Selective optical drive of thalamic reticular nucleus generates thalamic bursts & cortical spindles

Transcription

1 Selective optical drive of thalamic reticular nucleus generates thalamic bursts & cortical spindles Michael M. Halassa, Joshua H. Siegle, Jason T. Ritt, Jonathan T. Ting, Guoping Feng and Christopher I. Moore Supplementary Information Materials and Methods: VGAT-ChR2-YFP transgenic mice BAC transgenic mice were generated as previously described (Zhao et al., 2010). Briefly, A BAC clone containing the VGAT gene (RP23-392P11) was obtained from the Children s Hospital Oakland Research Institute. Humanized ChR2 containing the H134R mutation was fused to EYFP and inserted into the ATG codon in exon I of the VGAT gene through homologous recombination (Lee et al., 2001). The expression of the VGAT gene in the BAC clone was disrupted to avoid overexpression of VGAT in the BAC transgenic mice. Transgenic mice were generated by the injection of modified BAC DNA constructs into fertilized oocytes, using standard pronuclear injection techniques (Feng et al., 2004). Fertilized eggs were collected from the mating between C57BL/6J and CBA F1 hybrids. Founder mice were crossed to C57BL/6J to establish the transgenic line. Detailed characterization of this line of mice will be described elsewhere. VGAT-ChR2 mice were maintained in a heterozygous state. Neonatal mice were genotyped using the forward primer ACCCTTCTGTCCTTTTCTCC and reverse primer GCAAGGTAGAGCATAGAGGG. Mice 6-8 weeks old were used for drive implantation surgery as discussed below. All research involving mice have been conducted according to the Institutional Animal Care and Use Committee guidelines. All procedures were approved by the Institutional Animal Care and Use Committee. Brain Processing and Confocal Microscopy For histological experiments, mice were given a terminal dose of ketamine/xylazine anesthesia. Mice were perfused with ice-cold 1% phosphate buffered saline, followed by 4% paraformaldehyde. Brains were harvested and placed in 40% sucrose solution for 24 hours, after which coronal brain sections of 40 μm were cut using a freezing microtome and processed as free-floating sections. Mouse GAD67 antibody 1:1000 (Millipore, Temeluca, CA) followed by secondary staining with goat-anti-mouse antibody conjugated to Alexa 546 (Millipore, Temeluca, CA) was used for staining of GABAergic cells. Confocal microscopy was performed on a Nikon (Tokyo, Japan) PCM 2000 controlled by the Compix (Cranberry Township, PA) software package. Image analysis was performed using the public domain NIH Image J program (available at For the low magnification image of TRN, a 10x objective was used. Higher-power images of thalamus and neocortex were collected with a 40x 1

2 Plan Fluor objective. Laser power, gain, and black level were modulated to remove fluorophore bleed-though between channels. These parameters were kept constant for experiments requiring quantitative comparison among TRN, VPm and SI. Statistical comparisons between groups were done using a Student s t-test. Implant design, printing and loading Dual-site implants, with openings spaced to target ventral posteriomedial thalamus (VPm) and primary somatosensory cortex (SI), were designed in 3D CAD software (SolidWorks, Concord, MA) and stereolithographically printed in Accura 55 plastic (American Precision Prototyping, Tulsa, OK). Each implant was loaded with five thalamic and three cortical 20 micron tungsten stereotrodes (California Fine Wire Company, Grover Beach, CA), which were pinned to a custom-designed electrode interface board (EIB) (Sunstone Circuits, Mulino, OR). Two EEG wires and one ground wire (A-M systems, Carlsborg, WA), were also affixed to the EIB. An optical fiber targeting TRN (Doric Lenses, Quebec, Canada) was glued to the EIB. Animal Surgery Mice 6-8 weeks old were anesthetized with 1% isofluorane and placed in a stereotaxic frame. For each animal, five stainless-steel screws were implanted in the skull to provide EEG contacts (two prefrontal sites), ground (cerebellar), and mechanical support for the drive. A ~2.0 x 1.5mm craniotomy was drilled with a center coordinate of (M/L 2.5mm, A/P 1.7mm). The implant was attached to a custom-designed stereotaxic arm and lowered to the craniotomy. Thalamic stereotrodes were lowered to the following stereotaxic coordinates (M/L 1.9mm, A/P 1.7mm, D/V -3.5mm) which positioned the fiber optic at approximately the following coordinates (M/L 2mm, A/P 1.7mm, D/V -3.25mm) and neocortical stereotrodes at (M/L 3.25mm, A/P 1.7mm, D/V -0.5mm). Electrophysiological Recording Following recovery, each animal was connected to 16-channel preamplifier headstage (Neuralynx, Bozeman, MT). All data were recorded using a Neuralynx Cheetah 32 recording system. Signals from each stereotrode were amplified, filtered between 0.1 and 9 khz and digitized at approximately 30 khz. Local field potentials were collected from a single channel on each stereotrode. The LFP and EEG traces were amplified and filtered between 1 and 100 Hz. Signals were referenced to the cerebellar ground screw in most cases. When referencing to the ground screw produced significant noise, one of the EEG channels was used as a reference. For state analysis, EEG (filtered between 1-50 Hz) and EMG (Filtered between Hz) recordings were performed as has been described previously (Halassa et al., 2009) (Fig. 2). Video Recording Mice were recorded using a Sony HDR-XR150 camera at 30 Hz frame rate. Visual inspection of frames was used to label the animal s state as active vs. quiet (Fig. 2). Optogenetic Stimulation 2

3 A fiber optic patch cord (Doric Lenses) delivered light from a 473 nm laser (Opto Engine, Midvale, UT) to the fiber optic connector on the implant. Prior to connecting to the implant, laser power was measured and titrated to 15 mw using a neutral density filter (Thorlabs, Newton, NJ). Power at the tip of the implanted fiber was ~50% of this value, based on measurements prior to surgery. Thus, there was 7-8 mw of power at the fiber tip, or mw/mm 2 for a 200-micron fiber. An analog stimulus generator (Grass Technologies, Warwick, RI) was used to shape laser pulses of 20 msec duration and Hz frequency. Data Analysis All data were analyzed in Matlab (Mathworks, Natick, MA) using a combination of customwritten software and routines derived from the Chronux toolbox ( Clustering was performed offline using the MClust toolbox ( based on spike amplitudes and energies on the two electrodes of each stereotrode. Units were separated by hand, and crosscorrelation and autocorrelation analyses were used to confirm unit separation. Firing rate was calculated by computing the number of spikes over a 1 s window. Bursts were defined as spike sequences from a single unit with an interspike interval of less than 4 msec preceded by a period of non-spiking of more than 100 msec (Bezdudnaya et al., 2006). Spectrograms were generated using the Chronux toolbox. State-dependent analysis was based on visually detected changes in animal activity and thalamic firing rates. For Figure 2D, one session from each animal was used in which there were clear transitions between high and low activity. Evoked spindle power in each condition was normalized by the total pre-stimulus spindle power. For Figure S6, percentiles were calculated for the firing rate of each cluster, averaged for each recording session, and subsequently normalized by the maximum firing rate of that cluster for that session. This approach allowed for averaging of all clusters across all sessions. Spindles were scored visually for all sessions by an observer blind to the state analysis. 3

4 Supplementary Figures Figure S1: Enriched expression of ChR2-YFP in TRN (A) Low magnification single confocal section of VGAT-ChR2 mouse thalamus showing selective expression of ChR2 (green, YFP fluorescence) in TRN demarcated by GAD67-positive cell bodies (red). (B) Higher magnification confocal section of (A), showing colocalization of ChR2 and GAD67 staining at the cell membrane (white arrow in Merge). (C) Lack of labeling of cell bodies by either ChR2 or GAD67 in VPm thalamus and the process-like expression of ChR2, presumably from TRN axons (D) Cortical GAD67-positive neurons also expressed the ChR2-YFP construct. Exposure was several fold higher (compare to B for clarity). (E) Fluorescence in these brain regions showed significantly higher expression of ChR2 in TRN compared to SI and VPm (TRN vs. VPm, **, p<1.6x10-8 ; TRN vs. SI, **, p<5.2x10-8 ; VPm vs. SI, #, p< Error bars are SEM). 4

5 Figure S2: Brief optical stimulation in VGAT-ChR2 mice drives TRN cell firing Top: A TRN unit (Left) waveform isolated from a stereotrode in a freely behaving mouse, compared to (Right) a TC unit isolated from a separate stereotrode in VPm. Middle: Raster plot showing direct optical drive of the TRN. Note initial drive followed by rebound burst, likely reflecting recruitment of intra-trn feedforward inhibition. Bottom: The time-matched PSTH of TRN unit optical drive. 5

6 Figure S3: TRN drive does not alter firing rate but alters burst rate of TC neurons (Left) Individual TC neuron s firing rate (open circles) plotted before and after stimulation showed no change. (Right) In contrast, burst rate increased in 8 out of the 11 neurons recorded. Figure S4: Optical stimulation results in a wide-range of burst probability across recorded TC cells Histogram of burst probability showing that TC cells exhibited a wide range of burst responses following optical stimulation of TRN. Note that six out of the nine cells show burst probability > 20%. 6

7 Figure S5: Spontaneous neocortical spindles can occur in the absence of clear thalamic spindles during natural sleep Representative examples of three sleep spindles occurring in the cortical LFP in the absence of similar activity in thalamic recordings. 7

8 Figure S6: Spindle induction is most likely under conditions of low firing in TC cells (A) Example of unit firing during a session with noticeable variations in firing rate. Trials in which spindles were induced are highlighted by pink lines. The time of laser stimulation is demarcated by a blue vertical line. Note that during high ongoing firing rate epochs, no spindles were induced. (B) Normalized spindle probability of all cells as a measure of firing rate. There was a significant negative correlation between rate, where trials were binned into deciles, and normalized spindle probability (R = , p<0.04, N= 3 animals. Error bars are SEM). 8

9 Figure S7: Spindle induction is largely limited to NREM sleep (A) A representative polysomnography recording session from one mouse, showing state identification by EEG/EMG, as described previously (Halassa et al., 2009). Red asterisk denotes induced spindles during this session. W denotes awake epochs; N NREM-sleep; and, R REM-sleep. (B) Representative traces of EEG, top and EMG, bottom of the three states, NREM sleep, REM sleep and Wakefulness. Gray square highlights the one second post optical stimulation showing spindle induction in NREM sleep but not REM or wakefulness. Quantification across all sessions 9

10 in all animals shows that spindles are highly limited to NREM sleep (~19.56% induction, vs. 1.27% in wakefulness and 0% in REM; p <0.0001). Supplementary References 1. Bezdudnaya, T., et al., (2006)Thalamic burst mode and inattention in the awake LGNd. Neuron 49, Feng, G., et al., (2004). Generation of transgenic mice. Methods Mol. Med. 9, Halassa, M.M., et al., (2009). Astrocytic modulation of sleep homeostasis and cognitive consequences of sleep loss. Neuron 61, Lee EC, et al., (2001) A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73: Zhao S., et al., (2010) Fluorescent Labeling of Newborn Dentate Granule Cells in GAD67- GFP Transgenic Mice: A Genetic Tool for the Study of Adult Neurogenesis. PLoS One, 5(9). pii: e