Latent HSV-1 does not induce apoptosis in human trigeminal ganglia

Transcription

1 JVI Accepted Manuscript Posted Online 11 March 2015 J. Virol. doi: /jvi Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 Latent HSV-1 does not induce apoptosis in human trigeminal ganglia Susanne Himmelein 1,2#, Anja Lindemann 1,2, Inga Sinicina 3, Michael Strupp 1,2, Thomas Brandt 2,5, Katharina Hüfner 1,2* Affiliations 1 Department of Neurology, Klinikum Grosshadern, Ludwig Maximilians University, Munich, Germany; 2 German Center for Vertigo and Balance Disorders, DSGZ, Ludwig Maximilians University, Munich, Germany; 3 Department of Legal Medicine, Ludwig Maximilians University, Munich, Germany; 5 Institute for Clinical Neurosciences, Klinikum Grosshadern, Ludwig Maximilians University, Munich, Germany; *Present address: Department of Biological Psychiatry, Medical University of Innsbruck, Innsbruck, Austria # Corresponding author: Dr. rer. nat. Susanne Himmelein, Department of Neurology, German Center for Vertigo and Balance Disorders, DSGZ, Klinikum Grosshadern, Ludwig Maximilians University, Feodor-Lynen Str. 19, Munich, Germany. Telephone: , Fax: and susanne.himmelein@med.uni-muenchen.de Running title: HSV-1 does not induce apoptosis Abstract in words: 74 Words in text:

2 Abstract Herpes-simplex-virus type 1 (HSV-1) can establish lifelong latency in human trigeminal ganglia. Latently infected ganglia contain CD8 + T cells which secrete granzyme B and are thus capable of inducing neuronal apoptosis. Using immunohistochemistry and single-cell RT-qPCR higher frequency and transcript levels of caspase-3 were found in HSV-1 negative compared to positive ganglia and neurons respectively. No TUNEL assay positive neurons were detected. The infiltrating T cells do not induce apoptosis in latently infected neurons Herpes-simplex-virus type 1 (HSV-1) can establish lifelong latency in sensory neurons of the trigeminal ganglia (TG). HSV-1 latency is characterized by expression of one viral RNA (the latency associated transcript (LAT)) in the absence of viral protein. LAT is believed to play a role in establishing latency (1, 2), in facilitating the process of reactivation (3-5), and at the same time promoting neuronal survival after HSV-1 infection by reducing apoptosis (6). In vitro, the anti-apoptotic effects of LAT are mediated by the inhibition of caspase-3-, -8- and -9-induced apoptosis (7, 8). In humans and animal models, CD8 + T cells are found in latently infected ganglia (9, 10). These CD8 + T cells have been shown to release lytic granules containing granzyme B (GrB) in humans (9, 11) and mice (12, 13). In the setting of HSV-1 latency, rather than inducing apoptosis, GrB cleaves infected-cell polypeptide 4 (ICP4)(13), an essential viral protein needed for viral gene expression, thereby preventing viral reactivation (14). It is a wellknown clinical phenomenon that even after multiple reactivations of HSV-1 in the TG, no sensory deficits occur. Here we investigate if this observation is mirrored by the pathoanatomical findings in human TG latently infected with HSV-1. 2

3 Human TG were obtained at autopsy at Ludwig Maximilians University (Munich, Germany) with the approval of the Ethics Committee of the Medical Faculty of the University (Supplementary Table S1). Whole ganglia including neurons projecting to all three branches were embedded directly after removal in Jung Tissue freezing medium (Leica Microsystems, Nussloch, Germany). Frozen sections of 10μm were cut for immunohistochemistry and ISH, while RNA and DNA were isolated from ten pooled 30μm sections. Immunohistochemistry was performed with antibodies against active caspase-3 (R&D Systems, Wiesbaden, Germany) and GrB (AbD Serotec, Puchheim, Germany), as described previously (15, 16). Staining was visualized using biotinconjugated secondary antibody (Dako, Hamburg, Germany), HRP-conjugated streptavidin (BioLegend, Fell, Germany), and 3-3 -diaminobenzidine (DAB; Dako) under an all-in-one fluorescence microscope (BZ-8100E, Keyence, Neu-Isenburg, Germany). Apoptosis was detected using a commercially available assay based on detecting terminal deoxynucleotidyl transferase (TdT)-mediated dutp nick end labeling, according to the manufacturer s instructions (Promega, Madison, USA). In situ hybridization for HSV-1 LAT (16, 17) was performed in combination with immunofluorescence against GrB or CD8 in subsequent staining steps. Appropriate fluorophore-conjugated probe or antibody was used for LAT and GrB or CD8 respectively (Dianova, Hamburg, Germany). Laser capture microdissection was done as described (17). Thirty LAT+ or LAT- neurons were marked electronically and microdissected. Single-cell RT-qPCR was performed using an Ambion kit (Life Technologies, Darmstadt, Germany) according to the manufacturer s instructions. Commercially and custom-made TaqMan Gene Expression 3

4 Assays were used (Life Technologies, Darmstadt, Germany). Statistical analyses were performed in Microsoft Excel and SPSS; p<0.05 was regarded as significant. Human TG sections from LAT+ and LAT- ganglia were investigated for signs of neuronal apoptosis: no TUNEL-positive neurons were found (Figure 1 A-C). Immunohistochemistry for the expression of active caspase-3 revealed neuronal staining in a limited number of cases (Table 1, Figure 1 D-F). A higher number of LAT- ganglia showed staining for active caspase-3 compared to LAT+ (Chi Square Test, p=0.043). Neurons positive for active caspase-3 did not, however, appear morphologically apoptotic. Caspase-3 expression was investigated using TaqMan RT-qPCR from the RNA of the cross-sectional area of the whole TG. No difference in the expression of caspase-3 between LAT+ and LAT- ganglia was observed (mean relative transcript number ( CI); mean ( CI), (Mann-Whitney U-Test p=0.545), Figure 2). No correlation between caspase-3 expression in whole TG and age or post-mortem delay was seen (Spearman correlation r=0.89, p=0.72; r= , p=0.87). When caspase-3 expression was assessed at a single-neuron level it was found to be higher in LAT- neurons vs LAT+ (mean relative transcript number ( CI); mean ( CI), (Mann-Whitney U-Test p=0.005), Figure 2). There was a negative correlation between the expression of LAT and caspase-3 on a single-cell level (Spearman correlation r=-0.552, p=0.009). Higher numbers of GrB positive cells were found in HSV-1 latently infected ganglia compared to non-infected (Mann-Whitney U-Test, p=0.05 (Table 1)). No indications that GrB positive cells surround more LAT+ or LAT- neurons were found (Figure 3). 4

5 In the current study we provide experimental evidence for the absence of apoptosis in sensory neurons latently infected with HSV-1. This finding could help to explain the clinical observation that sensory deficits do not occur even after recurrent HSV-1 reactivation. Elevated numbers of GrB-secreting T cells have been detected in HSV-1 latently infected ganglia. In most settings, GrB is known to cleave and activate caspase- 3, which in turn triggers the caspase cascade, leading to degradation of DNA and apoptosis (18, 19). The presence of CD8 + T cells expressing GrB in infected TG tissue suggests that these T cells are active and could induce apoptosis in infected neurons. However, the exact opposite seems to be the case. The TUNEL assays for apoptosis showed no positive neurons, and the detection of caspase-3 by immunohistochemistry was more frequent in individuals not infected with HSV-1. Active caspase-3 was found in some neurons; none of these neurons showed typical features of apoptosis in their cellular structure. This suggests that caspase-3 may play a role separate from that in the apoptotic caspase cascade. Functional studies have increasingly recognized that caspases have non-apoptotic functions in multiple cellular processes, such as inflammation, cell differentiation and proliferation (20, 21). In an animal model, active caspase-3 was also found in the nuclei of dorsal root ganglia neurons but these were not TUNEL-positive or morphologically apoptotic (22). From the current experiments we can only speculate about the mechanisms behind the inhibition of apoptosis in ganglia latently infected with HSV-1. As destruction of neurons is seen very rarely in mice (23, 24) and never in humans (11), infiltrating CD8 + T cells apparently do not release their full cytotoxic capacity. Knickelbein et al (12) describe a nonlethal mechanism of viral inactivation in which the lytic granule component, GrB, degrades the HSV-1 immediate 5

6 early protein, ICP4, which is essential for efficient viral transcription. Without inhibition of apoptosis, latently infected neurons could die in response to viral infection, thereby reducing the number of latent HSV-1 genomes through destruction of their host Acknowledgements This study was supported by a grant from the BMBF (German Ministry for Education and Research) IFB-01EO0901. We thank Katie Ogston and Sarah Flowerdew for copyediting the manuscript References 1. Thompson RL, Sawtell NM The herpes simplex virus type 1 latency-associated transcript gene regulates the establishment of latency. Journal of virology 71: Perng GC, Slanina SM, Yukht A, Ghiasi H, Nesburn AB, Wechsler SL The latencyassociated transcript gene enhances establishment of herpes simplex virus type 1 latency in rabbits. J.Virol. 74: Hill JM, Sedarati F, Javier RT, Wagner EK, Stevens JG Herpes simplex virus latent phase transcription facilitates in vivo reactivation. Virology 174: Perng GC, Dunkel EC, Geary PA, Slanina SM, Ghiasi H, Kaiwar R, Nesburn AB, Wechsler SL The latency-associated transcript gene of herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous reactivation of HSV-1 from latency. Journal of virology 68: Thompson RL, Sawtell NM The herpes simplex virus type 1 latency associated transcript locus is required for the maintenance of reactivation competent latent infections. Journal of neurovirology 17: Perng GC, Jones C, Ciacci-Zanella J, Stone M, Henderson G, Yukht A, Slanina SM, Hofman FM, Ghiasi H, Nesburn AB, Wechsler SL Virus-induced neuronal apoptosis blocked by the herpes simplex virus latency-associated transcript. Science 287: Henderson G, Peng W, Jin L, Perng GC, Nesburn AB, Wechsler SL, Jones C Regulation of caspase 8- and caspase 9-induced apoptosis by the herpes simplex virus type 1 latencyassociated transcript. Journal of neurovirology 8 Suppl 2: Jiang X, Chentoufi AA, Hsiang C, Carpenter D, Osorio N, BenMohamed L, Fraser NW, Jones C, Wechsler SL The herpes simplex virus type 1 latency-associated transcript can protect neuron-derived C1300 and Neuro2A cells from granzyme B-induced apoptosis and CD8 T-cell killing. Journal of virology 85: Derfuss T, Segerer S, Herberger S, Sinicina I, Hufner K, Ebelt K, Knaus HG, Steiner I, Meinl E, Dornmair K, Arbusow V, Strupp M, Brandt T, Theil D Presence of HSV-1 immediate early 6

7 genes and clonally expanded T-cells with a memory effector phenotype in human trigeminal ganglia. Brain Pathol 17: Feldman LT, Ellison AR, Voytek CC, Yang L, Krause P, Margolis TP Spontaneous molecular reactivation of herpes simplex virus type 1 latency in mice. Proceedings of the National Academy of Sciences of the United States of America 99: Theil D, Derfuss T, Paripovic I, Herberger S, Meinl E, Schueler O, Strupp M, Arbusow V, Brandt T Latent herpesvirus infection in human trigeminal ganglia causes chronic immune response. The American journal of pathology 163: Knickelbein JE, Khanna KM, Yee MB, Baty CJ, Kinchington PR, Hendricks RL Noncytotoxic lytic granule-mediated CD8+ T cell inhibition of HSV-1 reactivation from neuronal latency. Science 322: Liu T, Tang Q, Hendricks RL Inflammatory infiltration of the trigeminal ganglion after herpes simplex virus type 1 corneal infection. Journal of virology 70: DeLuca NA, McCarthy AM, Schaffer PA Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4. Journal of virology 56: Theil D, Arbusow V, Derfuss T, Strupp M, Pfeiffer M, Mascolo A, Brandt T Prevalence of HSV-1 LAT in human trigeminal, geniculate, and vestibular ganglia and its implication for cranial nerve syndromes. Brain Pathol 11: Flowerdew SE, Wick D, Himmelein S, Horn AK, Sinicina I, Strupp M, Brandt T, Theil D, Hufner K Characterization of neuronal populations in the human trigeminal ganglion and their association with latent herpes simplex virus-1 infection. PloS one 8:e Held K, Junker A, Dornmair K, Meinl E, Sinicina I, Brandt T, Theil D, Derfuss T Expression of herpes simplex virus 1-encoded micrornas in human trigeminal ganglia and their relation to local T-cell infiltrates. Journal of virology 85: Chowdhury D, Lieberman J Death by a thousand cuts: granzyme pathways of programmed cell death. Annual review of immunology 26: Pardo J, Aguilo JI, Anel A, Martin P, Joeckel L, Borner C, Wallich R, Mullbacher A, Froelich CJ, Simon MM The biology of cytotoxic cell granule exocytosis pathway: granzymes have evolved to induce cell death and inflammation. Microbes and infection / Institut Pasteur 11: Schwerk C, Schulze-Osthoff K Non-apoptotic functions of caspases in cellular proliferation and differentiation. Biochemical pharmacology 66: Wagner DC, Riegelsberger UM, Michalk S, Hartig W, Kranz A, Boltze J Cleaved caspase-3 expression after experimental stroke exhibits different phenotypes and is predominantly nonapoptotic. Brain research 1381: Cheng C, Zochodne DW Sensory neurons with activated caspase-3 survive long-term experimental diabetes. Diabetes 52: Decman V, Kinchington PR, Harvey SA, Hendricks RL Gamma interferon can block herpes simplex virus type 1 reactivation from latency, even in the presence of late gene expression. Journal of virology 79: Esaki S, Goshima F, Katsumi S, Watanabe D, Ozaki N, Murakami S, Nishiyama Y Apoptosis induction after herpes simplex virus infection differs according to cell type in vivo. Archives of virology 155:

8 Table 1: Total numbers and percentages of different markers analyzed Total neurons on caspase-3 stained slides Percentages of caspase-3 positive neurons Total neurons on GrB stained slides Percentages of GrB positive CD8 + T cells TG sections represent whole cross-sectional area with neurons projecting into all 3 branches LAT-, LAT+ individuals

9 Figure legends Figure 1: (A, D) The micrograph shows human TG stained for LAT by ISH, circle indicates LAT positive neuron, (B) micrograph shows staining for TUNEL, circle indicates the same neuron as in (A) on a consecutive slide which is TUNEL negative. (C) Micrograph shows positive control for detection of DNA fragmentation (DNase I treatment), circle indicates TUNEL positive neuron. (E) Micrograph shows staining for active caspase-3, circle indicates the same neuron as in (D) on a consecutive slide which is active caspase-3 negative. (F) Micrograph shows active caspase-3 positive neuron, circle indicates active caspase-3 positive neuron. All tissues were counterstained with haematoxylin, except for (F), this tissue was counterstained with methylgreen. Scale bars represent 50µm Figure 2: Boxplot A shows the difference in the expression of caspase-3 in LAT+ and LAT- single neurons. Boxplot B shows the difference in the expression of caspase-3 in LAT+ and LAT- whole ganglia. Boxes denote interquartile ranges, lines denote medians, and whiskers denote 5th and 95th percentiles. Each measurement was done in duplicate. The results were normalized to the housekeeping gene Glyceraldehyde 3- phosphate dehydrogenase (GAPDH). Commercially available TaqMan Gene Expression Assays: Caspase-3: Assay ID: Hs _m1; GAPDH: Assay ID: Hs _g1. Custom-made TaqMan Gene Expression assay: LAT (F: CCCACGTACTCCAAGAAGGC; R: AGACCCAAGCATAGAGAGCCAG; Probe: CCCACCCCGCCTGTGTTTTTGTGT) (Life Technologies, Darmstadt)

10 Figure 3: Fluorescence labeling of human TG stained for CD8 + T cells (red), GrB (green) and nucleus staining / DAPI (blue). Stained sections were analyzed by confocal imaging. The micrograph on the left was taken at 100x magnification for an overview, the one on the right at 400x for a more detailed view. Dashed circles indicate neurons with Lipofuscin in red, arrows indicate GrB-positive CD8 + T cells. Scale bars represent 50µm

11

12

13

14 Table 1: Total numbers and percentages of different markers analyzed Total neurons on caspase-3 stained slides Percentages of caspase-3 positive neurons Total neurons on GrB stained slides Percentages of GrB positive CD8 + T cells TG sections represent whole cross-sectional area with neurons projecting into all 3 branches LAT-, LAT+ individuals.