive cell proliferation and to promote apoptosis (Huang et al, 25; Dong et al, 27; Zhao et al, 27; Lei et al, 28). Inactivation of the Hippo pathway or overexpression of YAP results in tissue overgrowth, ultimately leading to tumourigenesis. Our results here show that the Hippo pathway activation induces the suppression of the transcriptional activity of b-catenin through preventing its nuclear translocation. Thus, the Hippo pathway activation inhibits the action of the two distinct groups of transcriptional co-activators simultaneously. Remarkably, Wnt/b-catenin signalling contributes to proliferation of stem cells and/or progenitor cells in many tissues (Moon et al, 24; Nusse, 25; Clevers, 26). Therefore, the Hippo pathway-dependent regulation of b-catenin is considered as a fail-safe mechanism that ensures the suppression of dysregulated cell proliferation. Consistent with this notion, a previous study has shown that inactivation of the Hippo pathway in the developing mouse heart induces a cardiomyocytes overgrowth phenotype and that this phenotype is rescued by heterozygous deletion of b-catenin (Heallen et al, 211). Interestingly, both the Hippo pathway inactivation and the Wnt/b-catenin signalling activation are implicated in a number of cancers (Nusse, 25; Barker and Clevers, 26; Clevers, 26; Harvey and Tapon, 27; Pan, 21; Zhao et al, 21), suggesting that disruption of the Hippo pathway-dependent regulation of Wnt/b-catenin signalling should occur in cancers. Indeed, our results here show that downregulation of Hippo signalling correlates with upregulation of Wnt/b-catenin signalling in human CRCs. Importantly, our results also demonstrate that the Hippo pathway activation suppresses the action of even the tumour-derived stabilized form of b-catenin and that the Hippo pathway activation suppresses Wnt signalling even in CRC cells, in which b-catenin is constitutively stabilized by a mutation in APC. These results suggest that forced activation of the Hippo pathway would be a novel strategy for inhibiting Wnt signalling in cancer therapy and prevention. It will be interesting to examine whether the Hippo pathway activation could suppress oncogenesis driven by the activation of Wnt/b-catenin signalling. In summary, our results identify a novel mechanism through which the Hippo signalling pathway generally antagonizes Wnt/b-catenin signalling. Given that both the Hippo and Wnt signalling pathways are involved in a wide variety of cellular functions, our finding should provide novel insights into molecular bases for many biological processes. Materials and methods Cell culture Caco-2, HT-29, and HEK293T cells were obtained from American Type Culture Collection and maintained in DMEM supplemented with 1% FBS, 2 mm glutamine, and antibiotics (1 U/ml of penicillin and.2 mg/ml of kanamycin). Transfection of plasmids was performed with LipofectAMINE PLUS transfection reagent (Invitrogen) according to the manufacturer s protocol. Plasmids and antibodies To construct expression plasmids for YAP2, TAZ, Lats2, MST1, WW45, and b-catenin, cdnas were PCR amplified and cloned into a pcdna3 vector or a CSII vector. Antibodies used in this study are as follows: b-catenin (BD Transduction Laboratory), YAP (Santa Cruz Biotechnology, H-125), phosphor-yap (S127) (Cell Signaling), Flag (Sigma, M2), HA (Covance, 16B12), and a-tubulin (Sigma, DM1A). Preparation of lentiviral vectors Constructs expressing shrnas against YAP, WW45, and Lats2 were made by subcloning the following oligonucleotides into a CSII-U6- MCS-puro vector (Okamoto et al, 26) with the ApaI/EcoRI sites. WW45-sense, 5 -GACTCTGGTTCCCGATATTCTCAAGAGAAATATCG GGAACCAGAGTCTCTTTTTT-3 ; WW45-antisense, 5 -AATTAAAAAA GAGACTCTGGTTCCCGATATTTCTCTTGAGAATATCGGGAACCAGAGTC GGCC-3 ; Lats2-sense, 5 -GGGTGGTCAAACTCTACTATTCAAGAGATA & 212 European Molecular Biology Organization The EMBO Journal VOL 31 NO