Exploring the Connection between Sequence and Coordinated Gene Activity for Adjacent Promoter Pairs
|
|
|
- Poppy Kimberly Bishop
- 5 years ago
- Views:
Transcription
1 Exploring the Connection between Sequence and Coordinated Gene Activity for Adjacent Promoter Pairs Ameen Salem and Marc S. Halfon Department of Biochemistry NYS Center of Excellence Bioinformatics & Life Sciences University at Buffalo
2 What is a genome? C T G A A Adenosine C Cytosine G Guanine T Thymine
3 Promoter-CRM specificity some DNA sequence TTGGCCGCTCCCAGCGACGGCGG... TAAAAGGGCGCTGAGAGCAGCACAC cis-regulatory module (CRM)... promoter coding region gene coding region promoter... coding region promoter... X CRM... promoter coding region... promoter coding region X
4 Hypothesis Adjacent promoters with coordinated control will have similar sequences whereas those not coordinately regulated will have dissimilar sequences coding region promoter... coding region promoter... CRM... promoter coding region... promoter coding region X Interactions with CRMs simply based on proximity would lead us to expect that adjacent promoters are always co-regulated Cases show specifcity of CRM-promoter interactions
5 Activity of Adjacent Promoters Observations: 6967 Range : -0.74, 1.0 Mean : 0.22 Median : 0.23 p value : 1.2e-283 Observations : Range : -0.87, 1.0 Mean : 0.07 Median : 0.06 RAMPAGE profiling (Genome Res. 23:169)
6 Measuring Sequece Similarity - N2 Scoring An alignment-free sequence similarity measure Used to compare promoter sequences Scoring : 1 is most similar -1 is most dissimilar Promoter length measurement: From start site (-120bp, +40bp) start site (TSS) A C C A A C T A T A A G G upstream intergenic region promoter coding region A G C T T A T A A T G C C 120 bp 40 bp
7 Sequence Similarity of Adjacent Promoters Observations : 6023 Range : -0.23, 1.00 Mean : 0.13 Median : 0.05 p value : 1.24e-207 Observations : Range : -0.27, 0.78 Mean : 0.02 Median : 0.02
8 Sequence Similarity vs Expression Correlation Strong Correlations R value : R 0.9 R value : 0.01 R -0.9
9 Data from a Homogeneous Cell Type S2 cells, a popular Drosophila cell line Cell line : a population of cells derived from a single cell All cells therefore are expressing the same genes (no cell differentiation) Expression levels measured at single discrete instance (no time course) Expression level measurements: Digital : Any measurable signifies promoter activity Continuous : Define a measure to evaluate expression
10 Digital Description Co-expression vs Sequence Similarity Groupings are as follows: TSS TSS co-expressed ON/ON promoter A promoter B TSS ON/OFF promoter A Promoter B co-expressed OFF/OFF promoter A promoter B S2 cells (Cell Rep. 2:1025)
11 Defining Continuous Measure A pair of promoters with TSS scores that vary greatly should have a different co-expression description than a pair with identical peaks This measure ranges from 0 to 1, with 0 being the highest level of coexpression and 1 being the lowest Scoring formula : m = Difference of maximum TSS scores sum of maximum TSS scores No additional conclusions were drawn from continuous measure results
12 Conclusions We have not yet found support for our hypothesis that co-regulated promoters share similar sequences We used different data in an effort to more accurately describe promoter activity Using N2 scoring to measure sequence similarity may be more apt for comparing sets of sequences as opposed to individual pairs Shift in focus now is to explore alternatives to quantifying promoter similarity
13 New Directions Motifs are short recurring patterns of DNA in promoters Often indicate sequence-specific start sites, within promoter Presence can classify promoter classes cis-regulatory module... promoter coding region Promoter A Promoter B
14 Acknowledgements Marc S. Halfon, Ph.D., Department of Biochemistry, University at Buffalo John Ringland, Ph.D., Department of Mathematics, University at Buffalo This work was supported by the NSF CSUMS program, grant DMS to the University at Buffalo.
Results. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data
Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis Shisong Ma 1,2*, Michael Snyder 3, and Savithramma P Dinesh-Kumar 2* 1 School of Life Sciences, University
Chemistry 2050 Introduction to Organic Chemistry Fall Semester 2011 Dr. Rainer Glaser
Chemistry2050 IntroductiontoOrganicChemistry FallSemester2011 Dr.RainerGlaser Examination #5: The Final Lipids, Carbohydrates, Nucleobases & DNA. Monday, December 12, 2011, 10 am 12 pm. Name: Answer Key
MODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
Chemistry 2030 Introduction to Organic Chemistry Fall Semester 2012 Dr. Rainer Glaser
Chemistry 2030 Introduction to Organic Chemistry Fall Semester 2012 Dr. Rainer Glaser Examination #5: The Final Lipids, Carbohydrates, Nucleobases & DNA. Monday, December 10, 2012, 3 5 pm. Name: Question
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
Sections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Now that the DNA has been copied, it needs to send its genetic message to the ribosomes so proteins can be made Transcription: synthesis (making of) an RNA molecule from a DNA
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed
Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
Chapter 1. Introduction
Chapter 1 Introduction 1.1 Motivation and Goals The increasing availability and decreasing cost of high-throughput (HT) technologies coupled with the availability of computational tools and data form a
ChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine?
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? by Robert John Hollows This project is submitted in partial fulfilment of the requirements
Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
Statistical analysis of RIM data (retroviral insertional mutagenesis) Bioinformatics and Statistics The Netherlands Cancer Institute Amsterdam
Statistical analysis of RIM data (retroviral insertional mutagenesis) Lodewyk Wessels Bioinformatics and Statistics The Netherlands Cancer Institute Amsterdam Viral integration Viral integration Viral
ChIP-seq analysis. J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand
ChIP-seq analysis J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand Tuesday : quick introduction to ChIP-seq and peak-calling (Presentation + Practical session)
High Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
PhysicsAndMathsTutor.com. Question Number. Answer Additional Guidance Mark. 1(a) 1. mutation changes the sequence of bases / eq ;
1(a) 1. mutation changes the sequence of bases / eq ; 2. reference to stop code / idea of {insertion / deletion / eq} changes all triplets / frame shift / eq ; 3. {transcription / translation} does not
(A) Hydrophobic (B) Hydrophilic (C) Both A & B (D) Amphipathic (E) All of the answers above are correct.
Biochemistry - Problem Drill 03: Introduction to Biochemistry No. 1 of 10 1. Based on their affinity for water, molecules are classified into? (A) Hydrophobic (B) Hydrophilic (C) Both A & B (D) Amphipathic
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
MBios 478: Systems Biology and Bayesian Networks, 27 [Dr. Wyrick] Slide #1. Lecture 27: Systems Biology and Bayesian Networks
![MBios 478: Systems Biology and Bayesian Networks, 27 [Dr. Wyrick] Slide #1. Lecture 27: Systems Biology and Bayesian Networks](/thumbs/80/82116384.jpg "MBios 478: Systems Biology and Bayesian Networks, 27 [Dr. Wyrick] Slide #1. Lecture 27: Systems Biology and Bayesian Networks")
MBios 478: Systems Biology and Bayesian Networks, 27 [Dr. Wyrick] Slide #1 Lecture 27: Systems Biology and Bayesian Networks Systems Biology and Regulatory Networks o Definitions o Network motifs o Examples
Chapter 1 Heredity. Prepared by: GOAD s Team
Chapter 1 Heredity Prepared by: GOAD s Team IMPORTANT VOCABULARY WORDS Traits Character Genes Allele Genotype homozygote heterozygote Dominant recessive phenotype WHAT IS HEREDITY? HEREDITY - is a passing
Biological Molecules
The Chemical Building Blocks of Life Chapter 3 Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form up to 4 covalent bonds. Carbon may
The Chemical Building Blocks of Life. Chapter 3
The Chemical Building Blocks of Life Chapter 3 Biological Molecules Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form up to 4 covalent
Most life processes are a series of chemical reactions influenced by environmental and genetic factors.
Biochemistry II Most life processes are a series of chemical reactions influenced by environmental and genetic factors. Metabolism the sum of all biochemical processes 2 Metabolic Processes Anabolism-
Bioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
Supplemental material: Interference between number magnitude and parity: Discrete representation in number processing
Krajcsi, Lengyel, Laczkó: Interference between number and parity Supplemental material 1/7 Supplemental material: Interference between number magnitude and parity: Discrete representation in number processing
Introduction to Macromolecules. If you were to look at the nutrition label of whole milk, what main items stick out?
Introduction to Macromolecules Macromolecules are a set of molecules that are found in living organisms. Macromolecules essentially mean big molecules as the word macro means large. The functions of these
Figure 1: Final annotation map of Contig 9
Introduction With rapid advances in sequencing technology, particularly with the development of second and third generation sequencing, genomes for organisms from all kingdoms and many phyla have been
Chapter 1: Introduction to Statistics
Chapter 1: Introduction to Statistics Variables A variable is a characteristic or condition that can change or take on different values. Most research begins with a general question about the relationship
Fatty acids and phospholipids
PYS 4xx Intro 2 1 PYS 4xx Intro 2 - Molecular building blocks We now describe in more detail the nomenclature and composition of several classes of compounds of relevance to the cell, including: membrane
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Biological Molecules
Chemical Building Blocks of Life Chapter 3 Biological Molecules Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form up to 4 covalent
Peak-calling for ChIP-seq and ATAC-seq
Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq
Many of the compounds we are concerned with in biology are carbon-based compounds The study of carbon-based compounds is called organic chemistry
1 2 3 4 Bio 1101 Lecture 3 Chapter 3: Molecules of Life Organic Molecules Many of the compounds we are concerned with in biology are carbon-based compounds The study of carbon-based compounds is called
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
MIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
Human beings contain tens of thousands of genes, the basic material for cell
II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes
Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
Activity: Biologically Important Molecules
Activity: Biologically Important Molecules AP Biology Introduction We have already seen in our study of biochemistry that the molecules that comprise living things are carbon-based, and that they are thought
MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
The Carbon Atom (cont.)
Organic Molecules Organic Chemistry The chemistry of the living world. Organic Molecule a molecule containing carbon and hydrogen Carbon has 4 electrons in its outer shell and can share electrons with
Carbon. Isomers. The Chemical Building Blocks of Life
The Chemical Building Blocks of Life Carbon Chapter 3 Framework of biological molecules consists primarily of carbon bonded to Carbon O, N, S, P or H Can form up to 4 covalent bonds Hydrocarbons molecule
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Introduction to Genetics & DNA {DNA
Introduction to Genetics & DNA {DNA What is Heredity? Heredity explains how traits may be passed from parents to offspring. Heredity People have bred plants and animals for thousands of years to get desirable
Preliminary Exercises for Factoring Quadratics (Two Numbers)
#3160b GLA Guided Learning Activity Preliminary Exercises for Factoring Quadratics (Two Numbers) This packet contains exercises to accompany GLA 3160. It is intended for student and tutor use as needed.
Measurement and meaningfulness in Decision Modeling
Measurement and meaningfulness in Decision Modeling Brice Mayag University Paris Dauphine LAMSADE FRANCE Chapter 2 Brice Mayag (LAMSADE) Measurement theory and meaningfulness Chapter 2 1 / 47 Outline 1
Integrated network analysis reveals distinct regulatory roles of transcription factors and micrornas
Integrated network analysis reveals distinct regulatory roles of transcription factors and micrornas Yu Guo 1,2,4, Katherine Alexander 1, Andrew G Clark 1, Andrew Grimson 1 and Haiyuan Yu 2,3* 1 Department
An informal analysis of multilevel variance
APPENDIX 11A An informal analysis of multilevel Imagine we are studying the blood pressure of a number of individuals (level 1) from different neighbourhoods (level 2) in the same city. We start by doing
Chapter 23 Carbohydrates and Nucleic Acids. Carbohydrates
Chapter 23 Carbohydrates and Nucleic Acids Carbohydrates Synthesized by plants using sunlight to convert CO 2 and H 2 O to glucose and O 2. Polymers include starch and cellulose. Starch is storage unit
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Doctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
REGRESSION MODELLING IN PREDICTING MILK PRODUCTION DEPENDING ON DAIRY BOVINE LIVESTOCK
REGRESSION MODELLING IN PREDICTING MILK PRODUCTION DEPENDING ON DAIRY BOVINE LIVESTOCK Agatha POPESCU University of Agricultural Sciences and Veterinary Medicine Bucharest, 59 Marasti, District 1, 11464,
Week 1 - Introduction
Genetics Summary 1 Week 1 - Introduction - Polygenic > traits with multiple genes - Gregor Mendel > predictable offspring (didn t work with polygenic) - Friedrich Miescher > discovered DNA in 1869-2 sister
Development of a NIST Standard Reference Material for Cytomegalovirus
Development of a NIST Standard Reference Material for Cytomegalovirus Marcia Holden, Ross Haynes, Margaret Kline, John Butler (with help from David Duewer (NIST) and Steve Ellison (LGC)) Group, Biochemical
One-Way ANOVAs t-test two statistically significant Type I error alpha null hypothesis dependant variable Independent variable three levels;
1 One-Way ANOVAs We have already discussed the t-test. The t-test is used for comparing the means of two groups to determine if there is a statistically significant difference between them. The t-test
2-3 Carbon Compounds 10/22/2013. The Chemistry of Carbon. More Carbon. Chemistry (cont) More Macromolecules. Macromolecules
The Chemistry of Carbon 2-3 Carbon Compounds Because of carbons 4 valence electrons it can form covalent bonds with many other elements (octet rule) 2 Chemistry (cont) Plus, it can bond with itself More
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
Processing of RNA II Biochemistry 302. February 18, 2004 Bob Kelm
Processing of RNA II Biochemistry 302 February 18, 2004 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation Discovered by P. Sharp and R. Roberts in late 1970s
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
3.0 DNA is the Inherited Material Responsible for Variation
2.2 Asexual and Sexual Reproduction Homework: p. 29 #1-3 p. 36 #1-6 Create a table that looks like this: Read pages 35-36 and fill in your table. Asexual Reproduction Sexual Reproduction Advantages Disadvantages
Alternative Splicing and Genomic Stability
Alternative Splicing and Genomic Stability Kevin Cahill cahill@unm.edu http://dna.phys.unm.edu/ Abstract In a cell that uses alternative splicing, the total length of all the exons is far less than in
V24 Regular vs. alternative splicing
Regular splicing V24 Regular vs. alternative splicing mechanistic steps recognition of splice sites Alternative splicing different mechanisms how frequent is alternative splicing? Effect of alternative
In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described
Supplemental Methods In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described previously 1 2 using 32P-labeled 211 bp fragment from 3 HS1. Footprinting reaction mixes contained
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
Learning Convolutional Neural Networks for Graphs
GA-65449 Learning Convolutional Neural Networks for Graphs Mathias Niepert Mohamed Ahmed Konstantin Kutzkov NEC Laboratories Europe Representation Learning for Graphs Telecom Safety Transportation Industry
All living things are mostly composed of 4 elements: H, O, N, C honk Compounds are broken down into 2 general categories: Inorganic Compounds:
Biochemistry Organic Chemistry All living things are mostly composed of 4 elements: H, O, N, C honk Compounds are broken down into 2 general categories: Inorganic Compounds: Do not contain carbon Organic
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
Processing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm
Processing of RNA II Biochemistry 302 February 14, 2005 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation (non proteincoding sequence) Discovered by P. Sharp
2 3 Carbon Compounds. Proteins. Proteins
2 3 Carbon Compounds Proteins Proteins Proteins are macromolecules that contain nitrogen, carbon, hydrogen, and oxygen. Proteins are polymers of molecules called amino acids. There are 20 amino acids,
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Types of macromolecules. Proteins. Amino acids 9/15/2010. Carbohydrates. Lipids. Proteins. Nucleic acids
Types of macromolecules Carbohydrates Lipids Proteins Nucleic acids Proteins Chief building blocks of life 1000s of proteins Lots of different functions, but all built the same way & from the same raw
MicroRNA-mediated incoherent feedforward motifs are robust
The Second International Symposium on Optimization and Systems Biology (OSB 8) Lijiang, China, October 31 November 3, 8 Copyright 8 ORSC & APORC, pp. 62 67 MicroRNA-mediated incoherent feedforward motifs
Organic Chemistry. Organic chemistry is the chemistry of carbon compounds. Biochemistry is the study of carbon compounds that crawl.
Organic Chemistry Organic chemistry is the chemistry of carbon compounds. Biochemistry is the study of carbon compounds that crawl. Organic Compounds - have carbon bonded to other atoms and determine structure/function
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Haipeng Xing, Yifan Mo, Will Liao, Michael Q. Zhang Clayton Davis and Geoffrey
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
Diploma in Equine Science
The process of meiosis is summarised in the diagram below, but it involves the reduction of the genetic material to half. A cell containing the full number of chromosomes (two pairs) is termed diploid,
Chapter 1: Exploring Data
Chapter 1: Exploring Data Key Vocabulary:! individual! variable! frequency table! relative frequency table! distribution! pie chart! bar graph! two-way table! marginal distributions! conditional distributions!
Chapter 2. Chemical Composition of the Body
Chapter 2 Chemical Composition of the Body Carbohydrates Organic molecules that contain carbon, hydrogen and oxygen General formula C n H 2n O n -ose denotes a sugar molecule Supply energy Glucose Complex
Organic Molecules. 8/27/2004 Mr. Davenport 1
Organic Molecules 8/27/2004 Mr. Davenport 1 Carbohydrates Commonly called sugars and starches Consist of C, H, O with H:O ration 2:1 Usually classified as to sugar units Monosaccharide are single sugar
Clustering mass spectrometry data using order statistics
Proteomics 2003, 3, 1687 1691 DOI 10.1002/pmic.200300517 1687 Douglas J. Slotta 1 Lenwood S. Heath 1 Naren Ramakrishnan 1 Rich Helm 2 Malcolm Potts 3 1 Department of Computer Science 2 Department of Wood
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Title: Dengue Score: a proposed diagnostic predictor of pleural effusion and/or ascites in adult with dengue infection
Reviewer s report Title: Dengue Score: a proposed diagnostic predictor of pleural effusion and/or ascites in adult with dengue infection Version: 0 Date: 11 Feb 2016 Reviewer: Anthony Jin Shun Chua Reviewer's
STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
Transcript-indexed ATAC-seq for immune profiling
Transcript-indexed ATAC-seq for immune profiling Technical Journal Club 22 nd of May 2018 Christina Müller Nature Methods, Vol.10 No.12, 2013 Nature Biotechnology, Vol.32 No.7, 2014 Nature Medicine, Vol.24,
Report Date: 11/20/2017
Name: Sample Report Report Date: 11/20/2017 Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations
DNA, Genes, and Chromosomes. The instructions for life!!!
DNA, Genes, and Chromosomes The instructions for life!!! Gene Segment of DNA that has the information (the code) for a protein or RNA. A single molecule of DNA has thousands of genes on the molecule. Remember
Behavioral generalization
Supplementary Figure 1 Behavioral generalization. a. Behavioral generalization curves in four Individual sessions. Shown is the conditioned response (CR, mean ± SEM), as a function of absolute (main) or
(b) (i) A does not equal T C does not equal G; 1 (ii) DNA is not double stranded; 1 [8]
![(b) (i) A does not equal T C does not equal G; 1 (ii) DNA is not double stranded; 1 [8]](/thumbs/83/88785723.jpg "(b) (i) A does not equal T C does not equal G; 1 (ii) DNA is not double stranded; 1 [8]")
1. (i) Purines pair with pyrimidines / adenine and thymine always pair as do cytosine and guanine; Number of A = T/C = G; (different organisms have) different base sequences; different amount of each base
An Introduction to Genetics. 9.1 An Introduction to Genetics. An Introduction to Genetics. An Introduction to Genetics. DNA Deoxyribonucleic acid
An Introduction to Genetics 9.1 An Introduction to Genetics DNA Deoxyribonucleic acid Information blueprint for life Reproduction, development, and everyday functioning of living things Only 2% coding
Good Luck and Happy Studying!!
Honors Biology: Interactive Study Guide: Biochemistry (PowerPoint notes, lab activities, articles, discussions and chapter 3 text reference) Good Luck and Happy Studying!! Intro to Biochemistry Organic
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
4.3 Measures of Variation
4.3 Measures of Variation! How much variation is there in the data?! Look for the spread of the distribution.! What do we mean by spread? 1 Example Data set:! Weight of contents of regular cola (grams).
Processing of RNA II Biochemistry 302. February 13, 2006
Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:
Chapter 2: The Chemical Level of. Organization. Copyright 2009, John Wiley & Sons, Inc.
Chapter 2: Organization The Chemical Level of Question Of the following functions, the major propose of RNA is to A. Function in the synthesis of protein. B. Transmit genetic information to offspring.
Pre-mRNA Secondary Structure Prediction Aids Splice Site Recognition
Pre-mRNA Secondary Structure Prediction Aids Splice Site Recognition Donald J. Patterson, Ken Yasuhara, Walter L. Ruzzo January 3-7, 2002 Pacific Symposium on Biocomputing University of Washington Computational