Supplementary Materials for
|
|
|
- Jeremy Patrick
- 5 years ago
- Views:
Transcription
1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels Mike Hupe,* Minerva Xueting Li, Susanne Kneitz, Daria Davydova, Chika Yokota, Julianna Kele, Belma Hot, Jan M. Stenman, Manfred Gessler The PDF file includes: *Corresponding author. Published 11 July 2017, Sci. Signal. 10, eaag2476 (2017) DOI: /scisignal.aag2476 Fig. S1. Gene expression in the embryonic CNS vasculature at E14.5. Fig. S2. Translated transcripts encoding transporters in the embryonic CNS vasculature. Fig. S3. Translated transcripts encoding molecular markers related to physical barrier properties in the embryonic CNS vasculature. Fig. S4. Translated transcripts encoding transcription factors in embryonic vasculature. Fig. S5. Cdh5CreERT2 driver line activity is not strictly limited to ECs only. Fig. S6. Validation of TRAP-seq results by in situ hybridization. Fig. S7. Brain EC maturation during embryonic development. Fig. S8. Ctnnb1 deletion dependent molecular changes in brain ECs. Fig. S9. Single-cell sequence reads and mapping. Fig. S10. High EC heterogeneity at the single-cell level for genes encoding general EC markers or mcherry. Fig. S11. High EC heterogeneity at the single-cell level for genes encoding specific BBB markers. Fig. S12. High level of EC heterogeneity. Fig. S13. High EC heterogeneity at the single-cell level for genes encoding transcription factors identified as enriched in CNS vasculature by TRAP-seq. Legends for tables S1 to S28 Other Supplementary Material for this manuscript includes the following: (available at
2 Table S1 (Microsoft Excel format). Specifically translated genes in brain ECs. Table S2 (Microsoft Excel format). Brain EC enriched transcripts. Table S3 (Microsoft Excel format). Transcripts shared between ECs from all other organs. Table S4 (Microsoft Excel format). Brain EC depleted transcripts. Table S5 (Microsoft Excel format). Specifically translated genes in brain ECs during embryonic development. Table S6 (Microsoft Excel format). Regulated transcripts in brain ECs during embryonic development. Table S7 (Microsoft Excel format). Transcripts with increasing translation in brain ECs during embryonic development. Table S8 (Microsoft Excel format). Transcripts with decreasing translation in brain ECs during embryonic development. Table S9 (Microsoft Excel format). Genes with increasing and subsequently decreasing translation in brain ECs during embryonic development. Table S10 (Microsoft Excel format). Genes with decreasing and subsequently increasing translation in brain ECs during embryonic development. Table S11 (Microsoft Excel format). E14.5 brain EC enriched transcripts during embryonic development. Table S12 (Microsoft Excel format). E14.5 shared EC transcripts during embryonic development. Table S13 (Microsoft Excel format). E14.5 brain EC depleted genes during embryonic development. Table S14 (Microsoft Excel format). Genes encoding angiogenesis marker in brain ECs during embryonic development. Table S15 (Microsoft Excel format). Genes encoding proliferation and cell cycle marker in brain ECs during embryonic development. Table S16 (Microsoft Excel format). Ctnnb1 KO deleted transcripts in brain ECs at E14.5. Table S17 (Microsoft Excel format). Ctnnb1 KO deleted transcripts in brain ECs at E17.5. Table S18 (Microsoft Excel format). E14.5 brain EC enriched transcripts in Ctnnb1 KO brain ECs. Table S19 (Microsoft Excel format). Ctnnb1 KO enriched transcripts in brain ECs at E14.5. Table S20 (Microsoft Excel format). Ctnnb1 KO enriched transcripts in brain ECs at E17.5. Table S21 (Microsoft Excel format). E14.5 shared EC transcripts in Ctnnb1 KO brain ECs. Table S22 (Microsoft Excel format). Genes encoding angiogenesis marker in Ctnnb1 KO brain ECs. Table S23 (Microsoft Excel format). E14.5 brain EC depleted genes in Ctnnb1 KO brain ECs. Table S24 (Microsoft Excel format). Genes encoding proliferation and cell cycle marker in Ctnnb1 KO brain ECs.
3 Table S25 (Microsoft Excel format). Genes encoding housekeeping markers in single cells. Table S26 (Microsoft Excel format). Genes encoding EC markers in single cells. Table S27 (Microsoft Excel format). Genes encoding neuronal markers in single cells. Table S28 (Microsoft Excel format). Genes encoding housekeeping markers in single HEK293T cells.
4 Fig. S1. Gene expression in the embryonic CNS vasculature at E14.5. (A-D) Expression of transcripts identified to be translated (A), enriched (B), or depleted (C) in the brain vasculature or shared (D) among all endothelial beds. (E to H) Gene ontology (GO) analysis of the transcripts identified to be translated (E), enriched (F), depleted (G) in the brain vasculature or shared (H) amongst all endothelial beds. Analysis of the gene list for brain EC-depleted transcripts did not provide strong enrichments likely due to the limited number of genes. Data from N = 3 biological replicates.
5 Fig. S2. Translated transcripts encoding transporters in the embryonic CNS vasculature. TRAP-seq expression of genes encoding transporters, which were identified as enriched in brain vasculature (A) or in all analyzed vascular beds (B) in ECs from E14.5 embryos, in different temporal and spatial EC populations and their associated organs in wild-type (WT) or Ctnnb1 deletion (KO) embryos. Data are means ± standard deviations for N = 4 biological replicates for brain E17.5 KO, N = 3 biological replicates for all other samples.
6 Fig. S3. Translated transcripts encoding molecular markers related to physical barrier properties in the embryonic CNS vasculature. TRAP-seq expression of genes encoding tight junction molecules (A) and a marker for EC fenestration (B), which were identified in ECs from E14.5 embryos, in different temporal and spatial EC populations and their associated organs at wild-type (WT) or Ctnnb1 deletion (KO). Data are means ± standard deviations for N = 4 biological replicates for brain E17.5 KO, N = 3 biological replicates for all other samples.
7 Fig. S4. Translated transcripts encoding transcription factors in embryonic vasculature. TRAP-seq expression of genes encoding transcription factors that were identified as enriched in brain vasculature (A) or in all analyzed vascular beds (B) in ECs from E14.5 embryos, in different temporal and spatial EC populations and their associated organs at wild-type (WT) or Ctnnb1 deletion (KO) embryos. Note that Myt1l was subsequently excluded as being expressed in brain ECs. Data are means ± standard deviations for N = 4 biological replicates for brain E17.5 KO, N = 3 biological replicates for all other samples.
8 Fig. S5. Cdh5CreERT2 driver line activity is not strictly limited to ECs only. (A) Immunofluorescence using antibodies directed against mcherry (red) and Pecam1 (green), with DAPI nuclear counterstaining (blue) of adult Cdh5CreERT2 +/- ;R26-mCherry-Rpl10a +/- mouse cortical slices. Scale bar, 15 µm. Note the presence of the Cdh5CreERT2-induced mcherry-rpl10a fusion protein in Pecam1-negative cells (arrow). (B) TRAP-seq expression of genes encoding specific cell linage markers in brain ECs and total brain to verify the specificity of the Cdh5CreERT2 driver line. Note that, in addition to the enrichment for genes encoding blood EC markers (Cdh5, Kdr, Pecam1) in the EC population, enrichment for the polydendrocyte marker Cspg4 was observed throughout embryonic development with maximal enrichment at E14.5. Data are means ± standard deviations for N = 3 biological replicates.
9 Fig. S6. Validation of TRAP-seq results by in situ hybridization. (A and B) In situ hybridization of the EC marker Flt1 (A) or newly identified brain EC enriched genes (B) and autofluorescence of erythrocytes of cortical slices from E14.5 or E16.5 CD-1 mouse embryos. Arrows indicate erythrocytes in labeled vessels. Scale bar, 50 µm. Images are representative of at least 3 biological replicates. (C, D) Expression of Flt1 (C) or newly identified brain EC enriched genes (D) in the 80 individual cells from E14.5 embryos that were subjected to RNA-seq analysis. Black lines indicate the average expression in the EC (red) and non-ec (grey) population.
10 Fig. S7. Brain EC maturation during embryonic development. (A to E) Expression of genes identified at E14.5 as enriched (A), shared (B), or depleted (C) in brain ECs compared with other vascular beds as well as genes encoding markers for angiogenesis (D) or proliferation and cell cycle (E) during the developmental stages E11.5 E17.5. N = 3 biological replicates. (F) Quantification of the different transcript groups showing significantly (DESeq padj < 0.001) enriched (yellow) or depleted (blue) translation between E11.5 and E17.5. (G and H) Box plots of calculated z-scores of relative expression during developmental stages E11.5 E17.5 for 98 genes shared between all endothelial beds at E14.5 (G) or 50 genes encoding markers for proliferation and cell cycle (H). N = 3 biological replicates. Statistical significance was calculated using nonparametric Friedman with post hoc Nemenyi test (***p < 0.001, **p < 0.01, *p < 0.05).
11 Fig. S8. Ctnnb1 deletion dependent molecular changes in brain ECs. (A to E) Expression of genes identified as enriched (A), shared (B), or depleted (C) in the CNS vasculature compared with other vascular beds as well as genes encoding markers for angiogenesis (D) or proliferation and cell cycle (E) in wild-type (WT) or Ctnnb1-deleted (KO) brain ECs at E14.5 and E17.5. N = 3 biological replicates (N = 4 for brain E17.5 KO). (F) Quantification of the different transcript groups showing significantly (DESeq padj < 0.001) increased (yellow) or decreased (blue) translation at E14.5 and E17.5 in Ctnnb1 KO ECs. (G to H) Box plots of calculated z-scores of relative expression during developmental stages E11.5 E17.5 in control or Ctnnb1 KO ECs at E14.5 and E17.5 for 98 genes shared between all endothelial beds (G) or 50 genes encoding markers for proliferation and cell cycle (H). N = 3 biological replicates (N = 4 for brain E17.5 KO). Statistical significance was calculated using nonparametric Friedman with post hoc Nemenyi test (***p < 0.001).
12 Fig. S9. Single-cell sequence reads and mapping. (A) Number of reads obtained for each analyzed individual cell. (B) Mapping of the obtained reads for each analyzed individual cell.
13 Fig. S10. High EC heterogeneity at the single-cell level for genes encoding general EC markers or mcherry. (A) Expression of six well-established general EC markers in the 80 sequenced single cells at E14.5. Group assignment and order of cells as in Fig. 4B. ECs (red), microglia (blue), and neuronal cells (green). Horizontal black lines indicate the average expression of the EC or non-ec population accordingly. Note that Tek showed very low expression in several ECs. (B) Expression of mcherry in the 80 sequenced single cells at E14.5. Group assignment and order of cells as in Fig. 4B. ECs (red), microglia (blue) and neuronal cells (green). Note that mcherry was highly expressed by 2 microglia.
14 Fig. S11. High EC heterogeneity at the single-cell level for genes encoding specific BBB markers. Expression of eight well-established markers enriched in CNS vasculature in the 80 sequenced single cells at E14.5. Group assignment and order of cells as in Figure 4B. ECs (red), microglia (blue), and neuronal cells (green). Horizontal black lines indicate the average expression of the EC or non-ec population accordingly.
15 Fig. S12. High level of EC heterogeneity. (A) Calculations of the coefficient of variation for the expression of 30 housekeeping genes and 30 genes encoding cell-specific markers in the indicated single-cell populations. ECs (61cells, red), neuronal cells (12 cells, green), and HEK293T cells (35 cells, blue). Data are means ± standard deviations. (B) Visualizations of standard deviation of the calculated z-scores of relative expression of 30 housekeeping genes and 30 genes encoding cell-specific markers in the indicated single-cell populations. Statistical significance was calculated using robust Brown-Forsythe Levene-type test (***p < 0.001).
16 Fig. S13. High EC heterogeneity at the single-cell level for genes encoding transcription factors identified as enriched in CNS vasculature by TRAP-seq. Expression of eight genes encoding transcription factors, identified by TRAP-seq as enriched in brain ECs, in the 80 sequenced single cells at E14.5. Group assignment and order of cells as in Figure 4B. ECs (red), microglia (blue), and neuronal cells (green). Horizontal black lines indicate the average expression of the EC or non-ec population accordingly. Note that Foxl2 and Zfp551 showed higher expression only in a few distinct ECs. Myt1l was not expressed in ECs.
17 Tables S1 to S28 are provided in a separate Excel file. Table S1. Specifically translated genes in brain ECs. Table S2. Brain EC enriched transcripts. Table S3. Transcripts shared between ECs from all other organs. Table S4. Brain EC depleted transcripts. Table S5. Specifically translated genes in brain ECs during embryonic development. Table S6. Regulated transcripts in brain ECs during embryonic development. Table S7. Transcripts with increasing translation in brain ECs during embryonic development. Table S8. Transcripts with decreasing translation in brain ECs during embryonic development. Table S9. Genes with increasing and subsequently decreasing translation in brain ECs during embryonic development. Table S10. Genes with decreasing and subsequently increasing translation in brain ECs during embryonic development. Table S11. E14.5 brain EC enriched transcripts during embryonic development. Table S12. E14.5 shared EC transcripts during embryonic development. Table S13. E14.5 brain EC depleted genes during embryonic development. Table S14. Genes encoding angiogenesis marker in brain ECs during embryonic development. Table S15. Genes encoding proliferation and cell cycle marker in brain ECs during embryonic development. Table S16. Ctnnb1 KO deleted transcripts in brain ECs at E14.5. Table S17. Ctnnb1 KO deleted transcripts in brain ECs at E17.5. Table S18. E14.5 brain EC enriched transcripts in Ctnnb1 KO brain ECs. Table S19. Ctnnb1 KO enriched transcripts in brain ECs at E14.5. Table S20. Ctnnb1 KO enriched transcripts in brain ECs at E17.5. Table S21. E14.5 shared EC transcripts in Ctnnb1 KO brain ECs. Table S22. Genes encoding angiogenesis marker in Ctnnb1 KO brain ECs. Table S23. E14.5 brain EC depleted genes in Ctnnb1 KO brain ECs. Table S24. Genes encoding proliferation and cell cycle marker in Ctnnb1 KO brain ECs. Table S25. Genes encoding housekeeping markers in single cells. Table S26. Genes encoding EC markers in single cells. Table S27. Genes encoding neuronal markers in single cells. Table S28. Genes encoding housekeeping markers in single HEK293T cells.
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Supplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Supplementary Figure 1
Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Nature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
Inhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
Thomas HAIDER Journal Club
Thomas HAIDER Journal Club 20.10.2014 Background Immunology of the CNS - History Ehrlich, 1885 & 1904 dye did not stain brain -> BBB Shirai, Y. (1921) On the transplantation of the rat sarcoma in adult
Chapter 6. Villous Growth
Core Curriculum in Perinatal Pathology Chapter 6 Villous Growth Overview of vasculogenesis and angiogenesis Vasculogenesis Extraembryonic Vasculogenesis Angiogenesis Branching angiogenesis Sprouting angiogenesis
Supplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
Supplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/10/e1500775/dc1 Supplementary Materials for Structural-functional connectivity deficits of neocortical circuits in the Fmr1 /y mouse model of autism Matthias
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Figure S1: Pial and periventricular vascular networks and the dual GABA neuron streams of the early embryonic mouse telencephalon
Supplementary Figure S1: Pial and periventricular vascular networks and the dual GABA neuron streams of the early embryonic mouse telencephalon a) The profile of GABA neurons arriving at the pallial-subpallial
Supplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte
Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and
(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
1. Microfluidic device characteristics and cell compartmentalization
Supplementary figures: 1. Microfluidic device characteristics and cell compartmentalization Microfluidic channels were molded in PDMS (Fig. S1 A and B) over silicon masters, which were structured with
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
SOM Husse et al. Supplementary online material. Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN
SOM Husse et al. Supplementary online material Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN Jana Husse, Xunlei Zhou, Anton Shostak, Henrik Oster and Gregor Eichele SOM Husse et al.,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3443 In the format provided by the authors and unedited. Supplementary Figure 1 TC and SC behaviour during ISV sprouting. (a) Predicted outcome of TC division and competitive Dll4-Notch-mediated
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Ahtiainen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Boucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
Supplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
Cellular components of CNS
Cellular components of CNS Cellular components of CNS Neurons Glial cells: Astrocytes (including radial glia), oligodendrocytes, microglia, ependymal cells Epithelial cells of choroid plexus Endothelial
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN
UNC-6/Netrin mediates dendritic self-avoidance Cody J. Smith 1, Joseph D. Watson 1,4,5, Miri K. VanHoven 2, Daniel A. Colón-Ramos 3 and David M. Miller III 1,4,6 1 Department of Cell and Developmental
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/8/e1700521/dc1 Supplementary Materials for Functional vascularized lung grafts for lung bioengineering N. Valerio Dorrello, Brandon A. Guenthart, John D. O Neill,
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
a 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1
(GFP+ BrdU+)/GFP+ Labeling index Labeling index Figure S a, b, y =,x +, y =,x +,,,,,,,, Time (h) - - Time (h) c d S G M G h M G S G M G S G h Time of BrdU injection after electroporation (h) M G S G M
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The
Emx2 patterns the neocortex by regulating FGF positional signaling
Emx2 patterns the neocortex by regulating FGF positional signaling Tomomi Fukuchi-Shimogori and Elizabeth A Grove Presented by Sally Kwok Background Cerebral cortex has anatomically and functionally distinct
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Digitizing the Proteomes From Big Tissue Biobanks
Digitizing the Proteomes From Big Tissue Biobanks Analyzing 24 Proteomes Per Day by Microflow SWATH Acquisition and Spectronaut Pulsar Analysis Jan Muntel 1, Nick Morrice 2, Roland M. Bruderer 1, Lukas
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.
Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/358/ra2/dc1 Supplementary Materials for Localized TRPA1 channel Ca 2+ signals stimulated by reactive oxygen species promote cerebral artery dilation Michelle
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
Cluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,
A Transcriptome (RNA-seq) Transcriptome (RNA-seq) 3. 2.5 2..5..5...5..5 2. 2.5 3. 2.5 2..5..5...5..5 2. 2.5 Cluster Dendrogram RS_ES3.2 RS_ES3. RS_SHS5.2 RS_SHS5. PS_SHS5.2 PS_SHS5. RS_LJ3 PS_LJ3..4 _SHS5.2
What Cell Make Up the Brain and Spinal Cord
What Cell Make Up the Brain and Spinal Cord Jennifer LaVail, Ph.D. (http://anatomy.ucsf.edu/pages/lavaillab/index.html) What kinds of cells are these?" Neuron?" Epithelial cell?" Glial cell?" What makes
Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,
Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
Supplementary figures
Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed
Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants
SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,