Interferon- induction and related signaling pathways in human hepatocyte cell lines

Transcription

1 81 1, *, 2, *, 1, 2, 1, 2, 1, 2 1. /, ; 2. ( ), : ( IFN- ), IFN-, ( HBV), 3 PH5CH8 Huh7 HepG2, IFN- ( NDV) - poly( I C), IFN-, Huh7 HepG2, PH5CH8 NDV poly( I C) IFN- 3 IFN-,, PH5CH8, Huh7 HepG2 HBV, IFN : ; ; ; Interferon- induction and related signaling pathways in human hepatocyte cell lines CHEN Hui 1, *, WU Min 2, *, YU Shi-Yan 1, 2, CHEN Jie-Liang 1, 2, YUAN Zheng-Hong 1, 2 1. Key Laboratory of Medical Molecular Virology, Ministry of Education and Health, Shanghai Medical College, Fudan University, Shanghai , China; 2. Shanghai Public Health Clinical Center Affiliated to Fudan University, Shanghai , China Abstract: Interferon- plays an important role in innate immunity against viral infection. Hepatocytes, as hepatitis viruses-harboring cells, are reported to possess the potential to inductively express interferon-. However, a practical in vitro cell model for investigating the interplay between hepatitis B virus and host cells is rarely reported. Here, we determined the inductive expression of interferon- by interferon- agonists ( Newcastle disease virus, NDV) and poly ( I C) in immortalized primary hepatic cell line, PH5CH8, and hepatocarcinoma cell lines, Huh-7 and HepG2. The data demonstrated that inductive expression of interferon- in PH5CH8 cells was significantly higher than that in Huh7 or HepG2 cells. In addition, the expression level of key molecules critical for interferon- induction was investigated to clarify the underlying mechanism. The results showed that the background expression level was fairly low in Huh7 and HepG2 cell lines, compared to that in PH5CH8 cells. It is suggested that PH5CH8 cells possess intact potential to produce interferon- and reconstitution of a selective interferon-deficient hepatic cell line might be achieved via introduction of related molecules critical for interferon induction. Key words:hepatocyte; Interferon- ; Induction signaling pathway; Interferon- agonists : 973 ( 2005 CB522902), ( EYF162002) :, zhyuan@ shaphc. org Corresponding author: YUAN Zheng-Hong, zhyuan@ shaphc. org * : ( hepatitis B virus, HBV) ( hepatitis C virus, HCV) [ 1],, [ 2, 3 ]

2 Journal of Microbes and Infection, June 2009, Vol. 4, No. 2 ( interferon-, IFN- ) ( interferon-, IFN- ), [ 4] ( ), HCV [ 5], NS3/ 4A IFN- TIR ( Toll/IL-1 receptor domain-containing adaptor inducing IFN-, TRIF) [ 6] 1( interferon- promoter stimulator 1, IPS-1) [ 7 ] ; HBV Toll ( Toll-like receptor, TLR) [ 8], 1 ( signal transducer and activator of transcription 1, STAT1) [ 9] ;,, Huh7 HepG2 2, 2, Huh7 TLR , HepG2 TLR , [ 10 ],,, PH5CH8 1 HCV, prsv-tag ( SV40 T ) G418 [ 1 1], TLR3 A ( retinoic acid-inducible gene-, RIG- ) 5( melanoma differentiation-associated gene- 5, MDA-5) [ 12], IFN- ( Newcastle disease virus, NDV) - ; poly ( I C) < PH5CH8 Huh7 HepG2, ( polymerase chain reaction, PCR) ( enzyme-linked immunosorbent assay, ELISA) IFN-,, IFN-, % CO 2, 3d 1, PH5CH8 Okayama Nobuyuki Kato, 2 mmol /L 100 g/l ( Toyobo ) 10 mg/l ( Gibco ) 5 mg/l ( Gibco ) mol/l ( Gibco ) 0. 1 mol /L ( Gibco ) 5 mg/l ( Gibco ) 100 g/l ( Gibco ) 2% ( Gibco ) 10 mg/l ( Gibco ) 200 mg/l ( Sigma ) 500 g/l ( Gibco ) DMEM( Gibco ) F-12( Gibco ) ( 1 1) [ 13 ] ; Huh7 HepG2, 10% u/l 100 mg/l DMEM 1. 2 pifn- -Luc IFN- pgl3-luc, McGill Rongtuan Lin ( firefly luciferase, Fluc) prl-tk ( Renilla luciferase, Rluc),, Promega 1. 3 NDV poly( I C) NDV ( NDV PSF 48 h,,, NDV ) 100 HAU/ml ; poly( I C) ( Sigma ) 50 mg/l, 1. 4 RNA PCR 200 l TRIzol ( MRC ) RNase/DNase EP 1/5

3 83 5 min, g 15 min, g 10 min % 300 l, g 10 min,, 10 min 25 l DEPC ddh 2 O, 10 u DNase ( RNase-free) ( TaKaRa ), min DNA, 30 u ( Toyobo ) cdna, 2 l 10 pmol/l ( 1) PCR ( 25 l) PCR GAPDH, PCR 3 1 PCR Tab 1. Primers used for real-time PCR Primers Forward ( 5 3 ) Reverse ( 5 3 ) IFN- GATTCATCTAGCACTGGCTGG CTTCAGGTAATGCAGAATCC IRF7 TGGTCCTGCTGAAGCTGGAA GATGTCGTCATAGAGGCTGTTGG MxA CCACTGGACTGACGACTTGA GAGGGCTGAAAATCCCTTTC ISG56 TAGCCAACATGTCCTCACAGAC TCTTCTACCACTGGTTTCATGC GAPDH GGTATCGTGGAAGGACTCATGA ATGCCAGTGGCTTCCCGTTCAGC , 90% Fugene 6( Roche ) 25 ng pifn- -Luc 10 ng prl-tk,36 h NDV poly( I C), 16 h 200 l 1 Passive Lysis Luciferase Assay System ( Promega ) Lumat LB9507 Fluc Rluc, 10 s, Fluc Rluc ELISA , 90% NDV poly( I C), 16 h, IFN- ( FUJIREBIO ) ELISA OD ( 450 nm), IFN-, IU/ml cm, 48 h, 2 SDS Loading, 10 min 10 l 10% - ( sodium dodecyl sulfate polyacrylamide gel electrophoresis, SDS-PAGE) ( 10 ma, 3 h) ( 300 ma, 60 min) 0. 2 m ( Schleicher & Schuell ), 5% -20 ( phosphate buffered saline with0. 5% Tween-20, PBST) ; 3 h, 4, 1 PBST 10 min, 3, C ( horse radish peroxidase, HRP), 2 h, 1 PBST 10 min, 3, Western Lightning ( PerkinElmer ), ( Kodak ) -actin( Sigma ) CST , 3 t, P < IFN- NDV poly( I C) IFN-, TLR3 RIG- IFN- [ 14 ] IFN-, NDV PH5CH8 Huh7 HepG2, poly ( I C) PH5CH8 Huh7 ( ), 6 h TRIzol RNA, PCR, IFN-, PH5CH8 NDV, IFN , Huh7 HepG

4 Journal of Microbes and Infection, June 2009, Vol. 4, No ( 1A B) ; poly( I C) PH5CH8 IFN- mrna Huh7 ( 1C), 7 ( interferon regulator factor 7, IRF7) [ 15 ], NDV PH5CH8 Huh7 IRF7 mrna,, PH5CH8 NDV IRF7, Huh7 ( 1D) 2. 2 IFN- IFN-, PH5CH8 Huh7 HepG2 IFN-, TLR MyD88 TRIF, RIG- IPS-1, 2( tumor necrosis factor receptor-associated factor 2, TRAF2) TRAF3 TRAF6, 1 1 ( interleukin-1 receptor-associated kinase 1, IRAK1) IRAK4, PH5CH8, Huh7 HepG2 TRIF IRAK1 TRAF3 TRAF6, MyD88 IRAK4 ( 2) A: PH5CH8, Huh7, HepG2 cells in 24-well plates were challenged with 100 HAU/ml NDV for 6 h. Total RNA was isolated and analyzed for IFN- mrna by real-time RT-PCR. All samples were normalized using GAPDH ( housekeeping gene) expression. B: Fold induction of IFN- mrna was calculated by dividing normalized RNA levels of stimulated cells with that of mock-treated cells based on A. C: PH5CH8 and Huh7 cells in 24 -well plates were added with 50 mg /L poly( I C) for 6 h. IFN- mrna was then quantified as that described in A. D: IRF7 mrna of NDV ( 100 HAU/ml, 6 h) - treated PH5CH8 or Huh7 cells was quantified as that described in A. Data ( means SE) were from three independent experiments. * P < IFN- Fig 1. Comparison of NDV- and poly( I C) - induced IFN- production in three cell lines 2. 3 IFN- IFN- c-jun/ 2( activating transcription factor 2, ATF2) B( nuclear factor B, NF- B) IRF3 [ 16], PH5CH8 Huh7 HepG2 ( mitogen-activated protein kinase, MAPK) / 1( activator protein 1, AP1) I B ( NF- B inhibitor kinases, IKKs) /NF- B

5 85 TANK ( TANK-binding kinase 1, TBK1) / IRF3 IFN-, 3, PH5CH8 NF- B IKK IKK IKK TBK1/IRF3 TBK1 Huh7 HepG2, MAPK/ AP-1 ( 3) PH5CH8, Huh7, or HepG2 cells ( cultured in 10 cm dishes) were lysated in 2 SDS Loading Buffer, separated in 10 % SDS-PAGE and immunoblotted with antibodies against indicated genes ( -actin as loading control). 2 IFN- Fig 2. Comparison of IFN- induction-associated upstream adaptor and kinase expression in three cell lines PH5CH8, Huh7, or HepG2 cells ( cultured in 10 cm dishes) were lysated in 2 SDS Loading Buffer, separated in 10 % SDS-PAGE and immunoblotted with antibodies against indicated genes ( GAPDH as loading control). 3 IFN- Fig 3. Comparison of three signaling pathways critical for IFN- induction in three cell lines 2. 4 PH5CH8 IFN- PH5CH8 IFN-, ELISA PH5CH8 NDV poly( I C) IFN-, NDV poly( I C) PH5CH8 IFN- ( 4A), IFN- ( 4B) MxA ISG56 2 IFN- [ 1 7], IFN-,, NDV 16 h, PCR MxA ISG56 mrna,, NDV PH5CH8 MxA( 4C) ISG56( 4D) PH5CH8 IFN- 3, [ 18 ], HBV,, [ 19 ] Huh7 HepG2 HBV, 2 HBV, [ 20 ] IFN- NDV poly( I C), HepG2 IFN-, Huh7 IFN-, PH5CH8 IFN- mrna, NDV poly( I C) ; ( MxA ISG56 IRF7),, TLR RIG-I

6 Journal of Microbes and Infection, June 2009, Vol. 4, No. 2 A: PH5CH8 cells in 24-wells plates were treated with either NDV( 100 HAU/ml) or poly( I C) ( 50 mg/ ml) for 16 h. Supernant was then collected for ELISA. B: PH5CH8 cells in 24-well plates were co-transfected with pifn- -Luc ( 25 ng) and prl-tk ( 10 ng) for 36 h before treated with NDV( 100 HAU/ml) for 16 h. IFN- promoter activity was represented as the ratio of FLuc to RLuc. MxA ( C) or ISG56 ( D) mrna of NDV ( 100 HAU/ml, 16 h) -treated PH5 CH8 cells was quantified as previously described. Data ( means SE) were from three independent experiments. 4 PH5CH8 IFN- Fig 4. Levels of induced IFN-,IFN- promoter activity and inducible gene expression in primary hepatic cell line PH5CH8 [ 21], Huh7 HepG2 IFN-, Huh7 HepG2 PH5CH8 IFN-, PH5CH8, Huh7 HepG2, IFN- [ 16 ], PH5CH8, Huh7 HepG2 IKK/NF- B TBK1/IRF3, RIG- Huh7 IFN- ( ), Li TLR3 Huh7 poly ( I C) ISGs [ 12 ], Huh7 HepG2,, TLR3 HEK293 TLR3 IFN- [ 22], Huh7 HepG2, PH5CH8 ;, IFN-,, [ 1] Nascimbeni M, Rehermann B. Immunology of hepatitis B virus and hepatitis C virus infection [ J]. Nat Rev Immunol, 2005, 5( 3) : [ 2] Gao B, Jeong WI, Tian Z. Liver: An organ with predominant innate immunity [ J]. Hepatology, 2008, 47( 2) : [ 3] Racanelli V, Rehermann B. The liver as an immunological organ [ J]. Hepatology, 2006, 43 ( 2 Suppl 1) : S54-S62

7 87 [ 4] Takeuchi O, Akira S. Innate immunity to virus infection [ J]. Immunol Rev, 2009, 227( 1) : [ 5] Naka K, Dansako H, Kobayashi N, et al. Hepatitis C virus NS5B delays cell cycle progression by inducing interferon-beta via Toll-like receptor 3 signaling pathway without replicating viral genomes [ J]. Virology, 2006, 346( 2) : [ 6] Li K, Foy E, Ferreon JC, et al. Immune evasion by hepatitis C virus NS3 /4A protease-mediated cleavage of the Toll-like receptor 3 adaptor protein TRIF [ J]. Proc Natl Acad Sci USA, 2005, 102( 8) : [ 7] Meylan E, Curran J, Hofmann K, et al. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus [ J]. Nature, 2005, 437 ( 7062) : [ 8] Wu J, Meng Z, Jiang M, et al. Hepatitis B virus suppresses Toll-like receptor-mediated innate immune responses in murine parenchymal and nonparenchymal liver cells [ J]. Hepatology, 2009, 49( 4) : [ 9] Christen V, Duong F, Bernsmeier C, et al. Inhibition of alpha interferon signaling by hepatitis B virus [ J]. J Virol, 2007, 81( 1) : [ 10] Preiss S, Thompson A, Chen X, et al. Characterization of the innate immune signalling pathways in hepatocyte cell lines [ J]. J Viral Hepat, 2008, 15( 12) : [ 11] Ikeda M, Sugiyama K, Mizutani T, et al. Human hepatocyte clonal cell lines that support persistent replication of hepatitis C virus [ J]. Virus Res, 1998, 56( 2) : [ 12] Li K, Chen Z, kato N, et al. Distinct poly( I-C) and virus-activated signaling pathways leading to interferonbeta production in hepatocytes [ J]. J Biol Chem, 2005, 280( 17) : [ 13] Noguchi M, Hirohashi S. Cell lines from non-neoplastic liver and hepatocellular carcinoma tissue from a single patient [ J]. In Vitro Cell Dev Biol Anim, 1996, 32 ( 3) : [ 14] Jefferies C, Fitzgerald K. Interferon gene regulation: not all roads lead to Tolls [ J]. Trends Mol Med, 2005, 11 ( 9) : [ 15] Sato M, Suemori H, Hata N, et al. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN- / gene induction [ J]. Immunity, 2000, 13( 4) : [ 16] Edwards MR, Slater L, Johnston SL. Signalling pathways mediating type I interferon gene expression [ J]. Microbes Infect, 2007, 9( 11) : [ 17] Stetson DB, Medzhitov R. Type I interferons in host defense [ J]. Immunity, 2006, 25( 3) : [ 18] Haller O, Kochs G, Weber F. The interferon response circuit: induction and suppression by pathogenic viruses [ J]. Virology, 2006, 344( 1) : [ 19] Iannacone M, Sitia G, Ruggeri ZM, et al. HBV pathogenesis in animal models: Recent advances on the role of platelets [ J]. J Hepatol, 2007, 46( 4) : [ 20] Keskinen P, Nyqvist M, Sareneva T, et al. Impaired antiviral response in human hepatoma cells [ J]. Virology, 1999, 263( 2) : [ 21] Kawai T, Akira S. Innate immune recognition of viral infection [ J]. Nat Immunol, 2006, 7( 2) : [ 22] Yamamoto M, Sato S, Mori K, et al. Cutting edge: a novel Toll/ IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Tolllike receptor signaling [ J]. J Immunol, 2002, 169 ( 12) : ( : )