Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
|
|
|
- Sophia Lewis
- 5 years ago
- Views:
Transcription
1 Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin Friedlander 1 SI Figures and Legend
2 SI.1 Macrophages form a multinucleated network. All images are Z-stacks. (A-B) Immunohistochemistry for F4/80 (green) and CD31 (red) performed on sc matrigel plugs isolated from wild type (C57BL/6J) mice 6 days after matrigel injection. F4/80 + cells form a network of interconnected cells and some express CD31. Blue indicates Hoechst nuclear stain. These are mirror mages of Fig.1 A with the original color channels. (C) Imaris 3D rendering of a portion of Fig.1 G. An F4/80 + tubule (asterisks) extends over 200um. F4/80 (red) Hoechst nuclear stain (blue). All scale bars 20um.
3 SI.2 Macrophage network forms in Matrigel with both VEGF and proinflammatory cytokine supplementation. All images are Z-stacks. (A-E) 2 channel confocal photomicrograph of a Z-stack taken of 3 day plug with VEGF supplementation implanted in CX3CR1 GFP/+ mice. (A) nuclear stain, (B) CX3CR1 GFP/+ and (C) merged channels. A dense CX3CR1 GFP/+ network is formed. (D-E) Close up view of CX3CR1 GFP/+ cells forming cord-like structures. (F-H) Ten day sc plugs supplemented with either GM-CSF (F), Interferon-γ (G), or GM-CSF and Interferon γ (H). A network is formed by F4/80 + (green) macrophages under proinflammatory cytokine stimulation. F4/80 (green), CD31 (red), CD163 (white) and nuclear stain (blue). Scale bars as indicated.
4 SI.3 Monocytes/Macrophages interact with the leading front of an invading blood vessel. (A-C) Further analysis of Figure 2 (J-L). (D-F) Magnified image of boxed area in (A-C). The CX3CR1 GFP/GFP cells form a cuff around CD31 expressing tissue (white arrow). (G-I) depicts another area of interest at the leading front of the CD31 exprssing blood vessel. (J-L) A cluster of CX3CR1 GFP/GFP cells are located at the leading front of the blood vessel; just above the plane of CD31 expressing filopodia. Scale bars as indicated.
5
6 SI.4 CX3CR1 GFP/GFP cells express ADAM17 and MMP9 between 2 hours and 10 days. (A-D) Immunohistochemistry analysis showing ADAM17 positivity on a 10 day subcutaneous matrigel plug isolated from CX3CR1 GFP/GFP mouse. ADAM17 (red) and nuclear stain (blue). Invading CX3CR1 GFP/GFP cells express ADAM17 in the subcutaneous matrigel plug. White box demarcates an area that is magnified in Figure 1B. (E-H) A five day matrigel plug was immunostained for MMP9. Individual channels are shown as indicated. (I, J) IMARIS 3D renderings of E-H but shown as mirror images. MMP9 is expressed by this CX3CR1 GFP/GFP multinucleated tubular structure. (I) The green channel is rendered slightly translucent to allow visualization of the nuclei (blue). (J) Only the green and red channels are shown. (K) IMARIS 3D rendering of a 7 day subcutaneous matrigel plug from a CX3CR1 GFP/GFP mouse. A multinucleated cord/tubular structure composed of CX3CR1 GFP/GFP cells is found within a channel devoid of collagen IV. All images are Z-stacks. SI.5 PCR Angiogenesis array data. Three day subcutaneous matrigel plugs were harvested from C57BL/6J (wildtype) mice, dissociated and cells isolated. Cells were immunostained for F4/80 and subsequently sorted by FACS. RNA was isolated and RT-qPCR was performed using an Angiogenesis Array.
7 SI.6 Electron microscopy of matrigel plug. (A,B) Scanning EM image of matrigel solidified at 37 o C on a plastic surface. (B) This figure is a 10X image of the plug shown in (A) and scale bar is bottom right. Note the absence of channels and cells. (C,D) Scanning EM of subcutaneous matrigel plug harvested from a mouse 5 days after matrigel injection. Note the presence of cells. (E) Transmission EM of cells inside an 11 day sc matrigel plug. Cells are justaposed within a cleared zone of matrigel. (F) Boxed area in (E) shows a markedly dilated rough endoplasmic reticulum (RER). Doubled-headed arrow shows lumen of RER. Scale bars as shown.
8 SI.7 CX3CR1 GFP/GFP cells express multiple macrophage markers. All images are Z-stacks. (A-C) 7 day sc matrigel plug extracted from a CX3CR1 GFP/GFP mouse immunostained against MSR1 (macrophage scavenger receptor 1 - gold). (D-F) Nine day plug with nuclear stain in blue. (D) CX3CR1 GFP/GFP cells, (E) CD11b (red) and (F) merged channels. (G-I) Imaris 3D rendering of an LSM Z-stack from a seven day sc matrigel plug. (G) CX3CRI-GFP, (H) CD206 (mannose receptor red) and (I) merged channels. (J-M) Images generated from frozen sections of a sc matrigel plug harvested from a C57BL/6J wild type mouse. The sections were immunostained with antibodies directed against F4/80 (green), CD31 (red), CD163 (white) and counterstained with Hoechst nuclear stain (blue). Scale bars as indicated.
9 SI 8 Macrophages within the sc plug express Tie2, CD31, CD34, phosphoerk and LYVE1. Images are LSM Z-stacks. Matrigel was sc injected into either CX3CR1 GFP/GFP or C57BL/6J mice and plugs explanted 10 days later. (A-C) Tie2 expression by CX3CR1 GFP/GFP cells. (A) CX3CR1 GFP/GFP (green), (B) Tie2 (gold) and (C) merged channels including nuclear stain (blue). (D-F) CD31 and CD34 are expressed by CX3CR1 GFP/GFP cells. (D) CX3CR1 GFP/GFP, (E) CD31 and (F) CD34. (G-J) PhosphoERK is expressed by CX3CR1 GFP/GFP cells. (G) nuclear stain, (H) CX3CR1 GFP/GFP, (I) phosphoerk and (J) merged channels. (K-M) C57BL/6J 10 day sc plug. (K) CD11b, (L) LYVE1 and (M) merged channels. Scale bars and magnification are shown.
10 SI 9 Tumor rosettes are connected to macrophage conduits and are perfused. Images are LSM Z-stacks (A-E) A375 human melanoma tumor cells were injected subcutaneously into an athymic mouse. Seven days later, tumors were explanted and immunostained for various markers. (A) Tumor tufts and conduits express CD163 (red) and nuclear stain is in blue. Tufts are identified with yellow arrows. (B-E) The mouse was iv injected with 3 KD rhodamine dextran via tail vein, tumor excised and immunostained. (B) CD131, (C) F4/80, (D) intravenous 3 KD dextran and (E) merged channels,including the nuclear stain. The white arrow shows a tubular structure that immunostains for CD31, F4/80 and transmits systemically injected dye. (F-I) B16/F10 murine melanoma tumor cells were injected sc into a C57BL/6J mouse. Seven days later, tumors were excised and immunostained for (F) CD11b, (G) LYVE1, (H) iv 3 KD rhodamine dextran and (I) merged channels with nuclear stain. White arrow shows a tubular structure that stains for CD11b, LYVE1 and transmits iv injected dye. Scale bars as indicated.
11 SI.10 Both malignant and benign human meningiomas form an interconnected macrophage network. (A-B) and (C-D) are 6 µm serial sections stained independently from the same region of interest. (A-B) A macrophage network seen in (B) is present in malignant meningioma. Hematoxylin stain (blue) and CD163 immunoperoxidase (brown). (C-D) MALIGNANT meningioma tissue stained with the vascular mimicry marker PAS (magenta) and immunostained with either the endothelial marker CD31 (C) or the macrophage marker CD163 (D); both shown in brown. Blood vessels, shown in (C), are sparse, compared to the robust CD163 network in (D). Note colocalization of PAS and CD163. (E-G) IMARIS 3D representation of a Z-stack depicting a macrophage network in human BENIGN meningioma. Tissue was
12 stained with an anti CD163 antibody (gold) and Hoechst, a nuclear stain (blue). (F) Perspective view of boxed area in image (E). Dashed line represents a transverse cut through this CD163 + tubular structure. (G) View down the lumen of the same CD163 tubular structure with nuclei removed. Scale bars as indicated. SI MOVIES Movie 1 Still image shown in Figure 1I. Movie depicts travel within an F4/80 positive (red), Cx3CR1 GFP/GFP vascular mimicry tube within a sc matrigel plug (NO TUMOR). Movie 2 Still image shown in Figure 6. A three day subcutaneous A375 tumor was removed from an Athymic mouse after 3 KD rhodamine Dextran (red) was tail vein injected. Tumor tissue was fixed and immunostained for CD11b (purple). Movie depicts travel within the CD11b tube, followed by the addition of the red channel to show that the dye is within the CD11b tube. Movie 3 Still image is shown in Figure 7. A three day sc A375 tumor was removed from an athymic mouse after tail vein injection of 3KD rhodamine Dextran (red). The tumor tissue was immunostained for CD11b (purple), CD31 (green) and Hoechst nuclear stain (Blue). Movie depicts a confocal Z-stack image composed of the four individual acquired channels. The blue channel is Hoechst, a nuclear stain. The green channel depicts CD31 staining. The red channel shows the tail vein injected dye and finally, the purple channel (far red) depicts CD11b. Note the absence of CD31 staining in some of the perfused CD11b conduits.
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
Ahtiainen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
Supplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
Spheroid-based engineering of a human vasculature in mice
Spheroid-based engineering of a human vasculature in mice Abdullah Alajati, Anna M. Laib, Holger Weber, Anja M. Boos, Arne Bartol, Kristian Ikenberg, Thomas Korff, Hanswalter Zentgraf, Cynthia Obodozie,
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Fibrinogen-induced perivascular microglial clustering is required for the. development of axonal damage in neuroinflammation
SUPPLEMENTARY INFORMATION Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation Dimitrios Davalos, Jae Kyu Ryu, Mario Merlini, Kim
J. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
CD4 and CD8 T cells show a similar accumulation in the tumor stroma.
Fig S1 CD4 Fibronectin EpCM CD8 CD4 and CD8 T cells show a similar accumulation in the tumor stroma. Fluorescently-labeled CD4 (CMFD, green) and CD8 (Hoechst, yellow) T cells were added to a human lung
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Specimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1
A B Specimen Humeral Head 2 1 µm 76 µm Femoral Head Objective Femoral Condyle (medial) Supplementary Figure 1 A Femoral Head Global Cell Density Superficial Cell Density Cell Number at 1 µm Nuclei /.1
Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney
SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis
SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,
Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration
Braun et al. Supplementary Information 1 Supplementary Information Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration Asolina
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted Ctns -/- mice. Cells immunolabeled for the proliferation marker (Ki-67) were counted in sections (n=3 WT, n=4
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Mass Histology Service
Mass Histology Service A complete anatomical pathology laboratory www.masshistology.com Telephone: (877) 286-6004 Report on Pathology A Time Course Study of the Local Effects of Intramuscular XXXXXXX Injection
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supplementary Figure 1. Analysis of LN S1P gradients.
Supplementary Figure 1 Analysis of LN S1P gradients. (a) Diagram showing the spatial distribution of NK cells in WT LN. Inset: Upon infection, sinus-lining macrophages secrete IL-18 and other cytokines,
McWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Cancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
Supplementary Information
Supplementary Information Lymphatic endothelial cells support tumor growth in breast cancer Esak Lee a, Niranjan B. Pandey a, and Aleksander S. Popel a,b a Department of Biomedical Engineering, Johns Hopkins
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL
sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL LTL staining Negative control Fluorescence microscopy of normal (CL-11 +/+ ) mouse renal tissue after staining with
Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment
Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment Soheila Sharghi-Namini 1, Evan Tan 1,2, Lee-Ling Sharon Ong 1, Ruowen Ge 2 * and H. Harry Asada 1,3
Supplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
University of Groningen
University of Groningen Mechanisms of Hemagglutinin Targeted Influenza Virus Neutralization Brandenburg, Boerries; Koudstaal, Wouter; Goudsmit, Jaap; Klaren, Vincent; Tang, Chan; Bujny, Miriam V.; Korse,
Supporting Information
Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Intravital Microscopic Interrogation of Peripheral Taste Sensation
Supplementary Information Intravital Microscopic Interrogation of Peripheral Taste Sensation Myunghwan Choi 1, Woei Ming Lee 1,2, and Seok-Hyun Yun 1 * 1 Harvard Medical School and Wellman Center for Photomedicine,
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Supplementary figure 1. Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology.
Supplementary figure 1 Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology. Supplementary figure 2 Supplementary Figure 2. Evidence for existence
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
Real-time imaging reveals the single steps of brain metastasis fo mation r
Real-time imaging reveals the single steps of brain metastasis fo mation r Yvonne Kienast, Louisa von Baumgarten, Martin Fuhrmann, Wolfgang E.F. Klinkert, Roland Goldbrunner, Jochen Herms and Frank Winkler
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/8/e1700521/dc1 Supplementary Materials for Functional vascularized lung grafts for lung bioengineering N. Valerio Dorrello, Brandon A. Guenthart, John D. O Neill,
Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions
CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is
Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is not co-expressed in DCLK1-positive tuft cells. Scale
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
Supplementary information - Table (1), Figures (12), and Videos (5)
Supplementary information - Table (1), Figures (12), and Videos (5) A soft, transparent, freely accessible cranial window for chronic imaging and electrophysiology Chaejeong Heo 1, Hyejin Park 1, 2, Yong-Tae
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction
Supplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Supplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Drd1a-Cre driven ChR2 expression in the SCN. (a) Low-magnification image of a representative Drd1a-ChR2 coronal brain section (n = 2) showing endogenous tdtomato fluorescence (magenta).
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
Supplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Gilberti et al. SUPPLEMENTAL FIGURE LEGENDS: Figure S1: The effect of pharmacological inhibitors on particle uptake. The data presented in Figure 1
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE.
SUPPLEMENTARY FIGURES, TABLES AND VIDEOS PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE. Clément Ricard 1,2,3,4, Aurélie Tchoghandjian 2,4, Hervé Luche 5, Pierre
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Brooks and Wallingford, http://www.jcb.org/cgi/content/full/jcb.201204072/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Quantification of ciliary compartments in control
Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
!! INL!!!! ONL!! IS/OS!!
SUPPLEMENTARY FIGURES GCL INL ONL IS/OS RPE Choroid GR MR A B C HSD2 Cc RPE CV D Cc RPE CV E RPE Cc CV F RPE Cc CV Figure S1 Figure S1: Immunohistochemistry eidence for glucocorticoid receptor (GR), mineralocorticoid
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description: