Latent HSV-1 does not induce apoptosis in human trigeminal ganglia

Save this PDF as:

Size: px
Start display at page:

Download "Latent HSV-1 does not induce apoptosis in human trigeminal ganglia"


1 JVI Accepted Manuscript Posted Online 11 March 2015 J. Virol. doi: /jvi Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 Latent HSV-1 does not induce apoptosis in human trigeminal ganglia Susanne Himmelein 1,2#, Anja Lindemann 1,2, Inga Sinicina 3, Michael Strupp 1,2, Thomas Brandt 2,5, Katharina Hüfner 1,2* Affiliations 1 Department of Neurology, Klinikum Grosshadern, Ludwig Maximilians University, Munich, Germany; 2 German Center for Vertigo and Balance Disorders, DSGZ, Ludwig Maximilians University, Munich, Germany; 3 Department of Legal Medicine, Ludwig Maximilians University, Munich, Germany; 5 Institute for Clinical Neurosciences, Klinikum Grosshadern, Ludwig Maximilians University, Munich, Germany; *Present address: Department of Biological Psychiatry, Medical University of Innsbruck, Innsbruck, Austria # Corresponding author: Dr. rer. nat. Susanne Himmelein, Department of Neurology, German Center for Vertigo and Balance Disorders, DSGZ, Klinikum Grosshadern, Ludwig Maximilians University, Feodor-Lynen Str. 19, Munich, Germany. Telephone: , Fax: and Running title: HSV-1 does not induce apoptosis Abstract in words: 74 Words in text:

2 Abstract Herpes-simplex-virus type 1 (HSV-1) can establish lifelong latency in human trigeminal ganglia. Latently infected ganglia contain CD8 + T cells which secrete granzyme B and are thus capable of inducing neuronal apoptosis. Using immunohistochemistry and single-cell RT-qPCR higher frequency and transcript levels of caspase-3 were found in HSV-1 negative compared to positive ganglia and neurons respectively. No TUNEL assay positive neurons were detected. The infiltrating T cells do not induce apoptosis in latently infected neurons Herpes-simplex-virus type 1 (HSV-1) can establish lifelong latency in sensory neurons of the trigeminal ganglia (TG). HSV-1 latency is characterized by expression of one viral RNA (the latency associated transcript (LAT)) in the absence of viral protein. LAT is believed to play a role in establishing latency (1, 2), in facilitating the process of reactivation (3-5), and at the same time promoting neuronal survival after HSV-1 infection by reducing apoptosis (6). In vitro, the anti-apoptotic effects of LAT are mediated by the inhibition of caspase-3-, -8- and -9-induced apoptosis (7, 8). In humans and animal models, CD8 + T cells are found in latently infected ganglia (9, 10). These CD8 + T cells have been shown to release lytic granules containing granzyme B (GrB) in humans (9, 11) and mice (12, 13). In the setting of HSV-1 latency, rather than inducing apoptosis, GrB cleaves infected-cell polypeptide 4 (ICP4)(13), an essential viral protein needed for viral gene expression, thereby preventing viral reactivation (14). It is a wellknown clinical phenomenon that even after multiple reactivations of HSV-1 in the TG, no sensory deficits occur. Here we investigate if this observation is mirrored by the pathoanatomical findings in human TG latently infected with HSV-1. 2

3 Human TG were obtained at autopsy at Ludwig Maximilians University (Munich, Germany) with the approval of the Ethics Committee of the Medical Faculty of the University (Supplementary Table S1). Whole ganglia including neurons projecting to all three branches were embedded directly after removal in Jung Tissue freezing medium (Leica Microsystems, Nussloch, Germany). Frozen sections of 10μm were cut for immunohistochemistry and ISH, while RNA and DNA were isolated from ten pooled 30μm sections. Immunohistochemistry was performed with antibodies against active caspase-3 (R&D Systems, Wiesbaden, Germany) and GrB (AbD Serotec, Puchheim, Germany), as described previously (15, 16). Staining was visualized using biotinconjugated secondary antibody (Dako, Hamburg, Germany), HRP-conjugated streptavidin (BioLegend, Fell, Germany), and 3-3 -diaminobenzidine (DAB; Dako) under an all-in-one fluorescence microscope (BZ-8100E, Keyence, Neu-Isenburg, Germany). Apoptosis was detected using a commercially available assay based on detecting terminal deoxynucleotidyl transferase (TdT)-mediated dutp nick end labeling, according to the manufacturer s instructions (Promega, Madison, USA). In situ hybridization for HSV-1 LAT (16, 17) was performed in combination with immunofluorescence against GrB or CD8 in subsequent staining steps. Appropriate fluorophore-conjugated probe or antibody was used for LAT and GrB or CD8 respectively (Dianova, Hamburg, Germany). Laser capture microdissection was done as described (17). Thirty LAT+ or LAT- neurons were marked electronically and microdissected. Single-cell RT-qPCR was performed using an Ambion kit (Life Technologies, Darmstadt, Germany) according to the manufacturer s instructions. Commercially and custom-made TaqMan Gene Expression 3

4 Assays were used (Life Technologies, Darmstadt, Germany). Statistical analyses were performed in Microsoft Excel and SPSS; p<0.05 was regarded as significant. Human TG sections from LAT+ and LAT- ganglia were investigated for signs of neuronal apoptosis: no TUNEL-positive neurons were found (Figure 1 A-C). Immunohistochemistry for the expression of active caspase-3 revealed neuronal staining in a limited number of cases (Table 1, Figure 1 D-F). A higher number of LAT- ganglia showed staining for active caspase-3 compared to LAT+ (Chi Square Test, p=0.043). Neurons positive for active caspase-3 did not, however, appear morphologically apoptotic. Caspase-3 expression was investigated using TaqMan RT-qPCR from the RNA of the cross-sectional area of the whole TG. No difference in the expression of caspase-3 between LAT+ and LAT- ganglia was observed (mean relative transcript number ( CI); mean ( CI), (Mann-Whitney U-Test p=0.545), Figure 2). No correlation between caspase-3 expression in whole TG and age or post-mortem delay was seen (Spearman correlation r=0.89, p=0.72; r= , p=0.87). When caspase-3 expression was assessed at a single-neuron level it was found to be higher in LAT- neurons vs LAT+ (mean relative transcript number ( CI); mean ( CI), (Mann-Whitney U-Test p=0.005), Figure 2). There was a negative correlation between the expression of LAT and caspase-3 on a single-cell level (Spearman correlation r=-0.552, p=0.009). Higher numbers of GrB positive cells were found in HSV-1 latently infected ganglia compared to non-infected (Mann-Whitney U-Test, p=0.05 (Table 1)). No indications that GrB positive cells surround more LAT+ or LAT- neurons were found (Figure 3). 4

5 In the current study we provide experimental evidence for the absence of apoptosis in sensory neurons latently infected with HSV-1. This finding could help to explain the clinical observation that sensory deficits do not occur even after recurrent HSV-1 reactivation. Elevated numbers of GrB-secreting T cells have been detected in HSV-1 latently infected ganglia. In most settings, GrB is known to cleave and activate caspase- 3, which in turn triggers the caspase cascade, leading to degradation of DNA and apoptosis (18, 19). The presence of CD8 + T cells expressing GrB in infected TG tissue suggests that these T cells are active and could induce apoptosis in infected neurons. However, the exact opposite seems to be the case. The TUNEL assays for apoptosis showed no positive neurons, and the detection of caspase-3 by immunohistochemistry was more frequent in individuals not infected with HSV-1. Active caspase-3 was found in some neurons; none of these neurons showed typical features of apoptosis in their cellular structure. This suggests that caspase-3 may play a role separate from that in the apoptotic caspase cascade. Functional studies have increasingly recognized that caspases have non-apoptotic functions in multiple cellular processes, such as inflammation, cell differentiation and proliferation (20, 21). In an animal model, active caspase-3 was also found in the nuclei of dorsal root ganglia neurons but these were not TUNEL-positive or morphologically apoptotic (22). From the current experiments we can only speculate about the mechanisms behind the inhibition of apoptosis in ganglia latently infected with HSV-1. As destruction of neurons is seen very rarely in mice (23, 24) and never in humans (11), infiltrating CD8 + T cells apparently do not release their full cytotoxic capacity. Knickelbein et al (12) describe a nonlethal mechanism of viral inactivation in which the lytic granule component, GrB, degrades the HSV-1 immediate 5

6 early protein, ICP4, which is essential for efficient viral transcription. Without inhibition of apoptosis, latently infected neurons could die in response to viral infection, thereby reducing the number of latent HSV-1 genomes through destruction of their host Acknowledgements This study was supported by a grant from the BMBF (German Ministry for Education and Research) IFB-01EO0901. We thank Katie Ogston and Sarah Flowerdew for copyediting the manuscript References 1. Thompson RL, Sawtell NM The herpes simplex virus type 1 latency-associated transcript gene regulates the establishment of latency. Journal of virology 71: Perng GC, Slanina SM, Yukht A, Ghiasi H, Nesburn AB, Wechsler SL The latencyassociated transcript gene enhances establishment of herpes simplex virus type 1 latency in rabbits. J.Virol. 74: Hill JM, Sedarati F, Javier RT, Wagner EK, Stevens JG Herpes simplex virus latent phase transcription facilitates in vivo reactivation. Virology 174: Perng GC, Dunkel EC, Geary PA, Slanina SM, Ghiasi H, Kaiwar R, Nesburn AB, Wechsler SL The latency-associated transcript gene of herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous reactivation of HSV-1 from latency. Journal of virology 68: Thompson RL, Sawtell NM The herpes simplex virus type 1 latency associated transcript locus is required for the maintenance of reactivation competent latent infections. Journal of neurovirology 17: Perng GC, Jones C, Ciacci-Zanella J, Stone M, Henderson G, Yukht A, Slanina SM, Hofman FM, Ghiasi H, Nesburn AB, Wechsler SL Virus-induced neuronal apoptosis blocked by the herpes simplex virus latency-associated transcript. Science 287: Henderson G, Peng W, Jin L, Perng GC, Nesburn AB, Wechsler SL, Jones C Regulation of caspase 8- and caspase 9-induced apoptosis by the herpes simplex virus type 1 latencyassociated transcript. Journal of neurovirology 8 Suppl 2: Jiang X, Chentoufi AA, Hsiang C, Carpenter D, Osorio N, BenMohamed L, Fraser NW, Jones C, Wechsler SL The herpes simplex virus type 1 latency-associated transcript can protect neuron-derived C1300 and Neuro2A cells from granzyme B-induced apoptosis and CD8 T-cell killing. Journal of virology 85: Derfuss T, Segerer S, Herberger S, Sinicina I, Hufner K, Ebelt K, Knaus HG, Steiner I, Meinl E, Dornmair K, Arbusow V, Strupp M, Brandt T, Theil D Presence of HSV-1 immediate early 6

7 genes and clonally expanded T-cells with a memory effector phenotype in human trigeminal ganglia. Brain Pathol 17: Feldman LT, Ellison AR, Voytek CC, Yang L, Krause P, Margolis TP Spontaneous molecular reactivation of herpes simplex virus type 1 latency in mice. Proceedings of the National Academy of Sciences of the United States of America 99: Theil D, Derfuss T, Paripovic I, Herberger S, Meinl E, Schueler O, Strupp M, Arbusow V, Brandt T Latent herpesvirus infection in human trigeminal ganglia causes chronic immune response. The American journal of pathology 163: Knickelbein JE, Khanna KM, Yee MB, Baty CJ, Kinchington PR, Hendricks RL Noncytotoxic lytic granule-mediated CD8+ T cell inhibition of HSV-1 reactivation from neuronal latency. Science 322: Liu T, Tang Q, Hendricks RL Inflammatory infiltration of the trigeminal ganglion after herpes simplex virus type 1 corneal infection. Journal of virology 70: DeLuca NA, McCarthy AM, Schaffer PA Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4. Journal of virology 56: Theil D, Arbusow V, Derfuss T, Strupp M, Pfeiffer M, Mascolo A, Brandt T Prevalence of HSV-1 LAT in human trigeminal, geniculate, and vestibular ganglia and its implication for cranial nerve syndromes. Brain Pathol 11: Flowerdew SE, Wick D, Himmelein S, Horn AK, Sinicina I, Strupp M, Brandt T, Theil D, Hufner K Characterization of neuronal populations in the human trigeminal ganglion and their association with latent herpes simplex virus-1 infection. PloS one 8:e Held K, Junker A, Dornmair K, Meinl E, Sinicina I, Brandt T, Theil D, Derfuss T Expression of herpes simplex virus 1-encoded micrornas in human trigeminal ganglia and their relation to local T-cell infiltrates. Journal of virology 85: Chowdhury D, Lieberman J Death by a thousand cuts: granzyme pathways of programmed cell death. Annual review of immunology 26: Pardo J, Aguilo JI, Anel A, Martin P, Joeckel L, Borner C, Wallich R, Mullbacher A, Froelich CJ, Simon MM The biology of cytotoxic cell granule exocytosis pathway: granzymes have evolved to induce cell death and inflammation. Microbes and infection / Institut Pasteur 11: Schwerk C, Schulze-Osthoff K Non-apoptotic functions of caspases in cellular proliferation and differentiation. Biochemical pharmacology 66: Wagner DC, Riegelsberger UM, Michalk S, Hartig W, Kranz A, Boltze J Cleaved caspase-3 expression after experimental stroke exhibits different phenotypes and is predominantly nonapoptotic. Brain research 1381: Cheng C, Zochodne DW Sensory neurons with activated caspase-3 survive long-term experimental diabetes. Diabetes 52: Decman V, Kinchington PR, Harvey SA, Hendricks RL Gamma interferon can block herpes simplex virus type 1 reactivation from latency, even in the presence of late gene expression. Journal of virology 79: Esaki S, Goshima F, Katsumi S, Watanabe D, Ozaki N, Murakami S, Nishiyama Y Apoptosis induction after herpes simplex virus infection differs according to cell type in vivo. Archives of virology 155:

8 Table 1: Total numbers and percentages of different markers analyzed Total neurons on caspase-3 stained slides Percentages of caspase-3 positive neurons Total neurons on GrB stained slides Percentages of GrB positive CD8 + T cells TG sections represent whole cross-sectional area with neurons projecting into all 3 branches LAT-, LAT+ individuals

9 Figure legends Figure 1: (A, D) The micrograph shows human TG stained for LAT by ISH, circle indicates LAT positive neuron, (B) micrograph shows staining for TUNEL, circle indicates the same neuron as in (A) on a consecutive slide which is TUNEL negative. (C) Micrograph shows positive control for detection of DNA fragmentation (DNase I treatment), circle indicates TUNEL positive neuron. (E) Micrograph shows staining for active caspase-3, circle indicates the same neuron as in (D) on a consecutive slide which is active caspase-3 negative. (F) Micrograph shows active caspase-3 positive neuron, circle indicates active caspase-3 positive neuron. All tissues were counterstained with haematoxylin, except for (F), this tissue was counterstained with methylgreen. Scale bars represent 50µm Figure 2: Boxplot A shows the difference in the expression of caspase-3 in LAT+ and LAT- single neurons. Boxplot B shows the difference in the expression of caspase-3 in LAT+ and LAT- whole ganglia. Boxes denote interquartile ranges, lines denote medians, and whiskers denote 5th and 95th percentiles. Each measurement was done in duplicate. The results were normalized to the housekeeping gene Glyceraldehyde 3- phosphate dehydrogenase (GAPDH). Commercially available TaqMan Gene Expression Assays: Caspase-3: Assay ID: Hs _m1; GAPDH: Assay ID: Hs _g1. Custom-made TaqMan Gene Expression assay: LAT (F: CCCACGTACTCCAAGAAGGC; R: AGACCCAAGCATAGAGAGCCAG; Probe: CCCACCCCGCCTGTGTTTTTGTGT) (Life Technologies, Darmstadt)

10 Figure 3: Fluorescence labeling of human TG stained for CD8 + T cells (red), GrB (green) and nucleus staining / DAPI (blue). Stained sections were analyzed by confocal imaging. The micrograph on the left was taken at 100x magnification for an overview, the one on the right at 400x for a more detailed view. Dashed circles indicate neurons with Lipofuscin in red, arrows indicate GrB-positive CD8 + T cells. Scale bars represent 50µm




14 Table 1: Total numbers and percentages of different markers analyzed Total neurons on caspase-3 stained slides Percentages of caspase-3 positive neurons Total neurons on GrB stained slides Percentages of GrB positive CD8 + T cells TG sections represent whole cross-sectional area with neurons projecting into all 3 branches LAT-, LAT+ individuals.


HSV LAT AND NEURONAL SURVIVAL International Reviews of Immunology, 23: 187 198, 2004 Copyright # Taylor & Francis Inc. ISSN: 0883-0185 print/1563-5244 online DOI: 10.1080=08830180490265592 HSV LAT AND NEURONAL SURVIVAL DAVID C. BLOOM

More information

Comparison of Herpes Simplex Virus Reactivation in Ganglia In Vivo and in Explants Demonstrates Quantitative and Qualitative Differences

Comparison of Herpes Simplex Virus Reactivation in Ganglia In Vivo and in Explants Demonstrates Quantitative and Qualitative Differences JOURNAL OF VIROLOGY, July 2004, p. 7784 7794 Vol. 78, No. 14 0022-538X/04/$08.00 0 DOI: 10.1128/JVI.78.14.7784 7794.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Comparison

More information

Key issues in varicella-zoster virus latency

Key issues in varicella-zoster virus latency Journal of NeuroVirology, 8(suppl. 2): 80 84, 2002 c 2002 Taylor & Francis ISSN 1355 0284/02 $12.00+.00 DOI: 10.1080/13550280290101058 Key issues in varicella-zoster virus latency Peter GE Kennedy Department

More information

Reactivation of herpes simplex virus type 1 in the mouse trigeminal ganglion: an in vivo study of virus antigen and immune cell infiltration

Reactivation of herpes simplex virus type 1 in the mouse trigeminal ganglion: an in vivo study of virus antigen and immune cell infiltration Journal of General Virology (1996), 77, 2583-259. Printed in Great Britain Reactivation of herpes simplex virus type 1 in the mouse trigeminal ganglion: an in vivo study of virus antigen and immune cell

More information

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell

More information

Explain the laboratory diagnosis of Rabies?

Explain the laboratory diagnosis of Rabies? Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable

More information

Spontaneous Regression Mechanisms of Lumbar Disc Herniation Role of apoptosis and macrophages during disc tissue resorption

Spontaneous Regression Mechanisms of Lumbar Disc Herniation Role of apoptosis and macrophages during disc tissue resorption Spontaneous Regression Mechanisms of Lumbar Disc Herniation Role of apoptosis and macrophages during disc tissue resorption Shigeru Kobayashi, MD,PhD, 1 Riya Kosaka MD,PhD 2, Adam Meir, FRCS, 2 1 Dept.

More information

Transcription of the herpes simplex virus, type 1 genome during productive and quiescent. infection of neuronal and non-neuronal cells.

Transcription of the herpes simplex virus, type 1 genome during productive and quiescent. infection of neuronal and non-neuronal cells. JVI Accepts, published online ahead of print on 9 April 2014 J. Virol. doi:10.1128/jvi.00516-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 Transcription of the

More information

Persistent Infections

Persistent Infections Persistent Infections Lecture 17 Biology W3310/4310 Virology Spring 2015 Paralyze resistance with persistence WOODY HAYES Acute vs persistent infections Acute infection - rapid and self-limiting Persistent

More information

The latency associated transcripts (LAT) of herpes simplex virus: still no end in sight

The latency associated transcripts (LAT) of herpes simplex virus: still no end in sight Review Journal of NeuroVirology (1997) 3, 313 ± 321 ã 1997 Journal of NeuroVirology, Inc. The latency associated transcripts (LAT) of herpes simplex virus: still no end in sight

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency

Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency CLINICAL MICROBIOLOGY REVIEWS, Jan. 2003, p. 79 95 Vol. 16, No. 1 0893-8512/03/$08.00 0 DOI: 10.1128/CMR.16.1.79 95.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Herpes Simplex

More information

Probe. Hind III Q,! ?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!

More information

EBV infection B cells and lymphomagenesis. Sridhar Chaganti

EBV infection B cells and lymphomagenesis. Sridhar Chaganti EBV infection B cells and lymphomagenesis Sridhar Chaganti How EBV infects B-cells How viral genes influence the infected B cell Differences and similarities between in vitro and in vivo infection How

More information

Oncolytic Immunotherapy: A Local and Systemic Antitumor Approach

Oncolytic Immunotherapy: A Local and Systemic Antitumor Approach Oncolytic Immunotherapy: A Local and Systemic Antitumor Approach Oncolytic immunotherapy Oncolytic immunotherapy the use of a genetically modified virus to attack tumors and induce a systemic immune response

More information

Tissue speci c distribution of the herpes simplex virus type 1 latency-associated transcripts on polyribosomes during latent infection

Tissue speci c distribution of the herpes simplex virus type 1 latency-associated transcripts on polyribosomes during latent infection Short Communication Journal of NeuroVirology (1998) 4, 426 ± 432 ã 1998 Journal of NeuroVirology, Inc. Tissue speci c distribution of the herpes simplex virus type 1 latency-associated

More information

Real-time imaging reveals the single steps of brain metastasis fo mation r

Real-time imaging reveals the single steps of brain metastasis fo mation r Real-time imaging reveals the single steps of brain metastasis fo mation r Yvonne Kienast, Louisa von Baumgarten, Martin Fuhrmann, Wolfgang E.F. Klinkert, Roland Goldbrunner, Jochen Herms and Frank Winkler

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

A Therapeutic Vaccine That Reduces Recurrent Herpes Simplex Virus Type 1 Corneal Disease

A Therapeutic Vaccine That Reduces Recurrent Herpes Simplex Virus Type 1 Corneal Disease A Therapeutic Vaccine That Reduces Recurrent Herpes Simplex Virus Type 1 Corneal Disease Anthony B. Nesburn, 1 ' 2 Rae Lyn Burke, 5 Homayon Ghiasi, 1 ' 2 Susan M. Slanina, 1 Steven L Wechsler 1 ' 2 and

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

All animals have innate immunity, a defense active immediately upon infection Vertebrates also have adaptive immunity

All animals have innate immunity, a defense active immediately upon infection Vertebrates also have adaptive immunity 1 2 3 4 5 6 7 8 9 The Immune System All animals have innate immunity, a defense active immediately upon infection Vertebrates also have adaptive immunity Figure 43.2 In innate immunity, recognition and

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

Apoptosis of sensory neurons and satellite cells after sciatic nerve transection in C57BL/6J mice

Apoptosis of sensory neurons and satellite cells after sciatic nerve transection in C57BL/6J mice Brazilian TUNEL labeling Journal of of C57BL/6J Medical and sensory Biological neurons Research and satellite (2001) cells 34: 375-380 ISSN 0100-879X Short Communication 375 Apoptosis of sensory neurons

More information

Induction of apoptosis accelerates reactivation of latent HSV-1 in ganglionic organ cultures and replication in cell cultures

Induction of apoptosis accelerates reactivation of latent HSV-1 in ganglionic organ cultures and replication in cell cultures Induction of apoptosis accelerates reactivation of latent HSV-1 in ganglionic organ cultures and replication in cell cultures Te Du, Guoying Zhou, and Bernard Roizman 1 Marjorie B. Kovler Viral Oncology

More information

Fluid movement in capillaries. Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system

Fluid movement in capillaries. Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system Capillary exchange Fluid movement in capillaries Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system Lymphatic vessels Lymphatic capillaries permeate

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Size nm m m

Size nm m m 1 Viral size and organization Size 20-250nm 0.000000002m-0.000000025m Virion structure Capsid Core Acellular obligate intracellular parasites Lack organelles, metabolic activities, and reproduction Replicated

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 Date :

More information

Adaptive Immunity: Specific Defenses of the Host

Adaptive Immunity: Specific Defenses of the Host 17 Adaptive Immunity: Specific Defenses of the Host SLOs Differentiate between innate and adaptive immunity, and humoral and cellular immunity. Define antigen, epitope, and hapten. Explain the function

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Detection of Latency-Related Viral RNAs in Trigeminal Ganglia of Rabbits Latently Infected with Herpes Simplex Virus Type 1

Detection of Latency-Related Viral RNAs in Trigeminal Ganglia of Rabbits Latently Infected with Herpes Simplex Virus Type 1 JOURNAL OF VIROLOGY, Dec. 1987, p. 3820-3826 0022-538X/87/123820-07$02.00/0 Copyright X3 1987, American Society for Microbiology Vol. 61, No. 12 Detection of Latency-Related Viral RNAs in Trigeminal Ganglia

More information

VARICELLA-ZOSTER VIRUS: DISEASE AND VACCINATION. Anne A. Gershon, Jason Chen, Michael Gershon Columbia University

VARICELLA-ZOSTER VIRUS: DISEASE AND VACCINATION. Anne A. Gershon, Jason Chen, Michael Gershon Columbia University VARICELLA-ZOSTER VIRUS: DISEASE AND VACCINATION Anne A. Gershon, Jason Chen, Michael Gershon Columbia University Varicella Zoster Virus (VZV) The rash of VZV is vesicular. Vesicular fluid is highly infectious.

More information


SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Shida Yousefi, Jeffrey A. Gold, Nicola Andina, James J. Lee, Ann M. Kelly, Evelyne

More information

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii María Lázaro-Díez, Itziar Chapartegui-González, Santiago Redondo-Salvo, Chike Leigh, David Merino, David San Segundo, Jesús

More information

Neural stem cells and the neurobiology of ageing. Chen Siyun 1, Dawe G.S. 2

Neural stem cells and the neurobiology of ageing. Chen Siyun 1, Dawe G.S. 2 ABSTRACT Neural stem cells and the neurobiology of ageing Chen Siyun 1, Dawe G.S. 2 Department of Physics, Faculty of Science, National University of Singapore 10 Kent Ridge Road, Singapore 117546 The

More information

Central dogma in modern neuroscience: Learning is mediated by changes in the strength of synaptic connections

Central dogma in modern neuroscience: Learning is mediated by changes in the strength of synaptic connections Central dogma in modern neuroscience: Learning is mediated by changes in the strength of synaptic connections Basic Problem: The human brain is composed of ~ 100 billion nerve cells (neurons), and each

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information


Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Effector Mechanisms of Cell-Mediated Immunity

Effector Mechanisms of Cell-Mediated Immunity Effector Mechanisms of Cell-Mediated Immunity Dr. Julia Rempel Section of Hepatology 789-3825 804D JBRC Topics: I. Types of Cell-Mediated Immunity II. Migration of Effector T Lymphocytes

More information

Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014

Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014 Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014 Phenylketonuria (PKU) is an autosomal recessive genetic disorder that causes an accumulation of toxic metabolites in

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

The Immune System All animals have innate immunity, a defense active immediately

The Immune System All animals have innate immunity, a defense active immediately The Immune System All animals have innate immunity, a defense active immediately upon infection Vertebrates also have adaptive immunity Figure 43.2 INNATE IMMUNITY (all animals) Recognition of traits shared

More information

during latent infection in mice (8, 35, 41, 47) and in humans (45). In this study, the 2.0-kb latency-associated transcript

during latent infection in mice (8, 35, 41, 47) and in humans (45). In this study, the 2.0-kb latency-associated transcript JOURNAL OF VIROLOGY, Sept. 1988, p. 3281-3287 Vol. 62, No. 9 0022-538X/88/093281-07$02.00/0 Copyright 1988, American Society for Microbiology Expression of Herpes Simplex Virus Type 1 (HSV-1) Latency-Associated

More information


APPENDIX 1 ETHICAL CLEARANCE APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition

More information

Chapter 35 Active Reading Guide The Immune System

Chapter 35 Active Reading Guide The Immune System Name: AP Biology Mr. Croft Chapter 35 Active Reading Guide The Immune System Section 1 Phagocytosis plays an important role in the immune systems of both invertebrates and vertebrates. Review the process

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Pepsin Solution ready-to-use

Pepsin Solution ready-to-use SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical

More information

Micro 204. Cytotoxic T Lymphocytes (CTL) Lewis Lanier

Micro 204. Cytotoxic T Lymphocytes (CTL) Lewis Lanier Micro 204 Cytotoxic T Lymphocytes (CTL) Lewis Lanier Lymphocyte-mediated Cytotoxicity CD8 + αβ-tcr + T cells CD4 + αβ-tcr + T cells γδ-tcr + T cells Natural Killer cells CD8 + αβ-tcr

More information

International Conference on Biomedical and Biological Engineering (BBE 2016)

International Conference on Biomedical and Biological Engineering (BBE 2016) International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Flexible and stretchable nanowire-coated fibers for optoelectronic probing of spinal cord circuits Chi Lu, Seongjun

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,

More information

Vestibular Neuritis With Minimal Canal Paresis: Characteristics and Clinical Implication

Vestibular Neuritis With Minimal Canal Paresis: Characteristics and Clinical Implication Original Article Clinical and Experimental Otorhinolaryngology Vol. 10, No. 2: 148-152, June 2017 pissn 1976-8710 eissn 2005-0720 Vestibular Neuritis With Minimal

More information

Section Lectures: Immunology/Virology Time: 9:00 am 10:00 am LRC 105 A & B

Section Lectures: Immunology/Virology Time: 9:00 am 10:00 am LRC 105 A & B Section Director: Cliff Bellone, Ph.D. Office: Doisy Hall - R 405 Phone: 577-8449 E-Mail: Lecturers: James Swierkosz, Ph.D. Office: Medical School Rm. 412 Phone: 577-8430 E-Mail:

More information

Overexpression of Interleukin-2 by a Recombinant Herpes Simplex Virus Type 1 Attenuates Pathogenicity and Enhances Antiviral Immunity

Overexpression of Interleukin-2 by a Recombinant Herpes Simplex Virus Type 1 Attenuates Pathogenicity and Enhances Antiviral Immunity JOURNAL OF VIROLOGY, Sept. 2002, p. 9069 9078 Vol. 76, No. 18 0022-538X/02/$04.00 0 DOI: 10.1128/JVI.76.18.9069 9078.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Overexpression

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Recent Findings from Analysis of HIV Clade C in India

Recent Findings from Analysis of HIV Clade C in India Recent Findings from Analysis of HIV Clade C in India Pankaj Seth, Ph.D Associate Professor, Molecular & Cellular Neuroscience National Brain Research Centre (NBRC) Manesar, INDIA NeuroAIDS

More information

Cerebrospinal Fluid EBV Replication is Associated with Compartmental Inflammation and Pleocytosis in HIV-positive naïve and Treated Individuals

Cerebrospinal Fluid EBV Replication is Associated with Compartmental Inflammation and Pleocytosis in HIV-positive naïve and Treated Individuals Cerebrospinal Fluid EBV Replication is Associated with Compartmental Inflammation and Pleocytosis in HIV-positive naïve and Treated Individuals Lupia T, Milia MG, Atzori C, Audagnotto S, Imperiale D, Romito

More information

Bioassays for Quality Control of Cell & Gene Therapy Products

Bioassays for Quality Control of Cell & Gene Therapy Products Bioassays for Quality Control of Cell & Gene Therapy Products Erik Rutjens, Cell & Gene Therapy, Novartis Pharma AG CASSS Bioassays, Silver Spring, March2015 CTL019 Introduction CARTs = Chimeric Antigen

More information

The development of T cells in the thymus

The development of T cells in the thymus T cells rearrange their receptors in the thymus whereas B cells do so in the bone marrow. The development of T cells in the thymus The lobular/cellular organization of the thymus Immature cells are called

More information

Immunity to Viruses. Patricia Fitzgerald-Bocarsly September 25, 2008

Immunity to Viruses. Patricia Fitzgerald-Bocarsly September 25, 2008 Immunity to Viruses Patricia Fitzgerald-Bocarsly September 25, 2008 The Immune System Deals with a Huge Range of Pathogens Roitt, 2003 Immune Responses to Viruses Viruses are dependent on the host cell

More information

Lahore University of Management Sciences. BIO314 Virology and Microbiology (Spring 2015)

Lahore University of Management Sciences. BIO314 Virology and Microbiology (Spring 2015) BIO314 Virology and Microbiology (Spring 2015) Instructor Room. Office Hours Email Telephone Secretary/TA TA Office Hours Course URL (if any) Shaper Mirza and Sadia Hamera Course

More information


IN VIVO STUDIES ON VIRAL VIRULENCE IN VIVO STUDIES ON VIRAL VIRULENCE M.Phil student: Emily TSUI Supervisor: Professor Paul K.S Chan Department of Microbiology, CUHK Date: 15th Dec, 2014 Viral Virulence Capacity of a virus to cause disease

More information


SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Methylprednisolone, Valacyclovir, or the Combination for Vestibular Neuritis

Methylprednisolone, Valacyclovir, or the Combination for Vestibular Neuritis The new england journal of medicine original article Methylprednisolone, Valacyclovir, or the Combination for Vestibular Neuritis Michael Strupp, M.D., Vera Carina Zingler, M.D., Viktor Arbusow, M.D.,

More information

Department of Neurology/Division of Anatomical Sciences

Department of Neurology/Division of Anatomical Sciences Spinal Cord I Lecture Outline and Objectives CNS/Head and Neck Sequence TOPIC: FACULTY: THE SPINAL CORD AND SPINAL NERVES, Part I Department of Neurology/Division of Anatomical Sciences LECTURE: Monday,

More information

Nervous System Histology

Nervous System Histology Nervous System Histology Week 9 Human Body Explorer Objective 1: Neuron Structure Parts of a Neuron - animation Link Breakdown 1 Dendrites (receptive regions) Cell body (Soma) (biosynthetic center and

More information

Distribution of Herpes Simplex virus Type 1 IgG antibodies in Kaduna metropolis

Distribution of Herpes Simplex virus Type 1 IgG antibodies in Kaduna metropolis ISSN: 2319-7706 Volume 2 Number 11 (2013) pp. 143-148 Original Research Article Distribution of Herpes Simplex virus Type 1 IgG antibodies in Kaduna metropolis K.Abdulfatai 1*, O.S.Olonitola

More information

Herpes Simplex Virus Type 1 2-Kilobase Latency-Associated Transcript Intron Associates with Ribosomal Proteins and Splicing Factors

Herpes Simplex Virus Type 1 2-Kilobase Latency-Associated Transcript Intron Associates with Ribosomal Proteins and Splicing Factors JOURNAL OF VIROLOGY, Dec. 2001, p. 12070 12080 Vol. 75, No. 24 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.24.12070 12080.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Herpes

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

2) What is the difference between a non-enveloped virion and an enveloped virion? (4 pts)

2) What is the difference between a non-enveloped virion and an enveloped virion? (4 pts) Micro 260 SFCC Spring 2010 Name: All diagrams and drawings shall be hand drawn (do not photo-copied from a publication then cut and pasted into work sheet). Do not copy other student s answers. Para phase

More information

Overview: Chapter 19 Viruses: A Borrowed Life

Overview: Chapter 19 Viruses: A Borrowed Life Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between

More information

otherwise known as Cytotoxic T lymphocytes (CTLs)

otherwise known as Cytotoxic T lymphocytes (CTLs) MIT Biology Department 7.012: Introductory Biology - Fall 200 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29, 2004

More information

The humoral immune responses to IBV proteins.

The humoral immune responses to IBV proteins. The humoral immune responses to IBV proteins. E. Dan Heller and Rosa Meir The Hebrew University of Jerusalem, Israel COST FA1207 meeting WG2 + WG3, Budapest, Jan. 2015 1 IBV encodes four major structural

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests

Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests 3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information


INTRODUCTION TO PATHOLOGY INTRODUCTION TO PATHOLOGY The literal translation of the word pathology is the study (logos) of suffering (pathos). It is a discipline that bridges clinical practice and basic sciences. Pathology is concerned

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION CHAPTER 13 Effector Responses: Cell- and Antibody-Mediated Immunity Copyright 2013 by W. H.

More information

OVERVIEW: Cells die by one of TWO mechanisms: Necrosis or Apoptosis

OVERVIEW: Cells die by one of TWO mechanisms: Necrosis or Apoptosis CELL DEATH OVERVIEW: Cells die by one of TWO mechanisms: Necrosis or Apoptosis Necrosis/morphological features Necrosis is a pathological process induced by accidental cell damage. A number of toxic chemical

More information

Introduction to Immunology Part 2 September 30, Dan Stetson

Introduction to Immunology Part 2 September 30, Dan Stetson Introduction to Immunology Part 2 September 30, 2016 Dan Stetson 441 Lecture #2 Slide 1 of 26 CLASS ANNOUNCEMENT PLEASE NO TREE NUTS IN CLASS!!! (Peanuts, walnuts, almonds, cashews, etc)

More information

The Enemy Within: Human Cytomegalovirus. Juliet V. Spencer University of San Francisco

The Enemy Within: Human Cytomegalovirus. Juliet V. Spencer University of San Francisco The Enemy Within: Human Cytomegalovirus Juliet V. Spencer University of San Francisco NCASM Spring Meeting March 8, 2014 Herpes is all around us Human Herpesviruses Clinical Presentation Herpes simplex

More information

Disease caused by herpes simplex virus

Disease caused by herpes simplex virus Recurrence of herpes simplex virus in rabbit eyes: Results of a three-year study Peter R. Laibson and Sidney Kibrick Spontaneous reactivation of herpes simplex virus in rabbit ocular tissue was found on

More information

The Comet and TUNEL Assays

The Comet and TUNEL Assays Sperm DNA: organization, protection and vulnerability from basic science to clinical application Methods to assess the status of the sperm DNA: The Comet and TUNEL Assays Lars Björndahl Centre for Andrology

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Common Characteristics and Distinct Features of Human Pathogenic Herpesviruses

Common Characteristics and Distinct Features of Human Pathogenic Herpesviruses Common Characteristics and Distinct Features of Human Pathogenic Herpesviruses Hartmut Hengel Chapter 1 1.1 Hallmarks of Herpesvirus Infections The members of the family of the herpesviridae are phylogenetically

More information

were isolated from the freshly drawn blood of healthy donors and ACS patients using the

were isolated from the freshly drawn blood of healthy donors and ACS patients using the Supplemental Figure 1. Quality control of CD4 + T-cell purification. CD4 + T cells were isolated from the freshly drawn blood of healthy donors and ACS patients using the RosetteSep CD4 + T Cell Enrichment

More information

Chapter 14 Part One Biotechnology and Industry: Microbes at Work

Chapter 14 Part One Biotechnology and Industry: Microbes at Work Chapter 14 Part One Biotechnology and Industry: Microbes at Work Objectives: After reading Chapter 14, you should understand How biotechnology has resulted in numerous pharmaceutical products to help lessen

More information