Supplemental Methods: Histopathology scoring of individual components of Valentino

Size: px
Start display at page:

Download "Supplemental Methods: Histopathology scoring of individual components of Valentino"

Transcription

1 Supplementary Materials Online: Supplemental Methods: Histopathology scoring of individual components of Valentino synovitis grade and Mankin cartilage pathology scale Hemophilic synovitis was graded 0-10 points according to the system validated by Valentino et al. This scale awards 0-3 points for increasing synovial thickening, 0-3 points for increasing synovial vascularity and 0 or 1 point each for the presence of frank blood, discoloration by hemosiderin, synovial villous formation, and for gross cartilage erosion. In addition, the microscopic pathology in cartilage was scored using the modified Mankin scale This scale awards 0-14 points according to increasing degeneration of cartilage structure, cartilage cellularity, cartilage staining, and tidemark integrity. The Valentino and Mankin scores were combined to produce a Global Murine Hemarthrosis Score, as previously described 9. Gross structural changes in cartilage during the 8 week time course as graded by the Mankin score were minimal in this single hemarthrosis challenge, so that the trends for pathology as graded by the Global Score (included as Supplemental Figure 1) were similar to those graded by the Valentino score. The individual components of the Valentino synovitis grade, were also examined. (Supplemental Figure 2) As early as 24 hours after injury the clearance of blood from the synovial space in the WT and WT + Blood groups was nearly complete. This finding contrasts with the frank blood that dwelled in the joints of FIX -/- mice through at least day 3, by which time thickening of synovial lining cells was evident (Table 1, Figure 1B, Supplemental Figure 2). Synovitis, characterized by proliferative thickening of the fibroblast-like synoviocyte layer and dense subsynovial inflammatory infiltrate, developed in the joints of all FIX -/- mice, peaking on day 14 at a mean score of 4.9 out of a possible 10 points using the Valentino mouse synovitis scale. (Table 1, Figure 1A, 1B, Supplemental Figure 2) The corresponding peak synovitis score was 1.0 for the WT mice (day 5-7) and for the WT + Blood the peak synovitis

2 score was 1.4 (day 5). At the day 14 time point when FIX -/- mice demonstrated peak synovitis (day 14) and increasing neoangiogenesis, the WT + Blood group demonstrated strikingly better healing, with synovitis score only 0.33 and neovascular changes essentially resolved. (Table 1, Figure 1A, Figure 1B; Supplemental Figure 2) At no point during the 56 days of observation did the hemophilic mice completely resolve the synovitis, with persistent neovascularity contributing the most to the chronic histopathology. (Figure 1A, 1B, Supplemental Figure 2) In contrast with the FIX -/- findings, both groups of mice with normal thrombin-generating potential healed with minimal pathology. Supplemental Methods: Histopathologic evaluation of FIX -/- joint wound healing Sections were prepared with Prussian Blue stain for tissue iron. Iron staining was scored as not present (0); weak (1+); positive (2+); or strongly positive (3+) as previously described by Hoffman et al. 6 Sections were prepared for immunohistochemical staining and grading for macrophages and endothelial cells as previously described by Hoffman et al. 6 with some modifications. Macrophage infiltration was identified by immunostaining for CD68 using rat antimouse F4/80 (Serotec, Raleigh, NC, USA) at a 1:50 dilution, followed by biotinylated anti-rat IgG (Vector Laboratories, Burlingame, CA, USA) at a dilution of 1:100. The grading scheme used by Hoffman et al was used to evaluate the most heavily infiltrated portion of synovium: grade 0, no macrophages; 1+, scattered macrophages; 2+, lines of macrophages; 3+, clusters of macrophages; 4+, sheets of macrophages. Endothelial cells were identified by staining for VWF with a rabbit polyclonal primary antibody (abcam, Cambridge, MA, USA). Vessel profiles were defined as rounded or elongated spaces bounded by VWF-staining endothelial cells for serial quantification of vessel per high-powered field within synovium.

3 Supplemental Methods and Results: Dose finding study of recombinant nonacog beta pegol and unmodified rfix A dose-finding study of the effect of nonacog beta pegol (N9-GP) given early in response to induced joint hemorrhage was performed to determine an informative dose of N9-GP for subsequent study. A comparative study of the effect of N9-GP to preserve normal joint health employing the joint capsule puncture model was performed examining doses of 0.4 mg/kg (equivalent to 76 IU/kg), 0.75 mg/kg (143 IU/kg), 1.5 mg/kg (285 IU/kg) and 2.5 mg/kg (470 IU/kg) given intravenously at 20 minutes following injury to FIX -/- mice, in a fashion identical to induced hemarthrosis conditions used throughout the studies in this report. An additional group of FIX -/- mice received the same induced hemarthrosis followed by recombinant FIX (Benefix ) intravenously 20 minutes following injury. (Supplemental Table 1). In addition, one group of FIX -/- mice was infused with normal saline alone as an untreated hemophilic control group (NS). We have previously established that untreated hemophilia B mice never score less than 2/10 synovitis pathology score (Valentino scale) at two weeks following this bleeding challenge 8,23 ; in the same study we demonstrated that WT mice experiencing the same bleeding challenge do not score more than 2/10 synovitis when evaluated two weeks after induced hemarthrosis. The doses of 1.5 mg/kg (equivalent to ~280 Units/kg) 22 and 2.5 mg/kg (~470 Units/kg) each led to a mean synovitis score of <2/10 (untreated hemophilia B mice never score less than 2 at two weeks following this bleeding challenge) and similar partial protection from the development of iron deposition, inflammatory cell infiltrate and neoangiogenesis. (Supplemental Table 1) Because the dose of 1.5 mg/kg demonstrated clear efficacy but not complete protection, it was determined that comparing doses of 250 Units/kg of N9-GP and rfix in the subsequent studies likely would yield an informative range of therapeutic responses. We have previously demonstrated that plasma collected from FIX -/- mice that have received a dose of 250 units/kg of

4 unmodified recombinant FIX (Benefix) demonstrates the same clotting time in seconds in a onestage aptt assay as does the plasma of hemostatically normal wild type mice. Supplemental Methods and Results: Pharmacokinetic comparison of FIX measured in plasma and in synovial fluid We and others have previously shown that circulating FIX partitions into the synovial fluid and that intra-articular FIX can help maintain joint health of hemophilic mice following hemarthrosis 8,52,53. It was unknown whether N9-GP similarly could enter the joint space. To explore this we gave hemophilia B mice a dose of 250 IU/kg of either rfix or N9-GP by tail vein injection. Two hours later citrated plasma was collected followed immediately by euthanasia, harvest of the left knee joint, and lavage of the knee joint to collect synovial fluid lavage, as previously described 8. The lavage results in an estimated ten-fold dilution of the synovial fluid. Human FIX antigen concentration in plasma and in synovial fluid was measured using a sandwich ELISA as previously described 8. Consistent with previous pharmacokinetic evaluations in mice and humans 22,54, the mean incremental recovery in plasma of the N9-GP was higher than the unmodified rfix. The relative recovery in the synovial fluid was very similar for N9-GP when compared to unmodified rfix. The results suggest that the monopegylation of FIX does not alter the accessibility of the protein to the intraarticular space. (Table 2)

5 Supplemental Table 1: Pilot N9-GP dose-finding study Dose (mg/kg) N Synovitis Score N with Synovitis Score 2 (%)* N with Synovitis Score < 2 Iron CD68 Blood Vessels Normal Saline ±0.6 8/8 (100%) 0/8 2.6 ± ± ±5.3 N9-GP: 0.4mg/kg (76 IU/kg) N9-GP: 0.75mg/kg (143 IU/kg) N9-GP: 1.5mg/kg (285 IU/kg) N9-GP: 2.5mg/kg (470 IU/kg) ±1.3 5/5 (100%) 0/5 2.2 ± ± ± ±0.7 5/5 (100%) 0/5 1.6 ± ± ± ±1.0 3/5 (60%) 2/5 0.2 ± ± ± ±0.8 1/5 (20%) 4/5 0.4 ± ± ±4.7 rfix ±1.1 8/8 (100%) 0/8 1.8 ± ± ±6.3 (200 IU/kg) * Evaluated using the Valentino mouse synovitis pathology scale, untreated FIX-/- mice never demonstrate less than 2/10 synovitis at two weeks after a single joint capsule puncture, whereas hemostatically normal mice do not score more than 2/10.

6 Supplemental Table 2: Trabecular bone measurements vbmd [mgha] (% diff from WT) ConnDens [per mm 3 ] (% diff from WT) Tb.Sp [mm] (% diff from WT) Tb.N [mm] (% diff from WT) NS ±8.5 (-63.5%) 93.2 ±10.7 (-43.0%) 0.25 ±0.02 (-28.0%) 3.95 ±0.21 (-30.5%) N9-GP D ±13.2 (2.0%) ±20.1 (5.7%) 0.19 ±0.01 (3.3%) 5.07 ±0.29 (-1.6%) rfix D ±11.6 (-31.1%) ±32.7 (-21.0%) 0.25 ±0.03 (26.0%) 4.26 ±0.52 (-20.8%) rfix D0,1, ±18.5 (-40.8%) ±28.8 (7.3%) 0.21 ±0.01 (7.5%) 4.86 ±0.30 (-2.2%) rfix D ±9.4 (-4.5%) ±13.4 (24.1%) 0.18 ±0.01 (-4.5%) 5.42 ±0.12 (4.9%) WT ± ± ± ±0.20 Measurements are the mean ±SEM of each group, followed by the percent difference compared to WT control. Percent differences less than 5% are in bold.

7 Supplemental Table 3. Significant comparisons of Supplemental Figure 4. Table of Significance Synovitis Score Iron Score Macrophage Score Vessel Count / HPF NS vs N9-GP D0 #### #### #### # N9-GP D0, D7 #### #### ### # rfix D0 ## ## ## rfix D0, D7 ## ### ### rfix D 0, 1, 3 #### #### #### rfix D 0-13 #### #### #### # WT #### #### #### ### N9-GP D0 vs N9-GP D0, D7 rfix D0 * ** rfix D0, D7 ** ** rfix D 0, 1, 3 rfix D 0-13 WT N9-GP D0, D7 vs rfix D0 *** rfix D0, D7 ** *** rfix D 0, 1, 3 rfix D 0-13 WT rfix D0 vs rfix D0, D7 rfix D 0, 1, 3 ** rfix D 0-13 ** * WT ** *** ** rfix D0, D7 vs rfix D 0, 1, 3 rfix D 0-13 ** WT ** *** ** ** rfix D0, 1, 3 vs rfix D 0-13 WT rfix D0-13 vs WT *

8 Points that are significantly different from NS are indicated by #. Markers of significance are utilized as follows * P < 0.05, ** P < 0.01, *** P < 0.001; # P < 0.05, ## P < 0.01, ### P < 0.001, #### P <

9 Supplemental Figure 1: Joint wound healing: Global hemarthropathy score For the time-course study in hemostatically normal mice (WT + NS, ), normal mice challenged with intra-articular injection of autologous blood (WT + Blood, ) and hemophilia B mice (FIX -/-, ) joint cartilage pathology from Safranin-O stained sections was graded using the modified Mankin s score 49,50. The sum of the average Valentino synovitis score and modified Mankin s scores was calculated as the Global Score to represent the spectrum of bleeding-induced joint pathology, as previously described by Narkbunnam et al 9. The dynamic changes in the Global Score in WT and FIX -/- mice are shown to demonstrate that during the 8 week time course, the contribution to the Global Score of gross cartilage degenerative changes are minimal, as compared to the contribution of the synovitis component (Valentino synovitis grade, as shown in Figure 1A in the Text). Points that are significantly different from WT + Blood are indicated by *. Points that are significantly different from WT + NS are indicated by #. Markers of significance are utilized as follows ** P < 0.01, *** P < 0.001, **** P < ; # P < 0.05, ### P < 0.001, #### P < Supplemental Figure 2. Grading of individual components of the Valentino synovitis scale Figure 2A-C. The relative contribution of individual components of the Valentino scoring system to the overall pathology score are shown for the injured FIX -/- mice, for the injured WT mice (only NS instilled in the joint) and for the WT mice that received autologous citrated whole blood injected into the joint at the time of needle puncture (WT + Blood). Some WT mice having normal hemostatic potential did demonstrate modest neovascular and proliferative changes in the first week in response to the joint wound. The same changes were more marked and

10 persisted through the 2 nd to 8 th weeks in FIX -/- mice, accompanied with findings related to unresolved blood and heme iron contamination of the joint. Figures 2D-G. Synovial hyperplasia, neo-angiogenesis, blood present, and disocoloration were replotted for statistical comparison between hemostatically normal mice (WT + NS, ), normal mice challenged with intra-articular injection of autologous blood (WT + Blood, ) and hemophilia B mice (FIX -/-, ). Points that are significantly different from WT + Blood are indicated by *. Points that are significantly different from WT + NS are indicated by #. Markers of significance are utilized as follows * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < ; # P < 0.05, ## P < 0.01, ### P < 0.001, #### P < Supplemental Figure 3: N9-GP dose-finding pilot study: Synovitis scale Hemostatically normal mice (WT) were treated with normal saline and FIX -/- mice were treated intravenously with nonacog beta pegol (N9-GP) or recombinant FIX (rfix) or NS at the doses shown 20 minutes following induced hemarthrosis. Two weeks later, histopathology within the injured joint was scored using the Valentino synovitis pathology score. The dashed line indicates the historical threshold value of 2, because hemostatically normal mice challenged with this injury do not develop synovitis > 2 using this grading system. Points that are significantly different from NS are indicated by #. Markers of significance are utilized as follows * P < 0.05, ** P < 0.01; # P < 0.05, ## P < 0.01, ### P < 0.001, #### P <

11 Supplemental Figure 4: Joint wound healing comparing once or twice weekly dosing with factor IX Unilateral hemarthrosis was induced in all treatment groups, followed twenty minutes later by tail vein infusion of first treatment or placebo (NS) at twenty minutes after wounding. Some treatment groups received repeated doses of rfix at later time points as indicated, including groups of mice treated with FIX at the end of the first week of wound healing to provide some hemostatic potential during the second week of joint wound healing. The conclusion that is evident from this data, when compared to the data included in the main text, is that doses given at day 7 do not improve the joint healing outcomes achieved by either FIX product. The critical period for support appears to include days 0-6. Treatment groups (6-8 mice/group) consisted of FIX -/- mice treated with a single dose of NS on day 0 (NS, ); FIX -/- mice treated with a single dose of N9-GP on day 0 (N9-GP d0, ); FIX -/- mice treated with a single dose of N9-GP on day 0 and day 7 (N9-GP d0,d7, ); FIX -/- mice treated with a single dose of rfix on day 0 (rfix d0, ); FIX -/- mice treated with rfix on day 0 and on day 7 (rfix d0,d7, Δ); FIX -/- mice treated with rfix on day 0, 1 and 3 (rfix d0,1,3, ); FIX -/- mice treated with rfix on day 0, 1,3,5,7,9,11,13 (rfix d0-13, ); and WT mice treated with NS on day 0 (WT, ). All parameters were graded from joint histology prepared from samples collected at two weeks following hemarthrosis. Due to the great number of statistically significant comparisons, all have been moved to Supplemental Table 3. Supplemental Figure 4A. Synovitis grade The Valentino mouse synovitis pathology grade was generated by examination of hematoxylin and eosin stained joint histology. Supplemental Figure 4B. Iron

12 The intensity of Prussian blue staining ferric iron was graded in the heaviest areas of synovial and subsynovial staining from joint samples. Supplemental Figure 4C. Macrophage Infiltration Macrophage infiltration was identified by immunostaining for CD68 graded in the most heavily infiltrated portion of joint synovial samples. Supplemental Figure 4D. Neoangiogenesis Endothelial cells were identified by staining for VWF and counted in the staining areas of the synovium and sub-synovium.

13

14

15

16

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right

More information

Nanomechanical Symptoms in Cartilage Precede Histological Osteoarthritis Signs after the Destabilization of Medial Meniscus in Mice

Nanomechanical Symptoms in Cartilage Precede Histological Osteoarthritis Signs after the Destabilization of Medial Meniscus in Mice Nanomechanical Symptoms in Cartilage Precede Histological Osteoarthritis Signs after the Destabilization of Medial Meniscus in Mice Basak Doyran 1, Wei Tong 2, Qing Li 1, Haoruo Jia 2, Xianrong Zhang 3,

More information

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression

More information

Supplemental Material

Supplemental Material Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Effects of biological response modifiers in psoriasis and psoriatic arthritis Goedkoop, A.Y.

Effects of biological response modifiers in psoriasis and psoriatic arthritis Goedkoop, A.Y. UvA-DARE (Digital Academic Repository) Effects of biological response modifiers in psoriasis and psoriatic arthritis Goedkoop, A.Y. Link to publication Citation for published version (APA): Goedkoop, A.

More information

USA Product Label LEGEND / LEGEND MULTI DOSE. (hyaluronate sodium) Injectable Solution LEGEND MULTI DOSE. (hyaluronate sodium) Injectable Solution

USA Product Label LEGEND / LEGEND MULTI DOSE. (hyaluronate sodium) Injectable Solution LEGEND MULTI DOSE. (hyaluronate sodium) Injectable Solution USA Product Label http://www.vetdepot.com BAYER HEALTHCARE LLC Animal Health Division P.O. BOX 390, SHAWNEE MISSION, KS, 66201-0390 Customer Service Tel.: 800-633-3796 Customer Service Fax: 800-344-4219

More information

Prophylaxis & Arthropathy

Prophylaxis & Arthropathy Prophylaxis & Arthropathy On-Demand and Prophylaxis Treatment Coagulation factor replacement may be given when a bleed occurs (on-demand therapy) or before bleeding occurs, to prevent bleeds (prophylactic

More information

DUROLANE: The Science of the Single Injection

DUROLANE: The Science of the Single Injection : The Science of the Single Injection is a stabilised, hyaluronic acid (HA)-based, viscoelastic gel for the intra-articular treatment of mild to moderate osteoarthritis of the knee and hip. is different

More information

Haemophilia. Management of Haemophiliac Arthropathy Orthopaedic Point of View. Epidemiology of Haemophilic joint disease

Haemophilia. Management of Haemophiliac Arthropathy Orthopaedic Point of View. Epidemiology of Haemophilic joint disease Haemophilia Management of Haemophiliac Arthropathy Orthopaedic Point of View Dr. Alexander Chan Department of Orthopaedics & Traumatology Prince of Wales Hospital Deficiency of clotting factor VIII, and

More information

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast

More information

Why the dog? Analogy of the anatomy

Why the dog? Analogy of the anatomy Why the dog? Analogy of the anatomy Surgically Induced canine OA models: Anterior (cranial) cruciate ligament transection model Pond MJ, Nuki G. Ann Rheum Dis 1973 (and > 100 others) Meniscal disruption

More information

Types of osteoarthritis

Types of osteoarthritis ARTHRITIS Osteoarthritis is a degenerative joint disease is the most common joint disorder. It is a frequent part of aging and is an important cause of physical disability in persons older than 65 years

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

PRODUCT MONOGRAPH INCLUDING PATIENT MEDICATION INFORMATION REBINYN. Coagulation Factor IX (Recombinant), Pegylated. nonacog beta pegol

PRODUCT MONOGRAPH INCLUDING PATIENT MEDICATION INFORMATION REBINYN. Coagulation Factor IX (Recombinant), Pegylated. nonacog beta pegol PRODUCT MONOGRAPH INCLUDING PATIENT MEDICATION INFORMATION REBINYN Coagulation Factor IX (Recombinant), Pegylated nonacog beta pegol Lyophilized Powder 500, 1000 and 2000 IU/vial Blood Coagulation Factor

More information

Effect of blood on the activity and persistence of antigen induced inflammation in the rat air pouch

Effect of blood on the activity and persistence of antigen induced inflammation in the rat air pouch Annals of the Rheumatic Diseases, 1985, 44, 485-490 Effect of blood on the activity and persistence of antigen induced inflammation in the rat air pouch S YOSHINO, D R BLAKE, S HEWITT, C MORRIS, AND P

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration

More information

SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies

SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,

More information

Supplementary Data. Supplementary Methods:

Supplementary Data. Supplementary Methods: Supplementary Data Supplementary Methods: Release kinetics of from collagen sponges in vivo. 2μg of human recombinant 165 was labeled with lexafluor 555 (Microscale Protein Labeling Kit; Invitrogen) as

More information

PRP Usage in Today's Implantology

PRP Usage in Today's Implantology Volume 1, December 2004 www.implant.co.il PRP Usage in Today's Implantology by Dr. R. Shapira Introduction: Treating patients suffering from hematological disorders or using anticoagulant medications always

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

This presentation, entitled Current Practices and Treatment Recommendations for the Management of Hemophilia, will provide information from the

This presentation, entitled Current Practices and Treatment Recommendations for the Management of Hemophilia, will provide information from the Welcome to the continuing education activity entitled Challenges and Opportunities for Managing Hemophilia. We are pleased to provide you with what we hope will be an informative and meaningful program.

More information

Mass Histology Service

Mass Histology Service Mass Histology Service A complete anatomical pathology laboratory www.masshistology.com Telephone: (877) 286-6004 Report on Pathology A Time Course Study of the Local Effects of Intramuscular XXXXXXX Injection

More information

Histopathology: healing

Histopathology: healing Histopathology: healing These presentations are to help you identify, and to test yourself on identifying, basic histopathological features. They do not contain the additional factual information that

More information

Cannabinoids as Treatment for Hemophilic Arthropathy: Hypothesized Molecular Pathways

Cannabinoids as Treatment for Hemophilic Arthropathy: Hypothesized Molecular Pathways Journal of Reports Treatment in Pharmaceutical of Hemarthropathy Sciences using Cannabinoids 2016, 5(2), 89-93 Cannabinoids as Treatment for Hemophilic Arthropathy: Hypothesized Molecular Pathways Amir

More information

Study design: Multicenter, randomized, controlled, cross-over, blinded PK comparison

Study design: Multicenter, randomized, controlled, cross-over, blinded PK comparison Brand Name 1, 2 : Rixubis Generic Name 1, 2 : Coagulation factor IX recombinant Manufacturer 5 : Baxter Drug Class 1, 2, 3 : Antihemophilic agent Labeled Uses 1, 2 : Hemophilia B hemorrhage, routine prophylaxis,

More information

Hemofílie. MUDr.Ivan Vonke, MBA OKH, Nemocnice České Budějovice, a.s.

Hemofílie. MUDr.Ivan Vonke, MBA OKH, Nemocnice České Budějovice, a.s. Hemofílie e MUDr.Ivan Vonke, MBA OKH, Nemocnice České Budějovice, a.s. Hemophilia Incidence: Hemopilia A (deficiency of factor VIII): 1-2 of 10 000 male newborns in all ethnic groups Hemophilia B (deficiency

More information

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin

More information

Hypoxia-Inducible Factor-2a Is an Essential Catabolic Regulator of Inflammatory Rheumatoid Arthritis

Hypoxia-Inducible Factor-2a Is an Essential Catabolic Regulator of Inflammatory Rheumatoid Arthritis Hypoxia-Inducible Factor-2a Is an Essential Catabolic Regulator of Inflammatory Rheumatoid Arthritis Je-Hwang Ryu 1,2., Chang-Suk Chae 1., Ji-Sun Kwak 1, Hwanhee Oh 1, Youngnim Shin 1, Yun Hyun Huh 1,

More information

Afstyla. (antihemophilic factor [recombinant] single chain) New Product Slideshow

Afstyla. (antihemophilic factor [recombinant] single chain) New Product Slideshow Afstyla (antihemophilic factor [recombinant] single chain) New Product Slideshow Introduction Brand name: Afstyla Generic name: Antihemophilic Factor (recombinant), single chain Pharmacological class:

More information

LOX-1-deficient mice are resistant to zymosan-induced arthritis: A mini review

LOX-1-deficient mice are resistant to zymosan-induced arthritis: A mini review Hashimoto K, Oda Y, Yamagishi K, Tsukamoto I, Akagi M. J Immunological Sci. Mini Review Open Access LOX-1-deficient mice are resistant to zymosan-induced arthritis: A mini review Kazuhiko Hashimoto 1 *,

More information

Inflammation is Not the Enemy

Inflammation is Not the Enemy 6/22/2017 Inflammation is Not the Enemy Sean Mulvaney, MD 1 6/22/2017 2 6/22/2017 Lascaux 7.4 Billion 3 This image cannot currently be displayed. 6/22/2017 Goals 4 ANTI INFLAMMATORY THERAPIES NSAIDS 5

More information

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both

More information

State of the Science

State of the Science State of the Science Regenerative treatments for osteoarthritis Alfred C. Gellhorn Associate Professor, Rehabilitation Medicine 1 Main Presentation Title Edit In Slide Master Outline Steroids - what s

More information

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul

More information

Ricardo E. Colberg, MD, RMSK. PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute

Ricardo E. Colberg, MD, RMSK. PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute Ricardo E. Colberg, MD, RMSK PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute Pathophysiology of chronic orthopedic injuries Definition of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Inflammation in OA. Osteoarthritis. Crystals found in synovial fluid. Calcium-containing crystals in OA 10/28/2013. I have no disclosures

Inflammation in OA. Osteoarthritis. Crystals found in synovial fluid. Calcium-containing crystals in OA 10/28/2013. I have no disclosures Dublin Academic Medical Centre Dublin Academic Medical Centre How Do Calcium Crystals Induce Inflammation and Contribute to Osteoarthritis I have no disclosures Geraldine McCarthy MD, FRCPI Clinical Professor

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

POST-INJURY INTERVALS 1

POST-INJURY INTERVALS 1 POST-INJURY INTERVALS 1 Introduction 1 Contusion dating 2 Skin 2 Brain 5 Hypoxic/ischemic injury and increased intracranial pressure 18 Brain incidentals (non-injurious) 21 Sexual violence 27 INTRODUCTION

More information

Coagulopathy Case - 3. Andy Nguyen, M.D. 2009

Coagulopathy Case - 3. Andy Nguyen, M.D. 2009 Coagulopathy Case - 3 Andy Nguyen, M.D. 2009 CLINICAL HISTORY A 21 year-old male seen in the emergency room with a swollen, tender right knee. Patient is an electrician who had fallen to the ground an

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies

NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Bleeding Disorders. Dr. Mazen Fawzi Done by Saja M. Al-Neaumy Noor A Mohammad Noor A Joseph Joseph

Bleeding Disorders. Dr. Mazen Fawzi Done by Saja M. Al-Neaumy Noor A Mohammad Noor A Joseph Joseph Bleeding Disorders Dr. Mazen Fawzi Done by Saja M. Al-Neaumy Noor A Mohammad Noor A Joseph Joseph Normal hemostasis The normal hemostatic response involves interactions among: The blood vessel wall (endothelium)

More information

An Owner's Guide to Natural Healing. Autologous Conditioned Plasma (ACP)

An Owner's Guide to Natural Healing. Autologous Conditioned Plasma (ACP) An Owner's Guide to Natural Healing Autologous Conditioned Plasma (ACP) Healing after an injury involves a well-orchestrated and complex series of events where proteins in the blood have primary roles,

More information

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50

More information

Distribution of type IV collagen, laminin, nidogen and fibronectin in the haemodynamically stressed vascular wall

Distribution of type IV collagen, laminin, nidogen and fibronectin in the haemodynamically stressed vascular wall Histol Histopath (1 990) 5: 161-1 67 Histology and Histopathology Distribution of type IV collagen, laminin, nidogen and fibronectin in the haemodynamically stressed vascular wall Reinhold Kittelberger,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Figuring out the "fronds"-synovial proliferative disorders of the knee.

Figuring out the fronds-synovial proliferative disorders of the knee. Figuring out the "fronds"-synovial proliferative disorders of the knee. Poster No.: C-1209 Congress: ECR 2014 Type: Educational Exhibit Authors: S. Sivasubramanian; Tamil Nadu/IN Keywords: Imaging sequences,

More information

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE Final Report Aug 17 2009 Darryl D'Lima, MD, PhD Shiley Center for Orthopaedic Research and Education at Scripps Clinic La Jolla, California

More information

Hemophilia: diagnostics and treatment

Hemophilia: diagnostics and treatment Hemophilia: diagnostics and treatment Eveline Mauser-Bunschoten Van Creveldkliniek department of benign hematology thrombosis and hemostasis What is hemophilia? Hemophilia A: deficiency of factor VIII

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

Introduction to coagulation and laboratory tests

Introduction to coagulation and laboratory tests Introduction to coagulation and laboratory tests Marc Jacquemin Special Haemostasis Laboratory Center for Molecular and Vascular Biology University of Leuven Coagulation in a blood vessel: fibrin stabilises

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Disease-Modifying Activity in a Model of Rheumatoid Arthritis with an Orally Available Inhibitor of Methionine Aminopeptidase Type-2,

Disease-Modifying Activity in a Model of Rheumatoid Arthritis with an Orally Available Inhibitor of Methionine Aminopeptidase Type-2, Disease-Modifying Activity in a Model of Rheumatoid Arthritis with an rally Available Inhibitor of Methionine Aminopeptidase Type-2, PPI-2458 William Westlin, Ph.D. Praecis Pharmaceuticals Waltham, Massachusetts

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Prothrombin Complex Concentrate- Octaplex. Octaplex

Prothrombin Complex Concentrate- Octaplex. Octaplex Prothrombin Complex Concentrate- Concentrated Factors Prothrombin Complex Concentrate (PCC) 3- factor (factor II, IX, X) 4-factor (factors II, VII, IX, X) Activated 4-factor (factors II, VIIa, IX, X) Coagulation

More information

Intra-articular soft tissue masses of the knee: An imaging review of biopsy proven diagnoses

Intra-articular soft tissue masses of the knee: An imaging review of biopsy proven diagnoses Intra-articular soft tissue masses of the knee: An imaging review of biopsy proven diagnoses Poster No.: P-0114 Congress: ESSR 2014 Type: Scientific Poster Authors: A. Kirwadi 1, S. Raniga 2, R. Hargunani

More information

NACC Vascular Consortium. NACC Vascular Consortium. NACC Vascular Consortium

NACC Vascular Consortium. NACC Vascular Consortium. NACC Vascular Consortium NACC Vascular Consortium NACC Vascular Consortium Participating centers: Oregon Health and Science University ADC Rush University ADC Mount Sinai School of Medicine ADC Boston University ADC In consultation

More information

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging

More information

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek

More information

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory

More information

Injection of vascular endothelial growth factor into knee joints induces osteoarthritis in mice

Injection of vascular endothelial growth factor into knee joints induces osteoarthritis in mice Osteoarthritis and Cartilage 21 (2013) 491e497 Injection of vascular endothelial growth factor into knee joints induces osteoarthritis in mice A. Ludin yz a, J.J. Sela x *, A. Schroeder k, Y. Samuni z,

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation

More information

Equine Regenerative Medicine. Regenerative Medicine IRAP and PRP in the Equine Athlete. Stem Cells. Stem Cells. Veterinary Medical Devices

Equine Regenerative Medicine. Regenerative Medicine IRAP and PRP in the Equine Athlete. Stem Cells. Stem Cells. Veterinary Medical Devices Equine Regenerative Medicine Regenerative Medicine IRAP and PRP in the Equine Athlete Victoria Maxwell, DVM, MBA 2018 Potomac Regional Veterinary Conference Hyatt Regency Inner Harbor Baltimore, Maryland

More information

EXPERIMENTAL THERMAL BURNS I. A study of the immediate and delayed histopathological changes of the skin.

EXPERIMENTAL THERMAL BURNS I. A study of the immediate and delayed histopathological changes of the skin. EXPERIMENTAL THERMAL BURNS I A study of the immediate and delayed histopathological changes of the skin. RJ Brennan, M.D. and B. Rovatti M.D. The purpose of this study was to determine the progressive

More information

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry

More information

III. Results and Discussion

III. Results and Discussion III. Results and Discussion 1. Histological findings in the coronary artery Twenty-four swine had surgical treatments performed in two of the coronary arteries, LAD as well as either the LCX or RCA. A

More information

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.

More information

Approach to bleeding disorders &treatment. by RAJESH.N General medicine post graduate

Approach to bleeding disorders &treatment. by RAJESH.N General medicine post graduate Approach to bleeding disorders &treatment by RAJESH.N General medicine post graduate 2 Approach to a patient of bleeding diathesis 1. Clinical evaluation: History, Clinical features 2. Laboratory approach:

More information

RENAL HISTOPATHOLOGY

RENAL HISTOPATHOLOGY RENAL HISTOPATHOLOGY Peter McCue, M.D. Department of Pathology, Anatomy & Cell Biology Sidney Kimmel Medical College There are no conflicts of interest. 1 Goals and Objectives! Goals Provide introduction

More information

Chapter 4 describes the results of systematic literature review of the diagnostic validity

Chapter 4 describes the results of systematic literature review of the diagnostic validity Summary The main aim of this thesis was to contribute to the diagnostics of SI joint pain. We performed anatomical and clinical research next to a systematic literature review regarding diagnostic criteria

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat

Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat Supplementary Tables Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat condition, skin condition, weight, posture, mobility, and vitality are individually scored and summed to achieve

More information

CHONDROTOXICITY OF LOCAL ANESTHETIC

CHONDROTOXICITY OF LOCAL ANESTHETIC CHONDROTOXICITY OF LOCAL ANESTHETIC Sport Med 2017 Jas Chahal MD FRCSC MSc MBA University of Toronto NO DISCLOSURES Objectives To understand the clinical presentation and pathogenesis of chondrolysis Differentiate

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Myofibroblast Inhibition to Prevent Posttraumatic Joint Contracture. Pittsburgh, PA 15213

Myofibroblast Inhibition to Prevent Posttraumatic Joint Contracture. Pittsburgh, PA 15213 AWARD NUMBER: W81XWH-13-1-0300 TITLE: Myofibroblast Inhibition to Prevent Posttraumatic Joint Contracture PRINCIPAL INVESTIGATOR: Sandeep Kathju, MD, PhD CONTRACTING ORGANIZATION: University of Pittsburgh

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

Report on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques

Report on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques Report on Pathology Study: The effect of Compound X on pancreatic islets in rhesus macaques Prepared for: Client Name Client Address January 1, 2013 Prepared by: Charter Preclinical Services 21 Main St.,

More information

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection Victoria L. Smith, Yong Cheng, Barry R. Bryant and Jeffrey S. Schorey Supplementary Figure 1: Unprocessed

More information

Please see accompanying Full Prescribing Information.

Please see accompanying Full Prescribing Information. To Help Restore Joint Function Adequan i.m. is recommended for the intramuscular treatment of non-infectious degenerative and/or traumatic joint dysfunction and associated lameness of the carpal and hock

More information

Protoporphyrin IX distribution after intra-articular and systemic application of 5-aminolevulinic acid in healthy and arthritic joints

Protoporphyrin IX distribution after intra-articular and systemic application of 5-aminolevulinic acid in healthy and arthritic joints Protoporphyrin IX distribution after intra-articular and systemic application of 5-aminolevulinic acid in healthy and arthritic joints Gereon Hiittmann', Christian Hendrich2, Reginald Birngruber', Christiane

More information

PRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer

PRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer PRP Basic Science Peter J. Moley, MD Hospital for Special Surgery October 5, 2011 Questions that this talk aims to answer 1. What is PRP? 2. What blood components are NOT in PRP? 3. What are the active

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

A 24 year old male patient presented with a swelling on the dorsal aspect of left foot since 3 years. He was operated thrice before, outside, for

A 24 year old male patient presented with a swelling on the dorsal aspect of left foot since 3 years. He was operated thrice before, outside, for A 24 year old male patient presented with a swelling on the dorsal aspect of left foot since 3 years. He was operated thrice before, outside, for same. Came to us with recurrence since last one year with

More information

Omega-3 Fatty Acids Mitigate Obesity-induced Osteoarthritis And Accelerate Wound Repair

Omega-3 Fatty Acids Mitigate Obesity-induced Osteoarthritis And Accelerate Wound Repair Omega-3 Fatty Acids Mitigate Obesity-induced Osteoarthritis And Accelerate Wound Repair Chia-Lung Wu, MS, Deeptee Jain, MD, Jenna McNeill, BS, Dianne Little, BVSc, PhD, John Anderson, MD, Janet Huebner,

More information

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment Small Molecule Inhibitor of the Wnt Pathway (SM755) as a Potential Topical Scleroderma Treatment Vishal Deshmukh, PhD, Allison Hood, Yusuf Yazici, MD Disclosures Vishal Deshmukh, Ph.D. o Financial disclosure:

More information