JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice

Size: px
Start display at page:

Download "JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice"

Transcription

1 JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in Mice Freshteh Rahimi, M.Sc. 1, Saeed Sadigh-Eteghad, Ph.D. 2, Alireza Dehnad, Ph.D. 3, Javad Mahmoudi, Ph.D. 2, Laila Baradaran, M.Sc Instructor, Department of Biological Sciences, Higher Education Institute of Rab-Rashid, Tabriz, Iran 2- Assistant Professor, Neurosciences Research Center (NSRC), Tabriz University of Medical Sciences, Tabriz, Iran (Corresponding author; saeed.sadigetegad@gmail.com) 3- Associate Professor, Biotechnology Department, East Azerbaijan Research and Education Center for Agriculture and Natural Resources, AREEO, Tabriz, Iran Received: 12 June, 2016 Accepted: 15 January, 2017 Original article Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Mice Diabetes is a metabolic disorder with adverse effects on haematological parameters level, oxidative stress and antioxidant defence system. This study aimed to investigate the effects of Rosa canina (RC) fruit hydro alcoholic extract on oxidative stress, total antioxidant capacity (TAC) and haematological parameters in diabetic mice. In this study, 96 mice were randomly divided into the four groups (n=24). The control and diabetic groups received normal saline (p.o., 0.2 ml). Also, RC and treatment (diabetes+rc) groups received RC hydro alcoholic extract (p.o., 500 mg/kg). Diabetes was induced by a single dose of streptozotocin (i.p., 200 mg/kg).the study parameters were evaluated on day 10, 20, and 30 after the initiation of experiments. In the second and third sampling days, WBCs, lymphocytes, haemoglobin, RBC, MCV, MCHC, platelets, TAC and weight had a significant reduction (p<0.01) in the diabetic group in comparison to the control group. However, granulocytes, RDW, malondialdehyde (MDA) and glucose in the diabetic group significantly increased compared with the control group (p<0.01). Administration of the extract in the diabetic group significantly increased hemoglobin, MCV, MCHC, platelets, RBC, serum TAC and resulted in significant reduction in RDW and MDA levels in comparison to normal saline received diabetic animals (p<0.01). Based on our results, RC fruit extract has a regulatory role in controlling oxidative stress, serum TAC and hematologic factors in mice model of diabetes. Introduction 132

2 Journal of Kerman University of Medical Sciences 2017, Vol. 24, Issue 2 Materials and Methods Animals Plants collection and extraction 133

3 fruit hydroalcholic extract effects in diabetes Rahimi, et al Evaluation of Hematologic Factors STZ-model of DM Statistical analysis Experimental groups Results Blood sampling The measurement of MDA and TAC levels 134

4 Journal of Kerman University of Medical Sciences 2017, Vol. 24, Issue 2 Table 1. Changes in RBC-related hematological parameters during the study period in different groups Time group RDW (%) MCHC (g/dl) MCH (pg) MCV (fl) hemoglobin(g/dl) Red blood cell (1012/l) 14.33± ± ± ± ± ±0.23 Day10 14± ± ± ±1.47** 21.92± ±1.04** 69.13± ±1.68** 15.62± ±0.47** 7.55± ±0.25** 14.5± ±0.82## 20.3± ±1.1## 14.76±0.76## 6.93±0.26## 14.67± ± ± ± ± ±0.38 Day ± ±0.73* 26.67± ±2.48** 22.12± ±0.41** 66.02± ±1.41** 16.38± ±0.29** 6.97± ±0.18** 14.18±1.24# 25± ± ±1.19## 14.85±0.5# 6.93±0.36## 13.83± ± ± ± ± ±0.43 Day ± ±1.21** 27± ±1.51** 22.38± ±0.85** 68.42± ±2.69** 17.25± ±0.74** 7.58± ±0.22** 13.11±0.75## 22.17± ± ±1.2## 14.43±0.64## 6.45±0.15## ** p<0.01when compared with control group, ## p<0.01and # p<0.05 in comparison to diabetic mice. Table 2. Changes in WBC-related hematological parameters during the study period in different groups Time group PLT (10 9 /l) GRAN (%) MID (%) LYM (%) White blood cells(10 9 /l) ± ± ± ± ± ± ±1.66 3± ± ±1.49 Day ±16.89* 47.94± ±0.78** 43.55±1.19** 7.05± ± ± ± ± ± ± ± ± ±1.37 7±1.02 Day ± ±12.93** 47.17± ±0.77** 4.73± ±0.37** 48.12± ±0.5** 6.96± ±0.56** 380.5±22.54## 51.73± ± ± ± ± ± ± ± ± ± ± ±1.95 Day ±14.90** 52.72±2.32** 8.67±0.88** 38.6±2.72** ± ± ± ±0.90 ** p<0.01 and ## p<0.01 when compared with control and diabetic groups, respectively. 7.35± ± ±0.6** 5.73±

5 fruit hydroalcholic extract effects in diabetes Rahimi, et al Table 3. Alterations in the body weight, glucose levels and oxidative stress markers during the study period in different groups Time group Weight (gr) Glucose(mg/d) TAC (mm/l) MDA (nm/mg protein) 28± ± ±0.05 Day ± ± ± ± ±31.72** 0.21±0.04** 27.6± ± ± ± ± ±0.03 Day 20 30± ± ± ±1.6** ±28.94** 0.20±0.04** 26.1±1.3# ± ±0.05## 34± ± ±0.03 Day ± ± ± ±1.7** 534.6±23.33** 0.19±0.02** 24.8±1.9# 521.5± ±0.03## ** p<0.01when compared with control group, ## p<0.01and # p<0.05 in comparison to diabetic mice. 0.3± ± ±0.05** 0.66± ± ± ±0.04** 0.61± ± ± ±0.04** 0.6±0.04## Discussion 136

6 Journal of Kerman University of Medical Sciences 2017, Vol. 24, Issue 2 References 137

7 fruit hydroalcholic extract effects in diabetes Rahimi, et al 138

8 Journal of Kerman University of Medical Sciences 2017, Vol. 24, Issue 2 139

9 fruit hydroalcholic extract effects in diabetes Rahimi, et al 140

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Hematological Effects of Cadmium in Hybrid Isa brown

Hematological Effects of Cadmium in Hybrid Isa brown Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2012, 2 (6):2049-2054 Hematological Effects of Cadmium in Hybrid Isa brown * Imer Haziri 1, Bujar Mane 2, Arben

More information

Icd code for cbc with differential/ platelet

Icd code for cbc with differential/ platelet Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

2013/11/29 Version 2

2013/11/29 Version 2 1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219

More information

Laboratory for diagnosis of THALASSEMIA

Laboratory for diagnosis of THALASSEMIA SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Immune Mediated Haemolytic Anaemia Secondary to Sheathed Microfilaria A Case Report

Immune Mediated Haemolytic Anaemia Secondary to Sheathed Microfilaria A Case Report International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 5 (2017) pp. 603-607 Journal homepage: http://www.ijcmas.com Case Study https://doi.org/10.20546/ijcmas.2017.605.069

More information

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9 etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:

More information

The LaboratoryMatters

The LaboratoryMatters Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic

More information

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range 5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN

More information

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia 50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

EFFECTS OF ZINC SUPPLEMENTATION ON SOME HEMATOLOGICAL PARAMETERS OF SPONTANEOUSLY HYPERTENSIVE RATS

EFFECTS OF ZINC SUPPLEMENTATION ON SOME HEMATOLOGICAL PARAMETERS OF SPONTANEOUSLY HYPERTENSIVE RATS Trakia Journal of Sciences, Vol. 8, Suppl. 2, pp 61-65, 2010 Copyright 2009 Trakia University Available online at: http://www.uni-sz.bg ISSN 1313-7050 (print) ISSN 1313-3551 (online) EFFECTS OF ZINC SUPPLEMENTATION

More information

Paper ID: ART

Paper ID: ART analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in

More information

Symptoms and Signs in Hematology (2)/ 2013

Symptoms and Signs in Hematology (2)/ 2013 Symptoms and Signs in Hematology (2)/ 2013 Abdallah Abbadi.MD.FRCP Professor of Medicine,Hematology & Oncology University of Jordan & JUH Email: abdalla.awidi@gmail.com Case one: A 24 yr old female complains

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9 ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti

More information

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia

More information

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female) Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Changes of hematological references depends on storage period and temperature conditions in rats and dogs ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC) AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin

More information

ACCREDITATION DOCUMENT

ACCREDITATION DOCUMENT Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

The effects of garden sage s hydroalcoholic extract on blood parameters in mice

The effects of garden sage s hydroalcoholic extract on blood parameters in mice Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2015, 7(10):276-280 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 The effects of garden sage s hydroalcoholic extract

More information

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the

More information

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for

More information

The pros and cons of the fourth revision of thalassaemia screening programme in Iran

The pros and cons of the fourth revision of thalassaemia screening programme in Iran Original Article The pros and cons of the fourth revision of thalassaemia screening programme in Iran J Med Screen 2017, Vol. 24(1) 1 5! The Author(s) 2016 Reprints and permissions: sagepub.co.uk/journalspermissions.nav

More information

INFECTION/ INFLAMMATION

INFECTION/ INFLAMMATION HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital

More information

HM5. Hematology Analyzer BETTER. ACTUALLY.

HM5. Hematology Analyzer BETTER. ACTUALLY. HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS

MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS MHD I, Session 16, STUDENT Copy, Page 1 MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS CASE-BASED SMALL GROUP DISCUSSION SESSION 16 Pulmonary MHD I December 5, 2016 STUDENT COPY MHD I, Session

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für

More information

Complete Blood Count (CBC)

Complete Blood Count (CBC) Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction

More information

Chickens for Fattening Tolerate Nonanoic Acid Added to Diet at Levels up to 1000 mg/kg Feed

Chickens for Fattening Tolerate Nonanoic Acid Added to Diet at Levels up to 1000 mg/kg Feed Chickens for Fattening Tolerate Nonanoic Acid Added to Diet at Levels up to 1000 mg/kg Feed Feed Additive Conference Frankfurt, Germany 29 September 2017 Loretta Hunter Global Compliance Director, Anitox

More information

Clinical use of flow cytometry

Clinical use of flow cytometry Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

Continuing Education Questions

Continuing Education Questions FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one

More information

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

Hematological effects of mercury in hybrid birds Isa brown

Hematological effects of mercury in hybrid birds Isa brown Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2013, 3(1):185-190 Hematological effects of mercury in hybrid birds Isa brown ISSN: 2248 9215 CODEN (USA): EJEBAU

More information

CASE-BASED SMALL GROUP DISCUSSION

CASE-BASED SMALL GROUP DISCUSSION MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Evaluation of Anemia. Md. Shafiqul Bari Associate professor (Medicine) SOMC

Evaluation of Anemia. Md. Shafiqul Bari Associate professor (Medicine) SOMC Evaluation of Anemia Md. Shafiqul Bari Associate professor (Medicine) SOMC Definition Anemia is operationally defined as a reduction in one or more of the major RBC measurements Hemoglobin concentration

More information

Brief Communication Diagnostic Hematology

Brief Communication Diagnostic Hematology Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges

More information

i. Where is the participant seen?

i. Where is the participant seen? PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant

More information

Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia

Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia Clinical study: The clinical study Investigation into the molecular mechanism of action of Triticum

More information

1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00

1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00 Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000

More information

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010

More information

A Study on the Relationship between CBC and EEG for Epilepsy Patients

A Study on the Relationship between CBC and EEG for Epilepsy Patients ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on

More information

Haematology Comparability Document

Haematology Comparability Document South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für

More information

Biochemical And Hematological Study On Butanol Fraction Of Leaves Of Moringa Stenopetala In Experimental Rats.

Biochemical And Hematological Study On Butanol Fraction Of Leaves Of Moringa Stenopetala In Experimental Rats. IOSR Journal Of Pharmacy (e)-issn: 2250-3013, (p)-issn: 2319-4219 Volume 6, Issue 5 (May 2016), PP. 64-68 www.iosrphr.org Biochemical And Hematological Study On Butanol Fraction Of Leaves Of Moringa Stenopetala

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

The Full Blood Count. Dave Reynders University of Pretoria Paediatric Oncology and Haematology

The Full Blood Count. Dave Reynders University of Pretoria Paediatric Oncology and Haematology The Full Blood Count Dave Reynders University of Pretoria Paediatric Oncology and Haematology 1 History Empedocles in the 5 th century BC Vasculature contains Blood, Phlegm, Black bile and Yellow Bile.

More information

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters International Archives of Medical Research Volume 9, No. 1, pp.15-23 2017. ORIGINAL RESEARCH The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological

More information

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE

More information

Ordering Physician CLIENT,CLIENT. Collected REVISED REPORT

Ordering Physician CLIENT,CLIENT. Collected REVISED REPORT HPWET Hematopathology Consultation, MML Embed Client Hematopathology Consult REVISED INAL DIAGNOSIS Interpretation Peripheral blood, bone marrow aspirate and biopsies, bilateral iliac crests: 1. Normocellular

More information

Test Name Results Units Bio. Ref. Interval

Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 135091667 Age 37 Years Gender Male 29/8/2017 120000AM 29/8/2017 100129AM 29/8/2017 113851AM Ref By Final COAGULATION ROFILE 1 ARTIAL THROMBOLASTIN TIME, ACTIVATED; ATT

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00

More information

Panacea Journal of Health Sciences ISSN :

Panacea Journal of Health Sciences ISSN : EFFECT OF MANNA HEALTH MIX SUPPLEMENTATION ON ANTHROPOMETRIC PARAMETERS AND HEMATOLOGICAL PROFILE OF ANEMIC ADOLESCENT GIRLS Suganya N. * and Dr. D. Estherlydia** *M.Sc Student, ** Assistant Professor,

More information

Advanced Hematology Five-Part Differential. Simple Operation

Advanced Hematology Five-Part Differential. Simple Operation HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:

More information

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

HYPERCALCEMIC GOLDEN RETRIEVER

HYPERCALCEMIC GOLDEN RETRIEVER Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

A Reliable Screening Protocol for Thalassemia and Hemoglobinopathies in Pregnancy An Alternative Approach to Electronic Blood Cell Counting

A Reliable Screening Protocol for Thalassemia and Hemoglobinopathies in Pregnancy An Alternative Approach to Electronic Blood Cell Counting Hematopathology / SCREENING FOR THALASSEMIA AND HEMOGLOBINOPATHIES IN PREGNANCY A Reliable Screening Protocol for Thalassemia and Hemoglobinopathies in Pregnancy An Alternative Approach to Electronic Blood

More information

Evaluation of haematology analyzer CELL-DYN 3700 SL

Evaluation of haematology analyzer CELL-DYN 3700 SL Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo

More information

Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels.

Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. Supplementary Online Material Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. John C Chambers, Weihua Zhang, Yun Li, Joban Sehmi, Mark N Wass, Delilah Zabaneh,

More information

Haemogram profile of dengue fever in adults during 19 September 12 November 2008: A study of 40 cases from Delhi

Haemogram profile of dengue fever in adults during 19 September 12 November 2008: A study of 40 cases from Delhi Haemogram profile of dengue fever in adults during 19 September 12 November 2008: A study of 40 cases from Delhi Sonia Advani, # Shikha Agarwal & Jitender Verma Department of Biotechnology Engineering,

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

Hematology: Challenging Cases with Your Participation COPYRIGHT

Hematology: Challenging Cases with Your Participation COPYRIGHT Hematology: Challenging Cases with Your Participation Reed E. Drews, MD Beth Israel Deaconess Medical Center Harvard Medical School Boston, MA Question 1 Question 1 64-year-old man is evaluated during

More information

ESM Table 2 Data extraction form and key data from included studies

ESM Table 2 Data extraction form and key data from included studies ESM Table 2 Data extraction form and key data from included studies Author, year and title Behan, 2006 [21] Cessation of menstruation improves the correlation of FPG to hemoglobin A 1c in Caucasian women

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

High Hemoglobin F in a Saudi Child Presenting with Pancytopenia

High Hemoglobin F in a Saudi Child Presenting with Pancytopenia Case Report imedpub Journals http://www.imedpub.com Journal of Pediatric Care ISSN 2471-805X DOI: 10.21767/2471-805X.100002 High Hemoglobin F in a Saudi Child Presenting with Pancytopenia Abstract Saudi

More information

Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference October 2017

Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference October 2017 Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference 11 13 October 2017 Chris Lambert Haematology Service Delivery Manager Viapath Laboratories Kings College Hospital HUMAN

More information

Hematological Profile of Sickle Cell Anemia Subjects in Central India: A Cross Sectional Analysis ABSTRACT

Hematological Profile of Sickle Cell Anemia Subjects in Central India: A Cross Sectional Analysis ABSTRACT Original Article DOI: 10.21276/APALM.1694 Hematological Profile of Sickle Cell Anemia Subjects in Central India: A Cross Sectional Analysis Vaishali Baburao Nagose* 1, and Shivanand Shriram Rathod 2 1

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene

More information

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test. 5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC

More information

namib la UnIVERSITY OF SCIEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES

namib la UnIVERSITY OF SCIEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES namib la UnIVERSITY OF SCIEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES QUALIFICATION: BACHELOR OF BIOMEDICAL SCIENCES QUALIFICATION CODE: SOBBMS LEVEL: 6 COURSE

More information

MHD II Session 3 STUDENT COPY

MHD II Session 3 STUDENT COPY MHD II, Session 3, Student Copy - Page 1 MHD II Session 3 January 15, 2016 STUDENT COPY MHD II, Session 3, Student Copy - Page 2 CASE HISTORY 1 Cc: Terrible diarrhea for 1 ½ days A 66 year-old woman presents

More information

BCR-ABL - LSK BCR-ABL + LKS - (%)

BCR-ABL - LSK BCR-ABL + LKS - (%) Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8

More information

Changes to CBC Reference Ranges

Changes to CBC Reference Ranges September 28, 2016 July, 2017 Changes to CBC Reference Ranges At Dynacare, our vision is to be Canada s health and wellness solutions leader. As part of our commitment and continuous efforts to enhance

More information

INVESTIGATION OF ANTIDIABETIC PROPERTIES, MECHANISMS OF ACTION AND TOXICOLOGY OF STRYCHNOS HENNINGSII (GILG) BARK.

INVESTIGATION OF ANTIDIABETIC PROPERTIES, MECHANISMS OF ACTION AND TOXICOLOGY OF STRYCHNOS HENNINGSII (GILG) BARK. INVESTIGATION OF ANTIDIABETIC PROPERTIES, MECHANISMS OF ACTION AND TOXICOLOGY OF STRYCHNOS HENNINGSII (GILG) BARK. OYEDEMI SUNDAY OYEWOLE SEPTEMBER, 2010 i INVESTIGATION OF ANTIDIABETIC PROPERTIES, MECHANISMS

More information