Palindromic amplification of the ERBB2 oncogene in human primary breast tumors. A common pattern of copy number transition of chromosome 17 in HER2-

Size: px
Start display at page:

Download "Palindromic amplification of the ERBB2 oncogene in human primary breast tumors. A common pattern of copy number transition of chromosome 17 in HER2-"

Transcription

1 Supplemental Figures Table of Contents Palindromic amplification of the ERBB2 oncogene in human primary breast tumors Michael Marotta 1,5, Taku Onodera 3,5, Jeffrey Johnson 4, Thomas Budd 2, Takaaki Watanabe 1,4, Xiaojiang Cui 4, Armando Giuliano 4, Atsushi Niida 3 and Hisashi Tanaka 1,4 Figure 1 A common pattern of copy number transition of chromosome 17 in HER2- positive breast tumors Figure 2 Figure 3 Figure 4 Figure 5 Procedure of GAPF-seq Local genomic environment of the region surrounding ERBB2 gene Copy number alterations of chromosome 17 in HER2-positive breast cancer Mechanisms for generating a hairpin-capped chromosome 17 (model)

2 Supplementary Figure 1 - Marotta et al, Chr17 (hg19) 17q p12 p11.2 q q12 17q q25.3 ERBB2 A common pattern of copy number transition of chromosome 17 in HER2-positive breast tumors A heat map showing the copy number alterations in 117 HER2-positive breast tumors. Blue indicates genomic regions with copy-number gains and red indicates regions with copy-number loss.

3 Supplementary Figure 2 - Marotta et al, Tumor DNA palindromic DNA Normal DNA de-naturation re-naturation S1 nuclease digestion sequencing Procedure for enriching palindromic DNA from tumor genomic DNA. Palindromic DNA is shown by the pair of a blue and a red arrow that are complementary to each other. After denaturation and quick renaturation, palindromic DNA become double-stranded (dsdna), while non-palindromic DNA remains single-stranded (ssdna). Single-stranded nucleic acid specific nuclease S1 digests ssdna, but not dsdna. Thus the treatment by S1 results in the enrichment of DNA that derives from palindromic DNA.

4 Supplementary Figure 3 - Marotta et al, Scale chr17: Chromosome Band Hg19 Diff Common SNPs(144) Segmental Dups SYNRG DDX52 MIR378J RP11-697E22.2 HNF1B AC Mb hg38 38,000,000 38,500,000 39,000,000 39,500,000 40,000,000 40,500,000 41,000,000 41,500,000 17q12 Chromosome Bands Localized by FISH Mapping Clones 17q q21.2 Contigs New to GRCh38/(hg38), Not Carried Forward from GRCh37/(hg19) U6 TBC1D3K TBC1D3D 5S_rRNA TBC1D3L TBC1D3C TBC1D3D TBC1D3E Y_RNA Y_RNA ARHGAP23 MIR4734 RPL23 PLXDC1 TBC1D3E MRPL45 SRCIN1 PSMB3 FBXO47 ARL5C TBC1D3 SOCS7 C17orf96 U6 RP1-56K13.5 CACNB1 5S_rRNA MRPL45 CTB-58E17.2 CWC25 AC RPL19 GPR179 CISD3 LASP1 SOCS7 CTB-58E17.1 PLXDC1 ARHGAP23 CTB-58E17.3 AC AC MLLT6 RP5-906A24.1 CTB-58E17.9 MIR4726 MIR6779 RP5-906A24.2 AC CTD-2206N4.2 5S_rRNA PCGF2 CTB-58E17.5 PIP4K2B MIR4727 C17orf98 SNORA21 RP1-56K13.2 RP1-56K13.3 LINC00672 STAC2 FBXL20 AC Simple Nucleotide Polymorphisms (dbsnp 144) Found in >= 1% of Samples Duplications of >1000 Bases of Non-RepeatMasked Sequence CTB-131K11.1 NEUROD2 GRB7 MED1 PPP1R1B IKZF3 CDK12 TCAP RNU6-981P STARD3 RNU6-233P PNMT RP11-390P24.1 AC GRB7 PGAP3 MIR4728 MIEN1 ERBB2 GSDMB THRA CDC6 TNS4 KRT222 KRT28 KRT39 KRTAP4-5 KRT33A KRT36 KRT17 JUP CSF3 MIR6867 RARA CCR7 KRT24 KRT12 KRTAP2-1 KRTAP9-3 KRT34 KRT15 EIF1 P3H4 ZPBP2 MED24 WIPF2 IGFBP4 SMARCE1 KRT10 KRT40 KRTAP4-3 KRT33B KRT13 GAST ORMDL3 THRA RARA-AS1 KRT25 KRT23 KRTAP4-6 KRT31 KRT9 HAP1 RP11-387H17.4 NR1D1 CTD-2267D19.1 RP5-1028K7.1 KRT26 KRTAP4-4 AC KRT14 JUP LRRC3C MSL1 CTD-2267D19.3 RP11-458J1.1 KRT27 KRTAP4-2 KRT37 KRT16 GSDMA CASC3 GJD3 AC TMEM99 KRTAP1-5 KRTAP9-2 KRT38 RNA5SP442 PSMD3 RNA5SP441 KRT20 KRTAP1-4 KRTAP9-9 KRT32 HAP1 TOP2A KRTAP2-4 KRTAP9-4 RP11-387H17.6 RN7SL399P AC KRTAP4-1 AC MIR6884 KRTAP3-3 KRTAP9-2 RNU2-32P SNORD124 KRTAP3-2 KRTAP9-1 KRT35 RP11-749I16.3 KRTAP3-1 KRTAP9-8 KRT36 AC RP11-605F20.1 KRTAP1-3 KRTAP9-9 KRT13 RAPGEFL1 RP5-1110E20.1 KRTAP1-1 KRTAP9-6 Y_RNA KRTAP2-1 KRTAP9-7 AC RP11-58O9.2 KRTAP2-2 KRTAP29-1 KRT15 RP5-1028K7.2 KRTAP2-3 KRTAP16-1 MIR6510 KRTAP4-7 KRTAP17-1 KRT19 KRTAP4-8 LINC00974 RP13-415G19.2 KRTAP4-16P KRTAP4-9 KRTAP4-11 KRTAP4-12 FKBP10 NT5C3B KLHL10 RP11-156E6.1 KLHL11 Local genomic environment of the surrounding ERBB2 gene. Coordinates of chromosome 17, chromosome bands, contigs discordant from the previous genome assembly, dbsnps, segmental duplications, and genes are shown (modified from a figure taken from UCSC genome browser). Note that the centromeric side is flanked by the large discordant contigs and a large block of segmental duplications, whereas the telomeric side is flanked by the mumber of KRTAP and KRT gene families. As a result, these regions lack definitive SNP markers.

5 Supplementary Figure 4 - Marotta et al, 5T BT5 11T 40T BT4 ERBB2 Copy number alterations of chromosome 17 in 5 HER2-positive breast tumors. The location of ERBB2 amplicon is shown on the chromatograph. The regions on the 17p that retain copy numbers are indicated by black lines.

6 Supplementary Figure 5 - Marotta et al, fork stalling and reversal resolution resolution hairpin resolution end resection intra-strand annealing telomere centromere inverted repeats Inverted repeats-guided formation of a hairpin-capped chromosome (model). Replication forks stall at the inverted repeat (left). Fork reversal creates a four-way junction, the resolution of which results in a one-ended DSB. Processing of the end and intra-strand annealing lead to the formation of a hairpin-capped chromosome. Alternatively, a cruciform structure formed by the intra-strand annealing is resolved to form a hairpincapped chromosome (right).

Expression screening of 17q12 21 amplicon reveals GRB7 as an ERBB2-dependent oncogene

Expression screening of 17q12 21 amplicon reveals GRB7 as an ERBB2-dependent oncogene FEBS Letters 586 (2012) 1708 1714 journal homepage: www.febsletters.org Expression screening of 17q12 21 amplicon reveals GRB7 as an -dependent oncogene Makoto Saito a, Yukiko Kato a, Emi Ito b, Jiro Fujimoto

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

High Throughput Sequence (HTS) data analysis. Lei Zhou

High Throughput Sequence (HTS) data analysis. Lei Zhou High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic

More information

MODULE 3: TRANSCRIPTION PART II

MODULE 3: TRANSCRIPTION PART II MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

Supplementary Information

Supplementary Information Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho

More information

SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109

SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109 SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109 This P078-B1 Breast Tumour probemix contains probes for several genes (including ERBB2, BIRC5, MYC, TOP2A, ESR1, MTDH, CCND1, CCNE1, EGFR and C11orf30)

More information

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,

More information

computational proteomics

computational proteomics computational proteomics Laboratory for Computational Proteomics www.fenyolab.org E-mail: Info@FenyoLab.org Facebook: NYUMC Computational Proteomics Laboratory Twitter: @CompProteomics pubs.acs.org/jpr

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

MRC-Holland MLPA. Description version 06; 23 December 2016

MRC-Holland MLPA. Description version 06; 23 December 2016 SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

MODULE NO.14: Y-Chromosome Testing

MODULE NO.14: Y-Chromosome Testing SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes

More information

Hepatocyte nuclear factor 1 beta induces transformation and epithelial-to-mesenchymal transition

Hepatocyte nuclear factor 1 beta induces transformation and epithelial-to-mesenchymal transition Hepatocyte nuclear factor 1 beta induces transformation and epithelial-to-mesenchymal transition Atsuka Matsui 1, Jiro Fujimoto 2,3, Kosuke Ishikawa 2,3, Emi Ito 4, Naoki Goshima 5,6, Shinya Watanabe 4

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes.

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. Supplementary Figure 1 Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. (a,b) Values of coefficients associated with genomic features, separately

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Integrated Analysis of Copy Number and Gene Expression

Integrated Analysis of Copy Number and Gene Expression Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose

More information

Plasma-Seq conducted with blood from male individuals without cancer.

Plasma-Seq conducted with blood from male individuals without cancer. Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer

More information

SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B

SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B1-0613. The purpose of the P372 probemix is to further investigate results found with the P245 Microdeletion Syndromes-1A probemix. The

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

MRC-Holland MLPA. Description version 12; 13 January 2017

MRC-Holland MLPA. Description version 12; 13 January 2017 SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Chapter 1 : Genetics 101

Chapter 1 : Genetics 101 Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic

More information

17q12 Family Meeting families from 9 states

17q12 Family Meeting families from 9 states 8/5/04 7q Family Meeting 04 families from 9 states Genetics of the 7q Region Christa Lese Martin, PhD, FACMG August 8, 04 Many developmental issues have a genetic basis (learning, behavior, motor skills)

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Supplementary results

Supplementary results doi:1.138/nature946 Supplementary results Effects of rearrangements on protein coding genes Genomic instability drives cancer development through effects on genes, such as copy number changes, internal

More information

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted. mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised

More information

Repair of Broken Chromosomes and Maintenance of Chromosome Stability

Repair of Broken Chromosomes and Maintenance of Chromosome Stability Repair of Broken Chromosomes and Maintenance of Chromosome Stability Jim Haber Brandeis University Genome instability in tumor cells Truncations Translocations Inversions Duplications Amplifications Deletions

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer

Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within

More information

Prognostic relevance of acquired uniparental disomy in serous ovarian cancer

Prognostic relevance of acquired uniparental disomy in serous ovarian cancer Tuna et al. Molecular Cancer (2015) 14:29 DOI 10.1186/s12943-015-0289-1 RESEARCH Open Access Prognostic relevance of acquired uniparental disomy in serous ovarian cancer Musaffe Tuna 1*, Zhenlin Ju 2,

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Supplementary Figure 1. Spectrum and signatures of substitutions.

Supplementary Figure 1. Spectrum and signatures of substitutions. Supplementary Figure 1. Spectrum and signatures of substitutions. a. Heatmaps of trinucleotide context of substitutions. Each square represents a substitution in a specific trinucleotide context, normalised

More information

SALSA MLPA KIT P060-B2 SMA

SALSA MLPA KIT P060-B2 SMA SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the

More information

Prof. R. V. Skibbens. BIOS 10 and BIOS 90: BioScience in the 21 st Century. Cell Cycle, Cell Division and intro to Cancer.

Prof. R. V. Skibbens. BIOS 10 and BIOS 90: BioScience in the 21 st Century. Cell Cycle, Cell Division and intro to Cancer. Prof. R. V. Skibbens August 31, 2015 BIOS 10 and BIOS 90: BioScience in the 21 st Century Cell Cycle, Cell Division and intro to Cancer Cell Cycle Why a cell cycle? What is the goal? trauma growth development

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent

More information

A n a ly s i s. DNA replication timing 4 and long-range DNA interactions 6. predict mutational landscapes of cancer genomes

A n a ly s i s. DNA replication timing 4 and long-range DNA interactions 6. predict mutational landscapes of cancer genomes DNA replication timing and long-range DNA interactions predict mutational landscapes of cancer genomes Subhajyoti De 1,2 & Franziska Michor 1,2 211 Nature America, Inc. All rights reserved. Somatic copy-number

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Introduction. 8 These authors contributed equally to this work

Introduction. 8 These authors contributed equally to this work ARTICLE Complete Haplotype Sequence of the Human Immunoglobulin Heavy-Chain Variable, Diversity, and Joining Genes and Characterization of Allelic and Copy-Number Variation Corey T. Watson, 1,7 Karyn M.

More information

MRC-Holland MLPA. Description version 29; 31 July 2015

MRC-Holland MLPA. Description version 29; 31 July 2015 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082

More information

The distribution of insertionally polymorphic endogenous retroviruses in breast cancer patients and cancer-free controls

The distribution of insertionally polymorphic endogenous retroviruses in breast cancer patients and cancer-free controls Wildschutte et al. Retrovirology 2014, 11:62 RESEARCH Open Access The distribution of insertionally polymorphic endogenous retroviruses in breast cancer patients and cancer-free controls Julia H Wildschutte

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

FONS Nové sekvenační technologie vklinickédiagnostice?

FONS Nové sekvenační technologie vklinickédiagnostice? FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables

More information

Supplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC

Supplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC Cancer Cell, Volume 33 Supplemental Information lncrna Epigenetic Landscape Analysis Identifies as an Oncogenic lncrna that Interacts with and Promotes Cell-Cycle Progression in Cancer Zehua Wang, Bo Yang,

More information

MRC-Holland MLPA. Description version 19;

MRC-Holland MLPA. Description version 19; SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage?

Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? Questions about cancer What is cancer? Cancer Gil McVean, Department of Statistics, Oxford What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? What are the steps in

More information

Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis

Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol

More information

Metadata of the chapter that will be visualized online

Metadata of the chapter that will be visualized online Metadata of the chapter that will be visualized online ChapterTitle Chapter Sub-Title Advanced Analysis of Human Plasma Circulating DNA Sequences Produced by Parallel Tagged Sequencing on the 454 Platform

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR)

Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) O. Solomon, S. Oren, M. Safran, N. Deshet-Unger, P. Akiva, J. Jacob-Hirsch, K. Cesarkas, R. Kabesa, N. Amariglio, R.

More information

CELL CYCLE REGULATION AND CANCER. Cellular Reproduction II

CELL CYCLE REGULATION AND CANCER. Cellular Reproduction II CELL CYCLE REGULATION AND CANCER Cellular Reproduction II THE CELL CYCLE Interphase G1- gap phase 1- cell grows and develops S- DNA synthesis phase- cell replicates each chromosome G2- gap phase 2- cell

More information

MRC-Holland MLPA. Description version 08; 30 March 2015

MRC-Holland MLPA. Description version 08; 30 March 2015 SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.

More information

MRC-Holland MLPA. Description version 13;

MRC-Holland MLPA. Description version 13; SALSA MLPA probemix P027-C1 Uveal Melanoma Lot C1-0211: A large number of probes have been replaced by other probes in the same chromosomal regions as compared to previous lots, and several reference probes

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.

More information

MRC-Holland MLPA. Description version 18; 09 September 2015

MRC-Holland MLPA. Description version 18; 09 September 2015 SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the

More information

Agilent s Copy Number Variation (CNV) Portfolio

Agilent s Copy Number Variation (CNV) Portfolio Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human

More information

Determination of Genomic Imbalances by Genome-wide Screening Approaches

Determination of Genomic Imbalances by Genome-wide Screening Approaches Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

MRC-Holland MLPA. Description version 05; 03 April 2019

MRC-Holland MLPA. Description version 05; 03 April 2019 SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 Lot A1-1215. Glioblastoma, the most common malignant primary brain tumour, is characterised by aggressive behaviour and a poor survival. Hypermethylation in

More information

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit

More information

SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer

SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer 1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu

More information

MRC-Holland MLPA. Description version 14; 28 September 2016

MRC-Holland MLPA. Description version 14; 28 September 2016 SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium

More information

Interactive analysis and quality assessment of single-cell copy-number variations

Interactive analysis and quality assessment of single-cell copy-number variations Interactive analysis and quality assessment of single-cell copy-number variations Tyler Garvin, Robert Aboukhalil, Jude Kendall, Timour Baslan, Gurinder S. Atwal, James Hicks, Michael Wigler, Michael C.

More information

Polyomaviridae. Spring

Polyomaviridae. Spring Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm

More information

SALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced.

SALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced. SALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced. MENTAL RETARDATION is caused by aberrant copy numbers of subtelomeric

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

LACTASE PERSISTENCE: EVIDENCE FOR SELECTION

LACTASE PERSISTENCE: EVIDENCE FOR SELECTION LACTASE PERSISTENCE: EVIDENCE FOR SELECTION INTRODUCTION The ability of some human adults to digest lactose the sugar in milk is evidence of recent human evolution. All mammalian babies can digest lactose,

More information

CYTOGENETICS Dr. Mary Ann Perle

CYTOGENETICS Dr. Mary Ann Perle CYTOGENETICS Dr. Mary Ann Perle I) Mitosis and metaphase chromosomes A) Chromosomes are most fully condensed and clearly distinguishable during mitosis. B) Mitosis (M phase) takes 1 to 2 hrs and is divided

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

UNC-Duke Biology Course for Residents Fall Cell Cycle Effects of Radiation

UNC-Duke Biology Course for Residents Fall Cell Cycle Effects of Radiation UNC-Duke Biology Course for Residents Fall 2018 1 Cell Cycle: Sequence of changes in a cell starting with the moment the cell is created by cell division, continuing through the doubling of the DNA and

More information

No evidence of clonally selected somatic genomic alterations in cancer associated

No evidence of clonally selected somatic genomic alterations in cancer associated Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks?

Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Embryo 1 Embryo 2 combine samples for a single sequencing chip Barcode 1 CTAAGGTAAC

More information

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22. Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;

More information

Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing

Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Maria Nattestad Schatz + McCombie + Hicks at Cold Spring Harbor Laboratory McPherson

More information

Analysis of shotgun bisulfite sequencing of cancer samples

Analysis of shotgun bisulfite sequencing of cancer samples Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The

More information

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly

More information

MRC-Holland MLPA. Description version 07; 26 November 2015

MRC-Holland MLPA. Description version 07; 26 November 2015 SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced

More information

MRC-Holland MLPA. Description version 30; 06 June 2017

MRC-Holland MLPA. Description version 30; 06 June 2017 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are

More information

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2. a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

L I F E S C I E N C E S

L I F E S C I E N C E S 1a L I F E S C I E N C E S 5 -UUA AUA UUC GAA AGC UGC AUC GAA AAC UGU GAA UCA-3 5 -TTA ATA TTC GAA AGC TGC ATC GAA AAC TGT GAA TCA-3 3 -AAT TAT AAG CTT TCG ACG TAG CTT TTG ACA CTT AGT-5 OCTOBER 31, 2006

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION -. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17

More information