Supplementary Figure 1. Biological characteris=cs of Smarcb1 flox/flox ; Rosa26- Cre ERT2 ; lymphomas
|
|
|
- Duane Lynch
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1. Biological characteris=cs of Smarcb1 flox/flox ; Rosa26- Cre ERT2 ; lymphomas a Tec Kinase Signaling CD28 Signaling in T Helper Cells Role of Macrophages in Rheumatoid Arthri>s NFkB Signaling Hepa>c fibrosis/hepa>c Stellate cell ac>va>on c Ly Smarcb1 vs Mb % Ly Smarcb1 vs b Molecular Mechanism of Cancer CD28 Signaling in T Helper Cells icos- icosl signaling in T Helper Cells Role of NFAT in regula>on of the Immune Response d Tec Kinase signaling Ly Ctnnb vs Mb % Ly Ctnnb vs % % icos- icosl signaling InT Helper Cells Pa_ern Recogni>on Receptors in recogni>on of Bacteria and Viruses NFkB Signaling Type I Diabetes Mellitus Molecular Mechanism of Cancer CD28 Signaling in T Helper Cells icos- icosl signaling InT Helper Cells Role of NFAT in regula>on of the Immune Response e CD28 Signaling in T Helper Cells Role of Macrophages in Rheumatoid Arthri>s IL10 Signaling Acute Phase Response Signaling TREM1 Signaling Pa_ern Recogni>on Receptors in Recogni>on of Bacteria and Viruses Ly Smarcb1 vs Ly Ctnnb % f T Cell Receptor Signalingg Ly Smarcb1 vs Mb (3706) 1562 Overlap: 2144 pval: 0 (GREATER than expected) Ly Ctnnb vs Mb (3757) Ly Smarcb1 vs Ly Ctnnb vs (3273) (3544) Overlap: 1881 pval (GREATER than expected): 0 Ingenuity analyses of genes with significantly different expression (t- test analyses, p 0.05, Fold Change FC 1.2) in Smarcb1- deficient mouse lymphomas (Lymph Smarcb1 ) as compared with Mb (a) and (c); similar analyses comparing Ctnnb del_ex3 T- cell lymphomas (Lymp Ctnnb1 ) with Mb (b) and (d); similar analysis between the two types of lymphomas (e). Pathways are ranked from the most (up) to the less (down) significantly represented ones. The columns length represents the percentage of genes in the pathway that are significantly differen>ally expressed. Genes involved in the pathways are numbered at the end of the columns. Genes overexpressed in lymphomas as compared with Mb are shown in red, under- expressed genes in green. The yellow curve indicates the p.value for each overrepresented pathway. (f) Significant overlaps of the differen>al expressions between each type of lymphomas and Mb (upper panel) and (lower panels).
2 Supplementary Figure 2. Rosa26- Cre dependent recombina=on throughout mouse development a bp Brain- Tam Liver- Tam Vehicle Brain Liver del flox 300 E6 E9 E12 E18 P2 E6 E9 E12 E18 P2 E6 P2 E6 P2 b E6> E15 E9> E15 E6> E15 E9> E15 Veh. E15 HES. E15 HES. E15 (a) Semi- quan>ta>ve PCR on mouse brains and livers, five days ajer treatment with tamoxifen (Tam, 1mg/20g) and vehicle at various >me points (from E6 to birth). Del: deleted allele; flox: floxed allele. (b) Similar diffuse β- galactosidase staining in brains at E15 in Rosa26- CreERT2;Rosa26- LacZ mice treated with tamoxifen at E6 (lej upper panel) and E9 (right upper panel) ; scale bars represent 5mm. HES staining of control mouse at E15. Right panel: higher magnifica>on focusing on brains ; scale bars for high magnifica>on represent 1mm
3 Supplementary Figure 3. Tamoxifen injec=on at various stages of development Standard doses: mg/20g Standard doses: 2 mg/20g <E5 3 females E6- E11 6 females E12- E18 6 females 8 pups 20 mice No pup E6 33 pups 18 dead around birth E11 41 pups 0 dead around birth No tumor E19 E19 P0 W8 8/8 Failure to grow Early death- metabolic disorder 100% lymphomas M5 5 females Decreased doses: 0,5-1mg/20g 6 females 4 females Decreased doses: 1mg/20g E6 E7 E8 E9 E10 27 pups 100% IC tumours 28 pups 40% IC tumours E11 E12 21 pups No phenotype P0 10/10 Failure to grow 6/10 Early death- metabolic disorder P0: birth day. W8: 8 weeks of life. M5: 5 months of life. Mice showed no phenotype when treated with tamoxifen from E12 to E18 with standard doses (1.5-2mg/20g); therefore, we didn t use reduced doses ajer E12.
4 Supplementary Figure 4. Mouse intra- cranial tumors are split in two en==es b a :Paw :Face Mouse model Mb Neuronal features Smarcb1f lox/flox ; Rosa26Cre ERT2 Smarcb1 wt/del_ex1-2 Ptch1 - /+ Th- Mycn Fa Pa Lymphomas Non- Neuronal features Loca=on of the tumor :Paw Intra- cranial :Face Sympathe>c nervous system Soj- >ssues (Pa:paw and Fa: face) Liver & Spleen 0 1 c rank=2 rank=3 rank=4 rank=5 rank=6 rank=7 rank=8 d Lymphomas Mb k =3 k =4 k =5 k =6 k =7 Lymph. Mb Lymph. Mb Lymph. Mb Mb Lymph. Mb Lymph. (a) Unsupervised hierarchical clustering on 3161 genes; clusterize with neuronal tumors (Mb and ) while clusterize with lymphomas (b) whole genome correla>on between Smarcb1- deficient mouse tumors; a high correla>on is found between intracranial tumors of the group and the soj- >ssue tumors. i.e. arising in the paw (pa) and the face (fa). (c) Non Nega>ve Matrix Factoriza>on on the whole set of mouse Smarcb1- deficient tumors. Mb and ; the most robust and lowest number of clusters that split Mb from is k=5: Mb,, the Lymphoma group and 2 dis>nct groups within Smarcb1 flox/flox ;Rosa26- Cre ERT2 intracranial mouse tumors. (d) Consensus clustering on the same set of tumors showing that a number of clusters lower than 5 is unable to split Mb from.
5 Supplementary Figure 5. Human intra- cranial tumors are split in three en==es a 3630 genes b M B rank=2 rank=3 rank=4 M B rank=5 rank=6 rank=7 rank=8 c k =2 k =3 k =4 k =5 k =6 k =7 k =8 (a) Unsupervised hierarchical clustering on 3630 genes; 4 clusters within all SMARCB1- deficient tumors; : human extra- cranial tumors; hic: human extra- cranial tumors, groups 1, 2 and 3: : human medulloblastomas; : human neuroblastomas; NA: non assigned (b) Non Nega>ve Matrix Factoriza>on on the whole set of human SMARCB1- deficient tumors, and ; the most robust (highest cophene>c coefficient) and lowest number of clusters that split from is 6, confirming 4 dis>nct groups within SMARCB1- deficient tumors. (c) Consensus clustering on the same set of tumors, showing that a number of cluster lower than 6 is unable to split from.
6 Supplementary Figure 6. RT- PCR confirma=on on a subset of selected genes 8 genes that dis>nguish from were assessed on human tumor subgroups (, n=5 ;, n=5,, n=5, and, n=5) and mouse tumors subgroups (, n=4, and, n=4); the levels of expression in the face tumor from the heterozygous model (mec Hz, n=1) are also separately depicted to show the similarity of their expression profile with other tumors from the group. In box- plots, the central rectangle spans the first quar>le to the third quar>le (interquar3le range or IQR); the horizontal line inside the rectangle shows the median; whiskers are taken to 1.5 IQR from the quar>le ; circles show outliers
7 Supplementary Figure 7. ACTL6A and ACTL6B RNA expression In box- plots, the central rectangle spans the first quar>le to the third quar>le (interquar3le range or IQR); the horizontal line inside the rectangle shows the median; whiskers are taken to 1.5 IQR from the quar>le ; circles show outliers, n=11 ;, n=;12, n=5;, n=20;, n=5;, n=4; mec hz, n=1.
8 Supplementary Figure 8. Full gel showing the PCR results on wild type, knock out (KO) and floxed alleles of Smarcb1 bp Tam Vehicle KO/wt KO/flox H bp: base pair; Tam: tamoxifen; wt: wild type.
9 Supplementary Table 1. Exis=ng mouse models restrictedly based on Smarcb1 inac=va=on! Genetic! background! Guidi!et!al,! Promoter!trap! Moll!Cell!Biol,! in!intron!3! 2001! KlochendlerE Yeivin!et!al,! EO,!2000! Roberts!et!al,! PNAS,!2000! Tsitikis!et!al,! PNAS,!2005! Roberts!et!al,! Cancer!Cell,! 2002! Moreno!et!al,! J!Neuroscience,! 2015!! Deletion!of! exons!1!&!2! Deletion!of! exon1! Deletion!of! exons!6&7! Conditionnal! Inversion! Promoter! specific!for! granule!cell! precursors!:! Atoh1ECre! Tumour! Phenotype! penetrance! 15%! Head!and!neck! softetissues! tumours! Sarcomas,! lymphoma! 32%! Intracranial! paraspinal! subcutaneous! tumors! Pleomorphic! Rhabdoid!cells! 6.5%! Face!and!Neck! softetissue! tumors! Pleomorphic! Rhabdoid!cells! 26%! Face!and!neck! SoftEtissue! tumors! Pleomorphic! Rhabdoid!cells! 100%! Spleen!and! liver! lymphomas! 0%! Cerebellum! hypoplasia! Mean!Latency! 25weeks! 9!months! 6!months! 11!months! 3months! Not!applicable!
10 Supplementary Table 2. Primers used for RT- PCR valida=on of gene expression Sense Anti-sense Human&SOX2& GCCCCCAGCAGACTTCACAT% AGGGGCAGTGTGCCGTTAAT% Human&FABP7& TCATCAGGACTCTCAGCACATTCAA% CCATCCAGGCTAACAACAGACTTACA% Human&GAFP& CAGAAGCTCCAGGATGAAACCAA% GTGGCTTCATCTGCTTCCTGTCT% Human&ASCL1& CGTCCTGTCGCCCACCATCT% GGGGCTGAGCGGGTCGTAA% Human&HES5& GAAGCACAGCAAAGCCTTCGT% GTAGCCTTCGCTGTAGTCCTGGT% Human&GLI2& AAGTCACTCAAGGATTCCTGCTCA% GTTTTCCAGGATGGAGCCACTT% Human&MYC& ACCACCAGCAGCGACTCTGA% TCCAGCAGAAGGTGATCCAGACT% Human&HMOX1& CAGTCAGGCAGAGGGTGATAGAAGA% CTGCAACTCCTCAAAGAGCTGGAT% Mouse&SOX2& CACATGGCCCAGCACTAC% CCCTCCCAATTCCCTTGTATC% Mouse&FABP7& TGTAAGTCTGTGGTTCGGTTG% AGGGGCAGTGTGCCGTTAAT% Human&FABP7& TCATCAGGACTCTCAGCACATTCAA% AGCAACGATATCCCCAAAGG% Mouse&GAFP& GAAAACCGCATCACCATTCC% CTTAATGACCTCACCATCCCG% Mouse&ASCL1& GACTTGAACTCTATGGCGGG% TTCCAAAGTCCATTCCCAGG% Mouse&HES5& CGGTGGAGATGCTCAGTC% CTTGGAGTTGGGCTGGTG% Mouse&GLI2& GCTCCACACACCCGCAACA% AAGTTTTCCAGGACAGAACCATTGA% Mouse&MYC& ACCACCAGCAGCGACTCTGA% GGAATGGAGATGAGCCCGACT%% Mouse&HMOX1& ACAGAGGAACACAAAGACCAG% GTGTCTGGGATGAGCTAGTG%
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplementary Methods
Supplementary Methods Analysis of time course gene expression data. The time course data of the expression level of a representative gene is shown in the below figure. The trajectory of longitudinal expression
Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
JPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes
JPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes Teacher: Pr. Régis Josien, Laboratoire d Immunologie, CHU Nantes Regis.Josien@univ-nantes.fr 1 An#gen recogni#on by T cells
Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
Nature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-
Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-
Gene+c fate mapping. x loxp. Foxp3 3 UTR ROSA26 RFP IRES GFP CRE. STOP loxp. Stable Foxp3 expression. Foxp3 expression in new Treg.
1 Introduc+on (CD4 + CD25 + Foxp3 + )are indispensable for immune homeostasis. Muta+ons in Foxp3 gene leads to fatal autoimmune disorder. Condi+onal dele+on of Foxp3 reprograms cells into pathogenic Th
Supplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33
DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis
Classifica4on. CSCI1950 Z Computa4onal Methods for Biology Lecture 18. Ben Raphael April 8, hip://cs.brown.edu/courses/csci1950 z/
CSCI1950 Z Computa4onal Methods for Biology Lecture 18 Ben Raphael April 8, 2009 hip://cs.brown.edu/courses/csci1950 z/ Binary classifica,on Given a set of examples (x i, y i ), where y i = + 1, from unknown
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Supplemental Data Tamoxifen administration to Vil-Scap- mice.
Supplemental Data FIGURE S1. Tamoxifen administration to Vil-Scap - mice. In the experiments shown in Fig. 1 to Fig. 5, tamoxifen (2 mg per dose) was dissolved in corn oil and administered by orogastric
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplementary Materials
Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different
a b c periosteum parietal bone bone marrow dura periosteum suture mesenchyme osteogenic front suture mesenchyme 1
coronary suture sagittal suture DOI: 10.1038/ncb3139 a b c e parietal bone suture mesenchyme parietal bone bone marrow ura ura ura f parietal bone ura suture mesenchyme bone g ura osteogenic front suture
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The
In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell
Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later
Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.
a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid
Supplementary Results BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia Oliver Hantschel*, Wolfgang Warsch*, Eva Eckelhart*, Ines Kaupe, Florian Grebien, Kay-Uwe Wagner, Giulio
Nature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training.
Supplementary Figure 1 Behavioral training. a, Mazes used for behavioral training. Asterisks indicate reward location. Only some example mazes are shown (for example, right choice and not left choice maze
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Summary of behavioral performances for mice in imaging experiments.
Supplementary Figure 1 Summary of behavioral performances for mice in imaging experiments. (a) Task performance for mice during M2 imaging experiments. Open triangles, individual experiments. Filled triangles,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: TITLE: PRINCIPAL INVESTIGATOR: Jeremy Chien, PhD CONTRACTING ORGANIZATION: Mayo Clinic, REPORT DATE: September 2012 TYPE OF REPORT: Annual PREPARED FOR: U.S. Army Medical Research and
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
Nature Getetics: doi: /ng.3471
Supplementary Figure 1 Summary of exome sequencing data. ( a ) Exome tumor normal sample sizes for bladder cancer (BLCA), breast cancer (BRCA), carcinoid (CARC), chronic lymphocytic leukemia (CLLX), colorectal
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis
Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna