a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
|
|
- Marshall Davis
- 5 years ago
- Views:
Transcription
1 a 10 4 WT 10 4 TRPV2KO anti-gr anti-gr anti-f4/ anti-f4/ anti-cd11b anti-cd11b anti-f4/ anti-f4/80 WT Phalloidin KO Phalloidin b c Cells per mouse ( 10 5 ) Macro Mono WT KO PMN Lymph Link et al. Supplementary Figure 1
2 1 0.8 Control Accutase Index (arbitrary units) P = P = 4 x P = 0.01 P = WT KO KO + KCl Phagocytosis WT KO KO + KCl Binding Link et al. Supplementary Fig. 2
3 a b WT KO KO+ KCl 0.6 Binding Index WT KO KO+KCl Link et al. Supplementary Figure 3
4 U73122 Piceatannol Bright field α-trpv2 Untreated Link et al. Supplementary Fig. 4 PKC ζ pseudo-substrate Calphostin C Akt inhibitor X Wortmannin PP2
5 Isotype control WT TRPV2 KO Normalized prevalence anti-cd16/32 anti-cd64 anti-cd11b anti-cd18 Link et al. Supplementary Figure 5
6 a untreated IC b untreated KCl + no drug KCl + wortmannin WT KCl + adenosine KCl + 3m3FBS KO Link et al. Supplementary Figure 6
7 SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Flow cytometric analysis of peritoneal macrophages. (a) Scatter plots from flow cytometric examination of resident peritoneal cells from a representative wild-type and TRPV2KO mouse pair. Percent macrophages are indicated in gated regions. b. Quantification of cell types in peritoneal lavage samples from each genotype. Mean ± SEM; wild-type, n = 10; TRPV2KO, n = 9. Macrophages were defined as F4/80 and CD11b high/gr1, CD3, and B220 negative. Lymphocytes were defined as CD3 or B220 positive. Neutrophils were defined as Gr1 high/ CD11b medium. c. Actin staining of wild-type and TRPV2KO peritoneal macrophages with rhodaminephalloidin. Scale bar, 20 µm. Supplementary Figure 2: Discrimination between internalized versus noninternalized particles during phagocytosis and binding. Following phagocytosis (5 min) or binding (5 min) in the presence of 10 µm cytochalasin D of IgG-coated latex beads, binding or phagocytosis index was quantified in wild-type, TRPV2KO, or KCl-treated TRPV2KO macrophages before (black bars) and after (open bars) incubation with Accutase (100%, Sigma, 15 min, 37 C) to remove noninternalized particles. Mean ± SEM, n = 3 wells per condition per genotype. Note that Accutase treatment removes nearly all particles incubated under binding conditions, but spares most particles incubated under phagocytosis conditions in wild-type mice or in TRPV2KO cells treated with KCl. There is some reduction in particles associated with TRPV2KO cells even under phagocytosis conditions, suggesting that not all phagosomes had closed.
8 Supplementary Figure 3: Defective phagocytosis in TRPV2 deficient BMM and rescue by KCl. a. Representative photomicrographs of wild-type, TRPV2KO, and KCl-treated TRPV2KO BMMs following 5 min phagocytosis of IgG-coated latex beads (2 µm, left). Wild-type and TRPV2KO photos show cells exposed to beads under control conditions. KO + KCl, TRPV2KO cells were exposed to beads with KCl (50 mm) added to the medium. b. Corresponding phagocytic indices. Mean ± SEM, n = 3 mice per genotype, each assayed in duplicate. P < Supplementary Figure 4: Pharmacological inhibition of TRPV2 phagosomal recruitment. Wild-type macrophages are shown after 5 min phagocytosis of IgG-coated beads (arrowheads), without drugs or in the presence of PLC inhibitor U73122 (10 µm), Syk kinase inhibitor piceatannol (20 µm), PKC ζ pseudosubstrate (40 µm), gernal PKC inhibitor calphostin C (500 nm), Akt inhibitor X (10 µm), PI3 kinase inhibitor wortmannin (100 nm), or Src kinase inhibitor PP2 (1 µm). Top, TRPV2 immunofluorescence. Bottom, brightfield images. Scale bar, 8 µm. Supplementary Figure 5: Phagocyte receptor expression levels are similar between wildtype and TRPV2 deficient macrophages. Representative histograms from flow cytometric data of wild-type macrophages (F4/80 positive, CD11b positive, CD3 negative, B220 negative) in acutely isolated peritoneal lavage. Histograms compare wild-type (blue traces) and TRPV2KO (red traces) macrophages and isotype controls (green traces), with respect to intensity of surface binding by antibodies against Fcγ
9 receptors (anti-cd16/32, anti-cd64) (6) and complement C3 receptor (anti-cd11b, anti- CD18) (7). Supplementary Figure 6: IC-induced actin depolymerization. a. Representative photomicrographs of wild-type and TRPV2KO BMMs, stained with rhodaminephalloidin, which are untreated or following a 2 min stimulation with ICs at 37 C. b. Representative photomicrographs of TRPV2KO BMMs, stained with rhodaminephalloidin, which are untreated, treated with KCl (50 mm), KCl + wortmannin (100 nm, PI(3)K inhibitor), KCl + adenosine (300 µm, PI4 kinase inhibitor), or KCl + 3m3FBS (10 µm, PLC activator). Scale bar, 10 µm.
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Gilberti et al. SUPPLEMENTAL FIGURE LEGENDS: Figure S1: The effect of pharmacological inhibitors on particle uptake. The data presented in Figure 1
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSupplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationNature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
More informationSupplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationJ. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationLPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)
A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationSupplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
More informationSupplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse
Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationSupplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationeffect on the upregulation of these cell surface markers. The mean peak fluorescence intensity
SUPPLEMENTARY FIGURE 1 Supplementary Figure 1 ASIC1 disruption or blockade does not effect in vitro and in vivo antigen-presenting cell activation. (a) Flow cytometric analysis of cell surface molecules
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationIL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
More informationSupplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationSupplementary Figure 1
Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
More informationGeneration of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
More informationSupplementary information
Supplementary information Intrahepatic myeloid cell-aggregates enable local CD8 + T cell expansion and successful immunotherapy against chronic viral liver infection Li- Rung Huang, Dirk Wohlleber, Florian
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationQuantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
More informationSupplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationpro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
More informationSupplementary Information
Supplementary Information Distinct bone marrow-derived and tissue resident macrophage lineages proliferate at key stages during inflammation. 1 Luke C. Davies, 1 Marcela Rosas, 2 Stephen J. Jenkins, 1
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationLoss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
More informationSupporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationa surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationProject report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:
Project report October 2012 March 2013 CRF fellow: Gennaro Napolitano Principal Investigator: Sergio Daniel Catz Project title: Small molecule regulators of vesicular trafficking to enhance lysosomal exocytosis
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationSupporting Information for
Supporting Information for Rupture of Lipid Membranes Induced by Amphiphilic Janus Nanoparticles Kwahun Lee, Liuyang Zhang, Yi Yi, Xianqiao Wang, Yan Yu* Department of Chemistry, Indiana University, Bloomington,
More informationSupplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15
Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell
More informationSupplementary Materials
Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different
More informationTime after injection (hours) ns ns
Platelet life span (% iotinylated platelets) 1 8 6 4 2 4 24 48 72 96 Time after injection (hours) 6 4 2 IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure
More informationFigure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation
Figure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation with a range of concentrations of chemotherapy agents
More informationDC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN. (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were
Supplementary methods Flow cytometric analysis of DCs. DC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were
More information