Hepatocyte nuclear factor 1 beta induces transformation and epithelial-to-mesenchymal transition

Transcription

1 Hepatocyte nuclear factor 1 beta induces transformation and epithelial-to-mesenchymal transition Atsuka Matsui 1, Jiro Fujimoto 2,3, Kosuke Ishikawa 2,3, Emi Ito 4, Naoki Goshima 5,6, Shinya Watanabe 4 and Kentaro Semba 1,7 1 Department of Life Science and Medical Bioscience, School of Advanced Science and Engineering, Waseda University, Tokyo, Japan 2 Japan Biological Informatics Consortium (JBiC), Tokyo, Japan 3 Research Institute for Science and Engineering, Waseda University, Tokyo, Japan 4 Division of Gene Expression Analysis, Translational Research Center, Fukushima Medical University, Japan 5 Division of Transcriptome Analysis, Translational Research Center, Fukushima Medical University, Japan 6 Quantitative Proteomics Team, Molecular Profiling Research Center for Drug Discovery (molprof), National Institute of Advanced Industrial Science and Technology (AIST), Tokyo, Japan 7 Division of Gene Function Analysis, Translational Research Center, Fukushima Medical University, Japan Correspondence K. Semba, 2-2 Wakamatsu-cho, Shinjuku-ku, Tokyo , Japan Fax/Tel: ksemba@waseda.jp (Received 19 November 2015, revised 11 March 2016, accepted 16 March 2016, available online 31 March 2016) doi: / Edited by Angel Nebreda Gene amplification can be a cause of cancer, and driver oncogenes have been often identified in amplified regions. However, comprehensive analysis of other genes coamplified with an oncogene is rarely performed. We focused on the 17q12 21 amplicon, which contains ERBB2. We established a screening system for oncogenic activity with the NMuMG epithelial cell line. We identified a homeobox gene, HNF1B, as a novel cooperative transforming gene. HNF1B induced cancerous phenotypes, which were enhanced by the coexpression of ERBB2, and induced epithelial-to-mesenchymal transition and invasive phenotypes. These results suggest that HNF1B is a novel oncogene that can work cooperatively with ERBB2. Keywords: breast tumor; epithelial-to-mesenchymal transition; gene amplification; hepatocyte nuclear factor 1 beta; three-dimensional culture Gene amplification is caused by errors in DNA replication and occasionally produces extra gene copies, resulting in the overproduction of a normal protein [1]. Several oncogenes, such as ERBB2 (erb-b2 receptor tyrosine kinase 2), MYC (v-myc avian myelocytomatosis viral oncogene homolog), and MYCN (v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog), have been identified in gene amplification regions (amplicons) [2]. Generally, a unit of DNA amplification encompasses up to tens of megabases of DNA, resulting in the simultaneous overexpression of several to dozens of genes [3]. Researchers have often focused on a driver gene in an amplicon that possesses transforming activity, but the functional contribution of the other genes within the amplicon has been rarely comprehensively analyzed. We have focused on the 17q12 21 amplicon, which is observed in about 30% of breast tumors [2]. Amplification and overexpression of ERBB2, centrally localized in a unit of this amplicon, are associated with poor prognoses [4]. Homo- or heterodimer formation of ERBB2 and its related family members drives continuous cell proliferation and inhibits apoptosis. Thus, ERBB2 is thought to be an important driver oncogene in this amplicon. However, approximately 50 other Abbreviations HNF1B, hepatocyte nuclear factor 1 beta; DMEM, Dulbecco s modified Eagle s medium; ERBB2, v-erb-b2 erythroblastic leukemia viral oncogene homolog; ZEB2, zinc finger E-Box-binding homeobox 2; TP63, tumor protein 63; EMT, epithelial-to-mesenchymal transition; NMuMG, normal murine mammary gland. 1211

2 Hepatocyte nuclear factor 1 beta as an oncogene A. Matsui et al. genes are located in this amplicon, and these genes have not been comprehensively studied. We recently reported that among these genes, GRB7, a cytoplasmic activator and adaptor of ERBB2, enhanced ERBB2 phosphorylation and Akt signaling [5] and retinoic acid receptor alpha (RARA) gene induced epithelial-tomesenchymal transition (EMT) [6]. These results indicate that simultaneously amplified genes could cooperate in causing malignant phenotypes of breast cancer. In this study, we established a screening system using NMuMG cells, an epithelial-derived cell line, to test for transforming activities of genes coamplified with ERBB2 in the 17q12 21 amplicon. With this screen, we identified HNF1B (hepatocyte nuclear factor 1 beta) as a new member of the transforming genes in this amplicon and discuss its involvement in the initiation and progression of cancer. Materials and methods Cell culture NMuMG cells (kindly provided by K. Miyazawa, University of Yamanashi, Japan) were cultured in Dulbecco s modified Eagle s medium (DMEM) supplemented with 10% FBS, 100 UmL 1 penicillin, 100 lgml 1 streptomycin, 10 lgml 1 insulin, and 4.5% glucose at 37 C in 5% CO 2. MCF10A cells purchased from ATCC (Manassas, VA, USA) were cultured as previously described [6]. Retroviral packaging and infection Plat-E packaging cells were kindly provided by T. Kitamura (Institute of Medical Science, The University of Tokyo), and cultured in DMEM supplemented with 10% FBS, penicillin, and streptomycin. Preparation of recombinant retroviruses using Plat-E cells was previously described [5]. NMuMG-HNF1B, NMuMG-ERBB2wt, NM umg-erbb2ve, and MCF10A-HNF1B cells were established by retroviral infection of cells with pmxs-ires-pu ro-hnf1b, pqcxin-erbb2wt, pqcxin-erbb2v659e, and pmxs-ires-puro-hnf1b, respectively. To obtain stably expressing cells, puromycin or G418 sulfate was added to the medium for 1 week. Transformation assays and screening Infected NMuMG cells ( ) were mixed with noninfected cells ( ), seeded into 6-cm culture dishes and maintained for 1 2 weeks. Cells were stained with 0.05% crystal violet to detect focus formation. Next, 2.5 ml of 0.53% agarose (SeaPlaque GTG agarose; Lonza, Basel, Switzerland) in culture medium was plated and solidified on 60-mm culture dishes. A mixture of NMuMG cells in 0.27% agarose in culture medium (3 ml total) was then layered on the base agar. The cells were fed with 1 ml of culture medium at 1-week intervals for 30 days. Foci and colonies were picked using 200-lL pipette tips and seeded in 96-well plates. Genomic DNA were prepared as described previously [5] to identify inserted cdna. MCF10A 3D Matrigel/collagen assays were performed as previously described [6]. DNA constructs and antibodies ERBB2 expression vectors were previously described [5]. The human HNF1B cdna (RefSeq: NM_000458) was cloned into a pmxs retroviral vector [7] using the Gateway Cloning system (Thermo Fisher, Waltham, MA, USA). HNF1B mutants were made by PCR-based mutagenesis with appropriate primer sets (Table 1). All cdna sequences were confirmed by sequencing. Primary antibodies used were as follows: anti-alpha Tubulin (clone DM1A; Sigma, St. Louis, MO, USA), anti-hnf-1 beta (#612504; BD Transduction Laboratories, Franklin Lakes, NJ, USA), anti-e-cadherin (#610182; BD), anti-n-cadherin (#610921; BD) and anti-p63[4a4] (sc-8431; Santa Cruz Biotechnology, Dallas, TX, USA). Quantitative reverse-transcription (RT)-PCR Quantitative PCR was performed using Thunderbird Ò SYBR qpcr mix (Toyobo, Osaka, Japan) or TaqMan gene expression assays (Thermo Fisher) with TBP (NM_003194) or 18S rrna used as a relative control. Reaction conditions were as follows: an initial 1 min at 95 C followed by 40 cycles of 15 s at 95 C and 60 s at each annealing temperature. Primers are listed in Table 2. The following TaqMan gene expression assays were used: SNAI1, Hs _m1; SNAI2, Hs _m1; FOXC2, Hs _s1; ZEB1, Hs _m1; ZEB2, Hs _m1; TGFBR1, Hs _m1; TGFBR2, Hs _m1; TGFB1, Hs _m1; TGFB2, Hs _m1; SMAD3, Hs _m; and 18S, Hs _s1. Table 1. Primers for generation of the HNF1B mutation. Forward Reverse HNF1B-delPOU (del ) CAGAGTTCTGGAAATATGACAGACAAAAGCA CTGGGGGATGTTGTGTTGCTG HNF1B-delHomeo (del ) CAAAAGCTGGCCATGGACGC GTTGCGGCGCATCTTCTTGTT 1212

3 A. Matsui et al. Hepatocyte nuclear factor 1 beta as an oncogene Table 2. Primers for qrt-pcr. Forward Reverse Primer position TP63 DN (exons 3 0 4, no 1 3) GAAAACAATGCCCAGACTCAA TGCGCGTGGTCTGTGTT 3 0,4 TP63 a (exons 10 14, no 15) TCAGTTTCTTAGCGAGGTTG ATTTTCAGACTTGCCAGATC 12 13, 14 TP63 b (exons 10 12, 14, no 13 or 15) AGCATTGTCAGGATCTGG GAGATGAGAAGGGGAGGA 12, 14 ETS1 GTTAATGGAGTCAACCCAGC GGGTGACGACTTCTTGTTTG TBP CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC Table 3. Primers for ChIP qpcr. Putative-binding site Forward Reverse Binding site upstream of TSS (bp) ZEB1 site1 GCATTGAGGATGAATGCAGA TTTTCTTGGGCATTTTGAGAA 1581 ZEB1 site2 CCAATACTCCGGTCACGTTT CTTCCCACCTCCTTCGAATA 1228 ZEB2 site1 GTGCCTGACCCATGTTGAA CCCACCCCATCACAGATAAA 1851, 1801 ZEB2 site2 CTGTGCTCAGCATCCTCAAA CACTTCCCAGGGGAATTTTT 1012 DNp63 site2 TTCGTACCAAGGCCAGATTC GCACGTGATGCATCTATGTAAA 839 DNp63 site3 TGGATTTGCGTACTCTCTCCT CCACGATTTACAGAAGGCATTT 430 DNp63 site4 TCCATTGGAGTGGAGGAGTC CCCCGAGACCCTTACAATATG 19 FOXC2 site1 GAGCCTGGAAACTCCCTGTT CCCAGGTGTAATGGATTCAAA 935, 928 FOXC2 site2 GCGTTTGCTTTGAATCCATTA TCCCAAAGACCTTGTAAGTAGCA 806 ETS1 site2 TTTCTGCCTAAAACTTTTCAGTCCAT AAACAATTAAATGGGAATATAGAAAGA +154 Chromatin immunoprecipitation ChIP assays were performed using the SimpleChIP TM Enzymatic Chromatin IP Kit (Cell Signaling Technology, Danvers, MA, USA) according to the manufacturer s protocol. Soluble chromatin was immunoprecipitated with anti- DYKDDDDK tag antibody ( ; Wako Chemical, Osaka, Japan) or normal mouse IgG (sc-2025; Santa Cruz Biotechnology). qpcr was performed using Thunderbird SYBR qpcr mix (Toyobo). The primer sequences are listed in Table 3. An ACTB exon was used as a negative control. Statistical and DNA analysis Transformation assays and quantitative RT-PCR were performed with at least three replicates per experiment. ChIP assays were performed with two replicates per experiment. Statistical significance tests for these experiments were performed using Student s t-test. The breast cancer microarray datasets that include more than 200 cases were selected from ONCOMINE, a cancer microarray database ( The breast cancer microarray datasets were used from the study by Zhang et al. [8] (Zhang cohort or dataset, Affymetrix arrays, GSE10099) and Hatzis et al. [9] (Hatzis cohort or dataset, Affymetrix arrays, GSE25066). The patient samples were separated into high (> average SD) and low groups (< average SD) on the basis of HNF1B expression. Metastasis-free survival was estimated using the Kaplan Meier method. Statistical tests were performed using Gehan Breslow Wilcoxon test with PRISM 6.0 software (GraphPad Software, La Jolla, CA, USA). P-values less than 0.05 were considered statistically significant. The JASPAR database was used to search HNF1B-binding sites in the promoter of EMT-inducing factors [10]. Results Establishing a transformation assay using NMuMG cells We chose the NMuMG cell line as the recipient cells for our transformation assay, because this cell line is of epithelial origin, as are 80% of tumors. Additionally, NMuMG cells are capable of forming tumors in mice when transformed by oncogenic RAS [11]. We first examined whether NMuMG cells were suitable for a transforming assay. For this purpose, we retrovirally introduced an oncogenic mutant of ERBB2 (ERBB2V659E) [12] and performed focus and soft agar assays. Expression of mutant ERBB2 resulted in the efficient formation of foci and colonies, but neither wild-type ERBB2 nor control Venus gene had effects on cell growth (Fig. S1A). As the normal ERBB2 protein is overexpressed in most cases of human cancer with 17q12 21 amplicon, we decided to use wild-type ERBB2-expressing NMuMG cells (NMuMG- ERBB2wt) as a recipient cell to screen oncogenes cooperating with ERBB

4 Hepatocyte nuclear factor 1 beta as an oncogene A. Matsui et al. Table 4. List of cdna isolated from transformed cells infected with the retroviral cdna vector pool of genes in the 17q12 21 amplicon. Symbol Description Frequency TCAP Titin-cap (telethonin) 14 THRA Thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) 10 oncogene homolog, avian) PGAP3 Post-GPI attachment to proteins 3 9 DUSP14 Dual-specificity phosphatase 14 8 RARA Retinoic acid receptor, alpha 8 PCGF2 Polycomb group ring finger 2 7 HNF1B HNF1 homeobox B 7 CACNB1 Calcium channel, voltage-dependent, beta 1 subunit 7 GRB7 Growth factor receptor-bound protein 7 7 TNS4 Tensin 4 6 STARD3 StAR-related lipid transfer (START) domain containing 3 6 CSF3 Colony-stimulating factor 3 (granulocyte) 5 KRT24 Keratin 24 4 PLXDC1 Plexin domain containing 1 3 RAPGEFL1 Rap guanine nucleotide exchange factor (GEF)-like 1 3 TADA2A Transcriptional adaptor 2A 3 C17orf78 Chromosome 17 open reading frame 78 3 RPL23 Ribosomal protein L23 3 MED24 Mediator complex subunit 24 3 ORMDL3 ORM1-like 3 (Saccharomyces cerevisiae) 2 C17orf37 Chromosome 17 open reading frame 37 2 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 2 PSMB3 Proteasome (prosome, macropain) subunit, beta type, 3 2 PNMT Phenylethanolamine N-methyltransferase 2 PSMD3 Proteasome (prosome, macropain) 26S subunit, non-atpase, 3 2 KRT25 Keratin 25 2 RPL19 Ribosomal protein L19 1 PPP1R1B Protein phosphatase 1, regulatory (inhibitor) subunit 1B 1 MSL1 Male-specific lethal 1 homolog (Drosophila) 1 CWC25 CWC25 spliceosome-associated protein homolog (S. cerevisiae) 1 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, 1 neuro/glioblastoma-derived oncogene homolog (avian) LOC Hypothetical protein LOC SMARCE1 SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily e, member 1 1 NR1D1 Nuclear receptor subfamily 1, group D, member 1 0 IKZF3 IKAROS family zinc finger 3 (Aiolos) 0 IGFBP4 Insulin-like growth factor-binding protein 4 0 TMEM99 Transmembrane protein 99 0 SYNRG Synergin, gamma 0 MRPL45 Mitochondrial ribosomal protein L45 0 SOCS7 Suppressor of cytokine signaling 7 0 SRCIN1 SRC kinase signaling inhibitor 1 0 MLLT6 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 0 PIP4K2B Phosphatidylinositol-5-phosphate 4-kinase, type II, beta 0 LASP1 LIM and SH3 protein 1 0 FBXL20 F-box and leucine-rich repeat protein 20 0 MED1 Mediator complex subunit 1 0 GSDMB Gasdermin B 0 GSDMA Gasdermin A 0 WIPF2 WAS/WASL-interacting protein family, member 2 0 CDC6 Cell division cycle 6 homolog (S. cerevisiae) 0 CCR7 Chemokine (C-C motif) receptor 7 0 KRT28 Keratin 28 0 The number of sequence 137 The number of focus 29 Genes in bold were tested for focus formation assay. 1214

5 A. Matsui et al. Hepatocyte nuclear factor 1 beta as an oncogene Transformation of NMuMG cells by HNF1B To evaluate the cooperative transforming activity of genes in the 17q12 21 amplicon with wild-type ERBB2, we cloned human cdna corresponding to all such genes into pmx retroviral vectors and then prepared a mixture of ecotropic retrovirus by transfecting these vectors into Plat-E packaging cells. One to two weeks after infection of NMuMG-ERBB2wt cells with the virus mixture, we detected 29 foci and 19 colonies. We expanded each focus and prepared its genomic DNA to analyze integrated cdna by PCR amplification and DNA sequencing (Table 4). We identified 11 cdna with high integration frequency in the foci and individually introduced them into NMuMG-ERBB2wt cells to perform focus assays. As a result, we identified reproducible focus- and colony-forming activities of HNF1B (RefSeq: NM_000458). We next analyzed the ERBB2-dependency of HNF1B-mediated transformation. HNF1B induced transformation without ERBB2 overexpression, indicating that HNF1B itself has focus-forming activity (Fig. 1A). However, NMuMG cells coexpressing HNF1B and ERBB2 spread almost all over the surface of the culture dish and showed more morphological changes than those expressing either HNF1B or ERBB2 alone. HNF1B also significantly promoted colony formation both in ERBB2wt and ERBB2VE-expressing NMuMG cells (P < and P < , respectively) (Fig. 1B,C). Interestingly, expression of HNF1B alone formed colonies with well-ordered spheroid structures and coexpression of HNF1B and ERBB2wt formed smaller colonies than the coexpression of HNF1B and ERBB2VE, whereas coexpression of HNF1B and ERBB2VE formed filled colonies, as observed in typical transformed colonies (Fig. S1B). The HNF1B gene is a transcription factor that belongs to the Homeobox gene superfamily and contains the POU (Pit-1/Oct-1/Unc-86) domain and the Homeo domain, both of which are necessary for DNA binding [13]. To examine the contribution of HNF1B transcriptional activity to its transforming potential, we constructed two deletion mutants that lacked the DNA-binding domain. As shown in Fig. 1D G, both Fig. 1. Transforming activity of HNF1B in NMuMG cells. (A) Focus-formation assay. NMuMG, ERBB2wt-NMuMG, or ERBB2VE-NMuMG cells were infected with HNF1B or Mock retrovirus and then cultured for 10 days. Scale bar, 500 lm. (B) Colony formation assay. Cells prepared as in (A) were seeded in soft agar and cultured for 30 days. (C) Colony formation assay. Cells ( cells) were plated in 6-well plates. Colonies larger than 150 lm in diameter were counted, and the numbers are plotted. (D) Domain structure of HNF1Bwt and its mutants. (E) HNF1Bwt and its mutants were detected by western blotting. (F) Focus formation assays with HNF1B mutants. NMuMG cells were infected with retrovirus-expressing wild-type (wt) or mutant HNF1B, and then cultured for 13 days. Scale bar, 500 lm. Crystal violet staining of a culture dish is shown in the lower panel. (G) Foci were counted and the numbers are plotted. Venus versus HNF1Bwt: P < Experiments in (B), (C), (F), and (G) were performed with biological triplicates. 1215

6 Hepatocyte nuclear factor 1 beta as an oncogene A. Matsui et al. of the HNF1B mutants, del-pou (del ) and del-homeo (del ), were defective in transforming activity. These results indicate that HNF1B-mediated transformation depends on its DNA-binding activity. Induction of EMT and invasion phenotype by HNF1B Deficiency of the linkage between a variety of malignant phenotypes, besides transforming activity and the transcriptional regulation, provoked us to evaluate the function of HNF1B. Therefore, we investigated whether HNF1B induced EMT phenotype and found that HNF1B reduced E-cadherin expression in NMuMG cells (Fig. S2A). Because this phenotype was weak, we used MCF10A, a human immortalized breast epithelial cell line, as a more suitable cell to examine phenotypes of EMT and invasion in detail [6,14]. MCF10A cells showed a fibroblastic morphology by HNF1B overexpression (Fig. 2A). Western blot analysis revealed decreased expression of epithelial marker E-cadherin and increased expression of mesenchymal markers N-cadherin, vimentin, and fibronectin upon HNF1B expression in a DNA-binding domain-dependent manner (Fig. 2B, S2b). However, expression of ERBB2VE did not change expression of EMT markers (Fig. 2C). These results indicate that HNF1B regulates EMT through its transcriptional activity. In this study as well as in previous studies, it has been shown that EMT-inducing factors cause protrusion in MCF10A cells when embedded in a Matrigel/collagen mixture gel [6,15]. Using this assay, we observed that wild-type HNF1B efficiently induced cellular protrusion in MCF10A cells, whereas control MCF10A cells and MCF10A cells expressing HNF1B mutants did not (Fig. 2D). Nuclear imaging with a fluorescent protein, mcherry, revealed that HNF1B induced a phenotype of multicellular invasion and not elongation of single cells. This phenotypic change was very similar to that induced by other EMT-inducing genes [6,15]. Fig. 2. Expression of EMT markers and three-dimensional assays in HNF1Bexpressing MCF10A cells. (A) Morphological change in MCF10A cells induced by HNF1B. Scale bar, 250 lm. (B) Expression of EMT markers in MCF10A cells expressing HNF1B or its mutants. Venus retrovirus was used as a negative control. (C) Expression of EMT markers in ERBB2 and HNF1B-coexpressing MCF10A cells. (D) Three-dimensional culture of MCF10A cells with collagen/matrigel mixture. HNF1B caused protrusion of MCF10A cells, which represents invasive activity. MCF10A-expressing mcherry fused with a nuclear localization signal was detected by fluorescence (shown in right panel). Scale bar, 100 lm. 1216

7 A. Matsui et al. Hepatocyte nuclear factor 1 beta as an oncogene Transcriptional regulation of EMT-related genes by HNF1B We examined the expression levels of typical representative genes involved in EMT by quantitative RT-PCR [16 18] in HNF1B-overexpressing MCF10A cells. The results significantly revealed increased mrna levels of SNAI1 (12.8-fold), ZEB1 (2.54-fold), ZEB2 (4.73- fold), FOXC2 (1.87-fold), TGFBR1 (3.69-fold), TGFB (1.24-fold), and ETS1 (1.4-fold) and decreased levels of mrna for SNAI2 (0.20-fold), TWIST2 (0.43-fold), TGFBR2 (0.74-fold), TWIST1 (0.88-fold), and DNp63 (0.22-fold) (Fig. 3A). The transcription factor p63 is a member of the p53 gene family, and the p63 gene uses two promoters and an alternative splicing mechanism to encode at least six isoforms (TAp63a, TAp63b, TAp63c, DNp63a, DNp63b, and DNp63c) (Fig. S3). Among the isoforms, the depletion of DNp63a and b isoforms is known to induce EMT in MCF10A cells [19]. RT- PCR using isoform-specific primers (Table 2) revealed lower levels of p63a (0.19-fold) and p63b (0.21-fold) mrna in HNF1B-overexpressing MCF10A cells compared with those in parental MCF10A cells (Fig. 3A). Western blotting using a p63 antibody against all p63 isoforms showed decreased levels of DNp63a and DNp63b in HNF1B-overexpressing MCF10A cells and absence of TAp63 isoforms in MCF10A cells. We concluded that DNp63a is predominantly expressed in MCF10A cells and was downregulated by HNF1B (Fig. 3B). Although several HNF1B target genes have been reported [20,21], the genes described above have not yet been analyzed. We thus examined if these EMTinducing genes are directly regulated by HNF1B using ChIP assays. The POU and homeodomain DNA-binding domains of HNF1B recognize 5 0 -NNCAT-3 0 and 5 0 -TAAT-3 0, respectively, with extremely low binding affinity [13], but both domains function cooperatively to bind strongly to the consensus sequence 5 0 -GTT AATNATTAAC-3 0 [20]. Using the JASPAR database [10], we found candidate HNF1B-binding sites in the promoter regions ( 2000 to +200 bp of the transcription start site) of five genes, including ZEB2 and DNp63 (Table 3). We performed ChIP assays and found that HNF1B bound to the promoter of ZEB2 (site 1) and DNp63 (site 4) (Fig. 3C), but did not significantly bind to other candidate regions (data not shown). These results suggested that HNF1B might induce EMT and invasion phenotypes through direct transcriptional regulation of ZEB2 and DNp63. Prognosis of breast cancer metastasis associated with HNF1B HNF1B overexpression was reported to be associated with poor prognosis in ovarian and pancreatic cancer [22,23]. To address the involvement of HNF1B in breast tumor malignancy, we analyzed the correlation of HNF1B expression with metastasis-free survival or overall survival using 13 clinical datasets of breast Fig. 3. Expression of EMT-related genes in HNF1B-expressing MCF10A cells. (A) The mrna levels of EMT-related genes, ETS1 and TP63, were measured by quantitative RT-PCR. qrt-pcr values were normalized to the internal control, 18s rrna or TBP. Data are shown as the mean SD (***P < , **P < 0.005, *P < 0.05). (B) Levels of TP63 proteins in HNF1B-expressing cells were analyzed by western blotting. (C) ChIP qpcr analysis of HNF1B binding to candidate sites of ZEB2 and DNp63. (*P < 0.05). 1217

8 Hepatocyte nuclear factor 1 beta as an oncogene A. Matsui et al. Fig. 4. Metastasis-free survival curve. Metastasis-free survival was significantly worse with high levels of HNF1B expression. N: number of samples. cancer. In two datasets [8,9], HNF1B expression was associated with metastasis-free survival (Fig. 4). Discussion Gene amplification results in copy number increase in a restricted region of a chromosome arm. It is a crucial physiological program in normal development, such as in the Drosophila melanogaster ovary [2]. However, uncontrolled gene amplification can cause pathogenesis of diseases. Gene amplification is observed in solid tumors and is frequently involved in tumorigenesis and progression. We have focused on the 17q12 21 amplicon, which is involved in poor prognosis [3]. ERBB2 is located in this amplicon and has been recognized as a causal factor of breast cancer. Our previous two studies found that genes colocalized in the same amplicon as ERBB2 also play roles in malignancy; GRB7 enhanced Akt signaling by ERBB2 [5], whereas RARA induced EMT and invasion phenotypes independently of ERBB2 [6]. Therefore, we investigated the activation of ERBB2 signaling by HNF1B. However, we have not obtained any clear evidence on the molecular mechanism underlying the cooperation of ERBB2 and HNF1B. Thus, HNF1B and ERBB2 may contribute to the transformation independently, namely HNF1B weakly induces EMT and ERBB2 promotes proliferation of NMuMG cells, which may cooperatively induce efficient transformation as is the case with RARA and ERBB2. While our previous study used NIH3T3 cells [5], here we used mammary epithelial cells for screening and successfully identified HNF1B as another malignant factor in the same 17q12 21 amplicon. Interestingly, HNF1B was not identified by screening in NIH3T3 cells [5]. Attenuation and disruption of cell adhesion in epithelial cells is thought to induce loss of contact inhibition [24]. Therefore, the ability of EMT induction could promote transformation of epithelial cells, which may be the reason why HNF1B was identified as a transforming gene by screening with epithelial-derived NMuMG cells but not with fibroblast-derived NIH3T3 cells. Thus, HNF1B may be defined as an epithelial-specific oncogene. Although EMT is important for epithelial transformation, we think that EMT itself is not enough for transformation because our preliminary analysis showed that EMT-inducing genes did not always induce focus formation. Our findings demonstrated that HNF1B independently induced foci but cooperated with ERBB2 in colony formation. Many driver oncogenes, including PAK1 and CCND1, and cooperator genes have recently been identified in other amplicons. For example, in the 11q13 amplicon, CCND1, PAK1, and EMSY were coamplified, and coamplification of CCND1 and EMSY showed poorer prognosis than amplification of either gene [25 27]. In the 14q13.3 amplicon, TTF-1, NKX2-1, and PAX9 cooperated to promote lung cancer cell proliferation [28,29]. These results imply that multiple driver oncogenes or cooperator genes are colocalized in an amplicon, emphasizing the importance of analyzing all individual genes in an amplicon in which a driver oncogene has already been identified. We showed here at least three tumorigenesis-related phenotypes caused by HNF1B in a DNA-binding domain-dependent manner: focus formation, anchorage-independent growth, and the induction of EMT and invasive phenotypes. The HNF1B gene belongs to the Homeobox gene superfamily, which consists of 235 members that are classified in 102 families, such as Hox1, Cdx, Pax, and Dlx [30]. Several homeobox genes are known to be involved in cancer, including upregulated, downregulated, or translocation-induced fusion genes [30 34]. For example, ZEB1, ZEB2, and 1218

9 A. Matsui et al. Hepatocyte nuclear factor 1 beta as an oncogene GSC are known EMT-related factors, and LHX1 is an oncogene that functions through regulation of apoptosis, angiogenesis, and proliferation pathways. HOXB7 is involved in tumorigenesis through activation of the epidermal growth factor receptor (EGFR) pathway [16,35 37]. HNF1B is overexpressed in ovarian clear cell carcinoma, which shows poor prognosis because of low chemosensitivity [23]. HNF1B overexpression is also correlated with worse survival in pancreatic clear cell carcinoma [22] and in breast cancers. Together with our study and clinical data, we propose that HNF1B is a novel member of cancer-associated homeobox genes. Aberrant activation of EMT causes cellular invasion and metastasis and accelerates tumor malignancy [17,18]. It is likely that HNF1B also regulates the transcription of target genes in the context of initiation and progression of cancer. In this work, we demonstrated that HNF1B regulated the expression of a number of EMT-inducing genes and demonstrated direct regulation of ZEB2 and DNp63. ZEB2 was reported to be involved in invasiveness and aggressiveness in breast, ovarian, gastric pancreatic cancers [16,38]. Downregulation of DNp63 is known to induce EMT [19]. In contrast, some EMT-inducing factors such as SNAI2 were downregulated by HNF1B. A previous study reported that microrna-204 downregulated SNAI2, but not SNAI1, ZEB1, or ZEB2 [39]. Although we have no information on microrna expression profiles, these studies suggest that HNF1B may downregulate SNAI2 via mir-204. In cases of other EMT-related genes besides SNAI2, we do not know the mechanism and significance of their transcriptional regulation by HNF1B. We think that the important issue is that EMT-inducing factors constitute the transcriptional network regulating them mutually and thus it would be necessary to consider the overall effect of EMT-inducing factors. Indeed, our preliminary analysis failed to show the suppression of EMT by forced expression of DNp63 (data not shown). EMT-inducing factors also promote the generation of cancer stem like-cells in transformed cells [40]. Cancer stem cells have the potential for self-renewal and have been proposed to be involved in tumor malignancy [40,41]. Therefore, it will be necessary to investigate the involvement of HNF1B in cancer stem cell-phenotypes. HNF1B is located in the 17q12 21 amplicon, and our data indicated that HNF1B enhanced ERBB2- induced anchorage-independent growth and induced EMT phenotype. Because of the collaborative function of HNF1B and ERBB2, we predicted that HNF1B overexpression was involved in worse metastasis survival in HER2-positive breast cancer. However, we could not find informative datasets with metastasis status because of the small number of HER2-positive samples. Therefore, we did not show any difference in metastasis survival between HNF1B-high and HNF1Blow groups in HER2-positive breast cancer. These data suggest that HNF1B is involved in worse metastasis survival in breast cancers that are driven by not only ERBB2 but also other oncogenes. So far we have not found any common features between datasets of the Hatzis cohort and Zhang cohort. Indeed, patients included in the Hatzis cohort were ERBB2-negative, ER+, and were treated with endocrine-based therapy, and the Zhang cohort included lymph node-negative breast cancer patients. Analysis of more datasets, if available, will be required to conclude the importance of HNF1B in metastasis. Acknowledgements We thank our laboratory members, especially Kumiko Semba, for secretarial assistance. This work was conducted as a program through the Fukushima Translational Research Project and supported in part by JSPS KAKENHI Grant Number , Grant-in-Aid for Scientific Research (A). Author contributions AM designed and performed experiments. AM, JF, KI and KS wrote the manuscript. NG made and provided retroviral vectors of cdna clones. EI and SW provided information of amplicons and discussed the results. References 1 Santarius T, Shipley J, Brewer D, Stratton MR and Cooper CS (2010) A census of amplified and overexpressed human cancer genes. Nat Rev Cancer 10, Matsui A, Ihara T, Suda H, Mikami H and Semba K (2013) Gene amplification: mechanisms and involvement in cancer. Biomol Concepts 4, Albertson DG (2006) Gene amplification in cancer. Trends Genet 22, Yamamoto T, Saito M, Kumazawa K, Doi A, Matsui A, Takebe S, Amari T, Oyama M and Semba K (2011) ErbB2/HER2: its contribution to basic cancer biology and the development of molecular targeted therapy. In Breast Cancer - Carcinogenesis, Cell Growth and Signalling Pathways (M. Gunduz ed.). In Tech, Croatia. 5 Saito M, Kato Y, Ito E, Fujimoto J, Ishikawa K, Doi A, Kumazawa K, Matsui A, Takebe S, Ishida T et al. (2012) Expression screening of 17q12-21 amplicon 1219

10 Hepatocyte nuclear factor 1 beta as an oncogene A. Matsui et al. reveals GRB7 as an ERBB2-dependent oncogene. FEBS Lett 586, Doi A, Ishikawa K, Shibata N, Ito E, Fujimoto J, Yamamoto M, Shiga H, Mochizuki H, Kawamura Y, Goshima N et al. (2014) Enhanced expression of retinoic acid receptor alpha (RARA) induces epithelialto-mesenchymal transition and disruption of mammary acinar structures. Mol Oncol 9, Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T and Kumagai H (2003) Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol 31, Zhang Y, Martens JWM, Yu JX, Jiang J, Sieuwerts AM, Smid M, Klijn JGM, Wang Y and Foekens JA (2009) Copy number alterations that predict metastatic capability of human breast cancer. Cancer Res 69, Hatzis C, Pusztai L, Valero V, Booser DJ, Esserman L, Lluch A, Vidaurre T, Holmes F, Souchon E, Wang H et al. (2011) A genomic predictor of response and survival following taxane-anthracycline chemotherapy for invasive breast cancer. JAMA 305, Mathelier A, Fornes O, Arenillas DJ, Chen C-Y, Denay G, Lee J, Shi W, Shyr C, Tan G, Worsley-Hunt R et al. (2015) JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles. Nucleic Acids Res 44, D110 D Hynes NE, Jaggi R, Kozma SC, Ball R, Muellener D, Wetherall NT, Davis BW and Groner B (1985) New acceptor cell for transfected genomic DNA: oncogene transfer into a mouse mammary epithelial cell line. Mol Cell Biol 5, Bargmann CI, Hung MC and Weinberg RA (1986) Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell 45, Wegner M, Drolet DW and Rosenfeld MG (1993) POU-domain proteins: structure and function of developmental regulators. Curr Opin Cell Biol 5, Debnath J, Muthuswamy SK and Brugge JS (2003) Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods 30, Seton-Rogers SE, Lu Y, Hines LM, Koundinya M, LaBaer J, Muthuswamy SK and Brugge JS (2004) Cooperation of the ErbB2 receptor and transforming growth factor beta in induction of migration and invasion in mammary epithelial cells. Proc Natl Acad Sci USA 101, Thiery JP, Acloque H, Huang RYJ and Nieto MA (2009) Epithelial-mesenchymal transitions in development and disease. Cell 139, Higashikawa K, Yoneda S, Tobiume K, Saitoh M, Taki M, Mitani Y, Shigeishi H, Ono S and Kamata N (2009) DeltaNp63alpha-dependent expression of Id- 3 distinctively suppresses the invasiveness of human squamous cell carcinoma. Int J Cancer 124, Lindsay J, McDade SS, Pickard A, McCloskey KD and McCance DJ (2011) Role of DeltaNp63gamma in epithelial to mesenchymal transition. J Biol Chem 286, Little NA and Jochemsen AG (2002) p63. Int J Biochem Cell Biol 34, Gong Y, Ma Z, Patel V, Fischer E, Hiesberger T, Pontoglio M and Igarashi P (2009) HNF-1beta regulates transcription of the PKD modifier gene Kif12. J Am Soc Nephrol 20, Ma Z, Gong Y, Patel V, Karner CM, Fischer E, Hiesberger T, Carroll TJ, Pontoglio M and Igarashi P (2007) Mutations of HNF-1beta inhibit epithelial morphogenesis through dysregulation of SOCS-3. Proc Natl Acad Sci USA 104, Kim L, Liao J, Zhang M, Talamonti M, Bentrem D, Rao S and Yang G-Y (2008) Clear cell carcinoma of the pancreas: histopathologic features and a unique biomarker: hepatocyte nuclear factor-1beta. Mod Pathol 21, Higashiguchi A, Yamada T, Susumu N, Mori T, Aoki D and Sakamoto M (2007) Specific expression of hepatocyte nuclear factor-1 beta in the ovarian clear cell adenocarcinoma and its application to cytological diagnosis. Cancer Sci 98, Takai Y, Miyoshi J, Ikeda W and Ogita H (2008) Nectins and nectin-like molecules: roles in contact inhibition of cell movement and proliferation. Nat Rev Mol Cell Biol 9, Brown LA, Johnson K, Leung S, Bismar TA, Benıtez J, Foulkes WD and Huntsman DG (2010) Coamplification of CCND1 and EMSY is associated with an adverse outcome in ER-positive tamoxifentreated breast cancers. Breast Cancer Res Treat 121, Shrestha Y, Schafer EJ, Boehm JS, Thomas SR, He F, Du J, Wang S, Barretina J, Weir BA, Zhao JJ et al. (2012) PAK1 is a breast cancer oncogene that coordinately activates MAPK and MET signaling. Oncogene 31, Lorenzetto E, Brenca M, Boeri M, Verri C, Piccinin E, Gasparini P, Facchinetti F, Rossi S, Salvatore G, Massimino M et al. (2014) YAP1 acts as oncogenic target of 11q22 amplification in multiple cancer subtypes. Oncotarget 5, Kendall J, Liu Q, Bakleh A, Krasnitz A, Nguyen KCQ, Lakshmi B, Gerald WL, Powers S and Mu D (2007) Oncogenic cooperation and coamplification of 1220

11 A. Matsui et al. Hepatocyte nuclear factor 1 beta as an oncogene developmental transcription factor genes in lung cancer. Proc Natl Acad Sci USA 104, Hsu DS, Acharya CR, Balakumaran BS, Riedel RF, Kim MK, Stevenson M, Tuchman S, Mukherjee S, Barry W, Dressman HK et al. (2009) Characterizing the developmental pathways TTF-1, NKX2-8, and PAX9 in lung cancer. Proc Natl Acad Sci USA 106, Holland PWH, Booth HAF and Bruford EA (2007) Classification and nomenclature of all human homeobox genes. BMC Biol 5, Haria D and Naora H (2013) Homeobox gene deregulation: impact on the hallmarks of cancer. Cancer Hallm 1, Shah N and Sukumar S (2010) The Hox genes and their roles in oncogenesis. Nat Rev Cancer 10, Abate-shen C (2002) Deregulated homeobox gene expression in cancer: cause or consequence? Nat Rev Cancer 2, Samuel S and Naora H (2005) Homeobox gene expression in cancer: insights from developmental regulation and deregulation. Eur J Cancer 41, Dormoy V, Beraud C, Lindner V, Thomas L, Coquard C, Barthelmebs M, Jacqmin D, Lang H and Massfelder T (2011) LIM-class homeobox gene Lim1, a novel oncogene in human renal cell carcinoma. Oncogene 30, Wang X, He C and Hu X (2014) LIM homeobox transcription factors, a novel subfamily which plays an important role in cancer (review). Oncol Rep 31, Jin K, Kong X, Shah T, Penet M-F, Wildes F, Sgroi DC, Ma X-J, Huang Y, Kallioniemi A, Landberg G et al. (2011) The HOXB7 protein renders breast cancer cells resistant to tamoxifen through activation of the EGFR pathway. Proc Natl Acad Sci 109, Elloul S, Elstrand MB, Nesland JM, Trope CG, Kvalheim G, Goldberg I, Reich R and Davidson B (2005) Snail, Slug, and Smad-interacting protein 1 as novel parameters of disease aggressiveness in metastatic ovarian and breast carcinoma. Cancer 103, Qiu Y, Wei Y, Shen N, Wang Z, Kan T, Yu W, Yi B and Zhang Y (2013) mir-204 inhibits epithelial to mesenchymal transition by targeting slug in intrahepatic cholangiocarcinoma cells. Cell Physiol Biochem 32, Mani SA, Guo W, Liao M-J, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M et al. (2008) The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133, Dey M, Ulasov IV and Lesniak MS (2010) Virotherapy against malignant glioma stem cells. Cancer Lett 289, Supporting information Additional Supporting Information may be found online in the supporting information tab for this article: Fig. S1. Transformation assays using NMuMG cells. (A) Focus and soft agar assays were performed using NMuMG cells overexpressing ERBB2VE or ERBB2 wt. Scale bar, 1 mm. (B) Colony formation assay with HNF1B. NMuMG, ERBB2wt-NMuMG or ERBB2VE-NMuMG cells were infected with HNF1B. Fig. S2. Expression of EMT markers and cell morphology in HNF1B-expressing cells. (A) Expression of E-cadherin in NMuMG cells. (B) Expression of other EMT markers (fibronectin and vimentin) in MCF10A cells. Fig. S3. Domain structure of six isoforms of protein p63. Top: Schematic representation of p63 genomic organization. Alternative promoters and splicing events are shown for the various isoforms. Bottom: Functional domains of p63. The transcription activation domain (TA), DNA-binding domain, oligomerization domain (OLIGO), and the sterile alpha motif (SAM) are depicted. 1221