July 2015 Assay ID Assay Name Gene COSMIC ID Amino acid change Nucleotide change Wild type allele (VIC label) Mutant allele (FAM label)
|
|
|
- William Craig
- 5 years ago
- Views:
Transcription
1 July 2015 Assay ID Assay Name Gene COSMIC ID Amino acid change Nucleotide change Wild type allele (VIC label) Mutant allele (FAM label) p AHLJ090 AKT1_33765 AKT p.e17k c.49g>a C T 2 AHBKFRM BRAF_473 BRAF 473 p.v600k c.1798_1799gt>aa AC TT 3 AHCTDXU BRAF_475 BRAF 475 p.v600e c.1799_1800tg>aa CA TT 4 AH6R5PH BRAF_476 BRAF 476 p.v600e c.1799t>a A T 5 AHI14QI EGFR_12367 EGFR p.e746_s752>a c.2237_2254del18 AATTAAGAGAAGCAACAT - 6 AHLJ0XN EGFR_12369 EGFR p.l747_t751dellreat c.2240_2254del15 TAAGAGAAGCAACAT - 7 AHZAGZG EGFR_12370 EGFR p.l747_p753>s c.2240_2257del18 TAAGAGAAGCAACATCTC - 8 AH5I7PA EGFR_12377 EGFR p.h773_v774insh c.2319_2320inscac - CAC 9 AH7031Q EGFR_12378 EGFR p.d770_n771insg c.2310_2311insggt - GGT 10 AHRSRSS EGFR_12382 EGFR p.l747_a750>p c.2239_2248ttaagagttaagagaag C 11 AHFA92K EGFR_12383 EGFR p.l747_t751>p c.2239_2251>c TTAAGAGAAGCAA C 12 AH1SD4Y EGFR_12384 EGFR p.e746_s752>v c.2237_2255>t AATTAAGAGAAGCAACATC T 13 AHN1XN0 EGFR_12387 EGFR p.l747_p753>q c.2239_2258>ca TTAAGAGAAGCAACATCTCCCA 14 AHGJ78S EGFR_12419 EGFR p.l747_t751>q c.2238_2252>gca ATTAAGAGAAGCAAC GCA 15 AHS1PY0 EGFR_12422 EGFR p.l747_a750>p c.2238_2248>gc ATTAAGAGAAG GC 16 AHHS6E0 EGFR_12678 EGFR p.e746_t751>a c.2237_2251del15 AATTAAGAGAAGCAA - 17 AHPAV8K EGFR_12728 EGFR p.e746_t751delelreat c.2236_2253del18 GAATTAAGAGAAGCAACA - 18 AHZAGT4 EGFR_13551 EGFR p.e746_t751>i c.2235_2252>aat GGAATTAAGAGAAGCAAC AAT 19 AH4AAC4 EGFR_23571 EGFR p.l747_t751dellreat c.2238_2252del15 ATTAAGAGAAGCAAC - 20 AH0JFQ8 EGFR_ EGFR p.s492r 1476C>A C A 21 AH704SK EGFR_ EGFR p.s492r 1474A>C A C 22 AHMSY3W EGFR_6210 EGFR 6210 p.l747_t751>s c.2240_2251del12 TAAGAGAAGCAA - 23 AHMSY3Z EGFR_6213 EGFR 6213 p.l861q c.2582t>a T A 24 AHCTDP4 EGFR_6220 EGFR 6220 p.e746_s752>d c.2238_2255del18 ATTAAGAGAAGCAACATC - 25 AHLJ0XO EGFR_6223 EGFR 6223 p.e746_a750delelrea c.2235_2249del15 GGAATTAAGAGAAGC - 26 AHRSRSV EGFR_6224 EGFR 6224 p.l858r c.2573t>g T G 27 AH399I0 EGFR_6225 EGFR 6225 p.e746_a750delelrea c.2236_2250del15 GAATTAAGAGAAGCA - 28 AHABH29 EGFR_6239 EGFR 6239 p.g719a c.2156g>c G C 29 AHRSROS EGFR_6240 EGFR 6240 p.t790m c.2369c>t C T 30 AHZAGP4 EGFR_6252 EGFR 6252 p.g719s c.2155g>a G T 31 AH0JEWC EGFR_6253 EGFR 6253 p.g719c c.2155g>t G T 32 AHCTDP3 EGFR_6254 EGFR 6254 p.l747_t751dellreat c.2239_2253del15 TTAAGAGAAGCAACA - 33 AHGJ78R EGFR_6255 EGFR 6255 p.l747_s752dellreats c.2239_2256del18 TTAAGAGAAGCAACATCT - 34 AHUAOD0 ERBB2_14060 ERBB p.l755s c.2264t>c T C 35 AHFBAAA ERBB2_14062 ERBB p.v777l c.2329g>t G T 36 AHX1JLX IDH1_28746 IDH p.r132h c.395g>a C T 37 AHHS6NU IDH1_28747 IDH p.r132c c.394c>t G A 38 AHWSLEU JAK1_ JAK p.r659c c.1975c>t G A 39 AHRSRQX JAK2_12600 JAK p.v617f c.1849g>t G T 40 AHWSKQG KIT_1314 KIT 1314 p.d816v c.2447a>t A T 41 AH1SDY9 KIT_19285 KIT p.d816e c.2448c>g C G 42 AHWSK7D KRAS_ KRAS p.q61r c.182_183aa>gt TT AC
2 Assay ID Assay Name Gene COSMIC ID Amino acid change Nucleotide change Wild type allele (VIC label) Mutant allele (FAM label) 43 AHBKGGY KRAS_19900 KRAS p.a146v 437C>T G A 44 AHWSLAG KRAS_19404 KRAS p.a146t 436G>T C T 45 AHABH8G KRAS_19905 KRAS p.a146p 436G>C C G 46 AHGJ81K KRAS_19940 KRAS p.k117m 351A>C T G 47 AHHS67S KRAS_28519 KRAS p.k117n 351A>T T A 48 AH0JEUD KRAS_516 KRAS 516 p.g12c c.34g>t G T 49 AHI14FA KRAS_517 KRAS 517 p.g12s c.34g>a G A 50 AHMSYXY KRAS_518 KRAS 518 p.g12r c.34g>c C G 51 AHX1IHY KRAS_520 KRAS 520 p.g12v c.35g>t G T 52 AH6R5PI KRAS_521 KRAS 521 p.g12d c.35g>a C T 53 AHPAVDP KRAS_522 KRAS 522 p.g12a c.35g>c G C 54 AHRSRP5 KRAS_527 KRAS 527 p.g13c c.37g>t G T 55 AHUAN2L KRAS_528 KRAS 528 p.g13s c.37g>a G A 56 AHZAGRH KRAS_529 KRAS 529 p.g13r c.37g>c G C 57 AHD2BW0 KRAS_532 KRAS 532 p.g13d c.38g>a G A 58 AHKA2PJ KRAS_549 KRAS 549 p.q61k c.181c>a C A 59 AHQJTKH KRAS_552 KRAS 552 p.q61r c.182a>g A G 60 AH1SC4H KRAS_553 KRAS 553 p.q61l c.182a>t A T 61 AHFA90M KRAS_554 KRAS 554 p.q61h c.183a>c A C 62 AHI14JB KRAS_555 KRAS 555 p.q61h c.183a>t A T 63 AHLJ1OL MLF2_ MLF p.r158w c.472c>t G A 64 AHGJ8IX MPL_18918 MPL p.w515l c.1544g>t G T 65 AHLJ06N NPM1_17559 NPM p.w288fs*12 c.863_864instctg - TCTG 66 AHRSR8C NRAS_12725 NRAS p.q61l c.181_182ca>tt TG AA 67 AHVJMQ0 NRAS_12730 NRAS p.q61k c.180_181ac>ta GT TA 68 AH1SDZH NRAS_563 NRAS 563 p.g12s c.34g>a C T 69 AHI15D6 NRAS_564 NRAS 564 p.g12d c.35g>a C T 70 AHKA3KE NRAS_565 NRAS 565 p.g12a c.35g>c C G 71 AHABH6M NRAS_566 NRAS 566 p.g12v c.35g>t C A 72 AH0JFS9 NRAS_567 NRAS 567 p.g12g c.36t>c A G 73 AHFBAVK NRAS_569 NRAS 569 p.g13r c.37g>c C G 74 AHGJ81S NRAS_570 NRAS 570 p.g13c c.37g>t C A 75 AH704V4 NRAS_571 NRAS 571 p.g13s c.37g>a C T 76 AHABH75 NRAS_573 NRAS 573 p.g13d c.38g>a C T 77 AHS1QR0 NRAS_574 NRAS 574 p.g13v c.38g>t C A 78 AHUAOX8 NRAS_575 NRAS 575 p.g13a c.38g>c C G 79 AHVJM4G NRAS_576 NRAS 576 p.g13g c.39t>c A G 80 AH1SDFJ NRAS_580 NRAS 580 p.q61k c.181c>a G T 81 AHS1QJS NRAS_581 NRAS 581 p.q61e c.181c>g G C 82 AH704ZP NRAS_582 NRAS 582 p.q61p c.182a>c T G 83 AHD2CUE NRAS_583 NRAS 583 p.q61l c.182a>t T A 84 AHS1P6Q NRAS_584 NRAS 584 p.q61r c.182a>g T C 85 AHWSKRT PIK3CA_12591 PIK3CA p.m1043v c.3127a>g A G 86 AHD2BSD PIK3CA_760 PIK3CA 760 p.e542k c.1624 G>A G A
3 Assay ID Assay Name Gene COSMIC ID Amino acid change Nucleotide change Wild type allele (VIC label) Mutant allele (FAM label) 87 AHABHHX PIK3CA_763 PIK3CA 763 p.e545k c.1633 G>A G A 88 AHGJ86A PIK3CA_773 PIK3CA 773 p.m1043i c.3129g>t G T 89 AHPAVCD PIK3CA_775 PIK3CA 775 p.h1047r c.3140 A>G A G 90 AHLJ0TP PIK3CA_776 PIK3CA 776 p.h1047l c.3140 A>T A T 91 AH0JFSV PIK3R1_ PIK3R p.k567e c.1699a>g A G 92 AH704ZH TP53_10656 TP p.r248w c.742c>t G A 93 AHWSLEX TP53_10660 TP p.r273h c.818g>a C T 94 AHQJUJT TP53_10662 TP p.r248q c.743g>a C T 95 AHRSSQL TP53_10704 TP p.r282w c.844c>t G A 96 AHQJTS6 TP53_10779 TP p.r273l c.818g>t C A 97 AHGJ8JY TP53_10817 TP p.r249s c.747g>t C A 98 AHQJUE3 TP53_11073 TP p.r342* c.1024c>t G A 99 AHKA22M TP53_11081 TP p.g245c c.733g>t C A 100 AHUAOXR TP53_43559 TP p.v173l c.517g>t C A 101 AHRSSDK TP53_44908 TP p.r248q c.743_744gg>aa CC TT 102 AH1SDG3 TP53_6545 TP p.r248w c.741_742cc>tt GG AA 103 AHRSR2W TP53_6549 TP p.r248l c.743g>t C A 104 AHABHMO TP53_6932 TP p.g245s c.733g>a C T For Research Use Only. Not for use in diagnostic procedures Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. TaqMan is a registered trademark of Roche Molecular
4
5
6 Systems, Inc., used under permission and license.
Whole Exome Sequenced Characteristics
Supplementary Tables Supplementary Table 1: Patient characteristics of 45 whole exome sequenced HNSCC tumors Whole Exome Sequenced Characteristics Tumors (n=45) Age, years Median (range) 61.0 (19-90) Sex,
Supplementary Table 2. Identified causative mutations and/or mutation candidates.
Supplementary Table 2. Identified causative mutations and/or mutation candidates. Nonsense mutations base change aa change Average depth Result of next generation in 432 patient Hereditary form of the
The Personalized Cancer Medicine Initiative at Vanderbilt
The Personalized Cancer Medicine Initiative at Vanderbilt October 26, 2009 William Pao, MD, PhD Assistant Director, Personalized Cancer Medicine Vanderbilt-Ingram Cancer Center Cancer in the United States,
Supplementary Figure 1
Supplementary Figure 1 A B HEC1A PTEN +/+ HEC1A PTEN -/- 16 HEC1A PTEN -/- 22 PTEN RAD51 % Cells with RAD51 foci 40 -IR +IR 30 20 10 * *! TUBULIN 0 HEC1A PTEN+/+ HEC1A PTEN-/- 16 HEC1A PTEN-/- 22 C D 1.0
Supplementary Table 1. PIK3CA mutation in colorectal cancer
Liao X et al. PIK3CA Mutation in Colorectal Cancer. Page 1 Supplementary Table 1. PIK3CA mutation in colorectal cancer Exon Domain Nucleotide change* Amino acid change* cases 9 Helical c.1621t>a p.e541t
Recent advances in the molecular pathology of lung cancer: role of EGFR and KRAS mutation testing in treatment selection
ASIP 2009 USCAP Companion Meeting Molecular Pathology for the Practicing Pathologist Recent advances in the molecular pathology of lung cancer: role of EGFR and KRAS mutation testing in treatment selection
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Generation of cetuximab-resistant cells and analysis of singlecell clones. Cetuximab-sensitive cells (LIM1215 and OXCO-2) were chronically treated with cetuximab
Supplementary Online Content
Supplementary Online Content Pearlman R, Frankel WL, Swanson B, et al. Prevalence and spectrum of germline cancer susceptibility gene mutations among patients with early-onset colorectal cancer. JAMA Oncol.
Belgian study into von Willebrand Disease (B-Will): First results
Belgian study into von Willebrand Disease (B-Will): First results Inge Vangenechten VWD Research Unit, Antwerp University Hospital Supported by CSL Behring Chair in von Willebrand Disease, Antwerp University
Clinical presentation. Duration (Month)
Supplementary information, Table S1A: Clinical information for 125 PAs. No. Subtype Gender (M/F) Age at diagnosis (year) Clinical presentation Duration (Month) Maximal adenoma diameter(cm) Tumor invasion*
Spectrum and Classification of ATP7B Variants in a Large Cohort of Chinese Patients with Wilson s Disease Guides Genetic Diagnosis
Ivyspring International Publisher 638 Theranostics Research Paper 2016; 6(5): 638-649. doi: 10.7150/thno.14596 Spectrum and Classification of ATP7B Variants in a Large Cohort of Chinese Patients with Wilson
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
GALAFOLD (migalastat) capsules, for oral use Initial U.S. Approval: 2018
HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include all the information needed to use GALAFOLD safely and effectively. See full prescribing information for GALAFOLD. GALAFOLD (migalastat)
Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
This is an Open Access document downloaded from ORCA, Cardiff University's institutional repository:
This is an Open Access document downloaded from ORCA, Cardiff University's institutional repository: http://orca.cf.ac.uk/95828/ This is the author s version of a work that was submitted to / accepted
GALAFOLD (migalastat) capsules, for oral use Initial U.S. Approval: 2018
HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include all the information needed to use GALAFOLD safely and effectively. See full prescribing information for GALAFOLD. GALAFOLD (migalastat)
Next generation sequencing based detection of EGFR, KRAS, BRAF, NRAS, PIK3CA, Her 2 and TP53 mutations in patients with non small cell lung cancer
MOLECULAR MEDICINE REPORTS 18: 2191-2197, 2018 Next generation sequencing based detection of EGFR, KRAS, BRAF, NRAS, PIK3CA, Her 2 and TP53 mutations in patients with non small cell lung cancer CHANGWEN
Empowering STAT DNA Testing for Molecular Oncology Applications Using A Fully Automated
Empowering STAT DNA Testing for Molecular Oncology Applications Using A Fully Automated Platform Gregory J. Tsongalis, PhD, HCLD Professor of Pathology Director, Clinical Genomics and Advanced Technology
Belgian-Czech cooperation in the Brno-VWD study
Inge Vangenechten I Vangenechten, P Smejkal, O Zapletal, F Bouddount, J Zavrelova, J Blatny, M Penka, JJ Michiels, A Gadisseur. Aim of the study Characterisation of VWD in South Moravia (Czech Republic)
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each mutated gene and the panel of 125 cancer-driving genes
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Laboratory, Division of Medical Sciences, National Cancer Centre, Singapore
Supplementary Information Exome sequencing of liver fluke-associated cholangiocarcinoma Choon Kiat Ong 1,2*, Chutima Subimerb 1,2,3*, Chawalit Pairojkul 3, Sopit Wongkham 3, Ioana Cutcutache 4, Willie
Familial exudative vitreoretinopathy (FEVR) is an inheritable
Genetics Spectrum of Variants in 389 Chinese Probands With Familial Exudative Vitreoretinopathy Jia-Kai Li, 1 Yian Li, 1 Xiang Zhang, 1 Chun-Li Chen, 2 Yu-Qing Rao, 1 Ping Fei, 1 Qi Zhang, 1 Peiquan Zhao,
Genomic Profiling on an Unselected Solid Tumor Population Reveals a Highly Mutated Wnt/β-Catenin Pathway Associated with Oncogenic EGFR Mutations
Article Genomic Profiling on an Unselected Solid Tumor Population Reveals a Highly Mutated Wnt/β-Catenin Pathway Associated with Oncogenic EGFR Mutations Jingrui Jiang 1, *, Alexei Protopopov 2, Ruobai
How has Molecular Diagnostics changed my practice? Pulmonary Pathology
How has Molecular Diagnostics changed my practice? Pulmonary Pathology Lynette M. Sholl, M.D. Associate Pathologist Brigham and Women s Hospital Associate Director, Center for Advanced Molecular Diagnostics
Genetic Alteration Panels
TM Genetic Alteration Panels GENETIC ALTERATION PANELS Table of Contents AKT Genetic Alteration Panel (ATCC No. TCP-1029 )...1 BRAF Genetic Alteration Panel (ATCC No. TCP-1032 )...5 EGFR Genetic Alteration
c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester
Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester dsg6@le.ac.uk CFDNA/CTDNA Circulating-free AS A LIQUID DNA BIOPSY (cfdna) Tumour Biopsy Liquid Biopsy
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
Supporting Information
Supporting Information Rampal et al. 10.1073/pnas.1407792111 Fig. S1. Genetic events in leukemic transformation of chronic-phase MPNs. (A) Survival of post-mpn AML patients according to mutational status
Exons from 137 genes were targeted for hybrid selection and massively parallel sequencing.
SUPPLEMENTARY TABLES Supplementary Table 1. Targeted Genes ABL1 ABL2 AKT1 AKT2 AKT3 ALK APC ATM AURKA BCL2 BRAF BRCA1 BRCA2 CCND1 CCNE1 CDC73 CDH1 CDK4 CDK6 CDK8 CDKN1A CDKN2A CEBPA CHEK1 CHEK2 CREBBP
Table S4. List of point mutations found by WES in SMZL patients. * DNA extracted from frozen tissue *Method of detection: Variant detected using
Table S4. List of point mutations found by WES in SMZL patients. * DNA extracted from frozen tissue *Method of detection: Variant detected using RAMSES (R) or CNAG method (C) or both (R/C) **Validation
Nature Genetics: doi: /ng Supplementary Figure 1. Alternative splicing events in the 5K panel.
Supplementary Figure 1 Alternative splicing events in the 5K panel. The majority of cryptic splicing occurred by creation of an AG or GT (Type I). While some other mutations increased the usage of a nearby
Accel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
MUTATION TEST CE IVD. ctnras-braf FEATURES
ctnras-braf CE IVD TECHNICAL SHEET IDYLLA ctnras-braf MUTATION TEST The Idylla ctnras-braf Mutation Test, performed on the Biocartis Idylla System, is an in vitro diagnostic test for the qualitative detection
Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation
SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.
DNA Analysis in Glycogen storage disease
DNA Analysis in Glycogen storage disease Nick Beauchamp PhD Sheffield, Sheffield Children s NHS Foundation Trust 14th October 2010 Glycogen Synthase Type 0 Glycogen Synthesis and Breakdown Type IV UDPGlucose
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP Frequency Domain Mammals a 3 S/P b Mammals a 3 S/P b
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
THE FUTURE OF PAP SMEAR SCREENING IN THE ERA OF MOLECULAR DIAGNOSTICS AND VACCINES MARK H STOLER, MD ASIP COMPANION MEETING USACP 2009
Stoler, MH THE FUTURE OF PAP SMEAR SCREENING IN THE ERA OF MOLECULAR DIAGNOSTICS AND VACCINES MARK H STOLER, MD ASIP COMPANION MEETING USACP 2009 TAKE HOME BULLET POINTS: 1. MORPHOLOGY BASED SCREENING
THE FUTURE OF PAP SMEAR SCREENING IN THE ERA OF MOLECULAR DIAGNOSTICS AND VACCINES MARK H STOLER, MD ASIP COMPANION MEETING USACP 2009
Stoler, MH THE FUTURE OF PAP SMEAR SCREENING IN THE ERA OF MOLECULAR DIAGNOSTICS AND VACCINES MARK H STOLER, MD ASIP COMPANION MEETING USACP 2009 TAKE HOME BULLET POINTS: 1. MORPHOLOGY BASED SCREENING
The Role of Next Generation Sequencing in Solid Tumor Mutation Testing
The Role of Next Generation Sequencing in Solid Tumor Mutation Testing Allie H. Grossmann MD PhD Department of Pathology, University of Utah Division of Anatomic Pathology & Oncology, ARUP Laboratories
Distinct molecular abnormalities underlie unique clinical features of essential thrombocythemia. in children
Distinct molecular abnormalities underlie unique clinical features of essential thrombocythemia in children Supplementary methods Patients and diagnostic criteria The study was approved by the hospital-based
Supplementary information to:
Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
Intron p Hybrid with p.leu245val p. Gly336Cys. p.leu62phe p. Ala137Val p. Asn152Thr hybrid with p.leu245val p.
RHD negative, i.e. null Phenotype Allele name Nucleotide change Exon Predicted amino acid change D RHD*01N.01 RHD deletion 1-10 p.0 Allele name detail Comments D RHD*08N.01 RHD*Pseudogene RHD* Ψ 37- bp
Circulating tumor DNA detection in advanced non-small cell lung cancer patients
Original Article Circulating tumor DNA detection in advanced non-small cell lung cancer patients Zhi-Wei Guo 1 *, Min Li 1 *, Ji-Qiang Li 2, Chun-Lian Zhou 1, Xiang-Ming Zhai 1, Ming Li 1, Ying-Song Wu
Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes
QIAGEN (Suzhou) Translational Medicine Co., Ltd. Bringing Biomarkers and CDx to Precision Medicine
QIAGEN (Suzhou) Translational Medicine Co., Ltd. Bringing Biomarkers and CDx to Precision Medicine 1 CONTENT Company Overview Our Capabilities & Expertise A Total Solution Provider for Precision Medicine
Summary of Results CARRIER STATUS DNA INSIGHT. Result: Carrier, Heterozygote. Protected Health Information. Propionic Acidemia
Test Results Reviewed & Approved by: Laboratory Director, Nilesh Dharajiya,.D. SAPLE REPORT CARRIER STATUS DNA INSIGHT PERSONAL DETAILS DOB Jan 1, 19XX ETHNICITY Asian ORDERING HEALTHCARE PROFESSIONAL
Long-term exposure to Myozyme results in a decrease of anti-drug antibodies in lateonset Pompe disease patients
Long-term exposure to Myozyme results in a decrease of anti-drug antibodies in lateonset Pompe disease patients Elisa Masat 1, Pascal Laforêt 1,2, Marie De Antonio 3, Guillaume Corre 4, Barbara Perniconi
SUPPLEMENTARY INFORMATION
Somatic ERCC2 Mutations Are Associated with a Distinct Genomic Signature in Urothelial Tumors Jaegil Kim, Kent W Mouw, Paz Polak, Lior Z Braunstein, Atanas Kamburov, Grace Tiao, David J Kwiatkowski, Jonathan
Role of the pathologist in the diagnosis and mutational analysis of lung cancer Professor J R Gosney
Role of the pathologist in the diagnosis and mutational analysis of lung cancer Professor J R Gosney Consultant Thoracic Pathologist Royal Liverpool University Hospital Disclosure JRG is a paid advisor
Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM
Supplementary Data Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM cohort. Supplementary Table e2. Specificity, sensitivity and unadjusted ORs for glioma in participants
Nature Genetics: doi: /ng Supplementary Figure 1. TNFAIP3-associated haplotypes in family 1.
Supplementary Figure 1 TNFAIP3-associated haplotypes in family 1. The p.leu227* mutation (shown as a star) arose de novo in the first affected member of the family (P1). Red haplotypes carry the TNFAIP3
Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL
Round Table: Tissue Biopsy versus Liquid Biopsy César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Introduction Classic Advantages of liquid biopsy collection over standard biopsy Standard biopsy
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
Total pathogenic allele frequency of autosomal recessive MEFV mutations causing familial Mediterranean fever in Tunisia and Morocco
CHAPTER 7 Total pathogenic allele frequency of autosomal recessive MEFV mutations causing familial Mediterranean fever in Tunisia and Morocco Teeuw ME/ Kelmemi W, Jonker MA, Kharrat M, Lariani I, Laarabi
Names for H (ISBT 018) Blood Group Alleles
Names for H (ISBT 018) Blood Group Alleles General description: The H blood group system consists of one antigen, H, that is carried on glycolipids and glycoproteins on the RBC membrane, where it is synthesised
Integration Solutions
Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide
Names for ABO (ISBT 001) Blood Group Alleles
Names for ABO (ISBT 001) blood group alleles v1.1 1102 Names for ABO (ISBT 001) Blood Group Alleles General description: The ABO system was discovered as in 1900 and is considered the first and clinically
Liquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
J. Callahan, Pabilonia, K.L.. Presented by Nardy Robben. The world leader in serving science
The effect of pooling 5 or 11 Tracheal/Oropharyngeal (TR/OP) swabs on the performance of a USDA Licensed reverse transcriptase, real-time PCR (rrt-pcr) test for avian influenza virus J. Callahan, Pabilonia,
MICROSCOPY PREDICTIVE PROFILING
Immunomodulatory therapy in NSCLC: a year into clinical practice Professor J R Gosney Consultant Thoracic Pathologist Royal Liverpool University Hospital Disclosure JRG is a paid advisor to and speaker
Targeted sequencing of refractory myeloma reveals a high incidence of mutations in CRBN and Ras pathway genes
Targeted sequencing of refractory myeloma reveals a high incidence of mutations in CRBN and Ras pathway genes KM Kortüm 1,8 *, EK Mai 3,4 *, NH Hanafiah 3 *, CX Shi 1, YX Zhu 1, L Bruins 1, S Barrio 1,
Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Supplementary Information. Exome sequencing identifies distinct mutational patterns in liver fluke related and noninfection-related
Supplementary Information Exome sequencing identifies distinct mutational patterns in liver fluke related and noninfection-related bile duct cancers Waraporn Chan-on 1,2,3*, Maarja-Liisa Nairismägi 1,2*,
Tumor monitoring in a drop of blood.
Tumor monitoring in a drop of blood. PRECISION MEDICINE STARTS WITH A FINGER STICK. circulogene.com Circulogene Theranostics solution to liquid biopsy. Novel cell-free DNA enrichment method for high quantity
Obrien et al., Imatinib Compared with Interferon and Low-Dose Cytarabine for Newly Diagnosed Chronic-Phase Chronic Myeloid Leukemia.
Clinical Cancer Genotyping Long Phi Le, MD/PhD Department of Pathology Diagnostic Molecular Pathology Laboratory Translational Research Laboratory Massachusetts General Hospital Boston, MA lple@partners.org
The role of liquid biopsies in the treatment of advanced colon cancer
The role of liquid biopsies in the treatment of advanced colon cancer Clara Montagut Hospital del Mar, Barcelona ESMO CRC Preceptorship Valencia, May 12, 2017 1 ESMO consensus guidelines for the management
Supplemental material Mutant DNMT3A: A Marker of Poor Prognosis in Acute Myeloid Leukemia Ana Flávia Tibúrcio Ribeiro, Marta Pratcorona, Claudia
Supplemental material Mutant DNMT3A: A Marker of Poor Prognosis in Acute Myeloid Leukemia Ana Flávia Tibúrcio Ribeiro, Marta Pratcorona, Claudia Erpelinck-Verschueren, Veronika Rockova, Mathijs Sanders,
The College of American Pathologists (CAP) offers these
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Thyroid Carcinoma Simon Chiosea, MD; Sylvia L. Asa, MD; Michael A. Berman, MD; Sally E. Carty, MD; Louanne Currence,
Supplementary Information
Supplementary Information JAK1 truncating mutations in gynecologic cancer define new role of cancerassociated protein tyrosine kinase aberrations Yuan Ren, Yonghong Zhang, Richard Z. Liu, David A. Fenstermacher,
Research Article Mutation Analysis of the Common Deafness Genes in Patients with Nonsyndromic Hearing Loss in Linyi by SNPscan Assay
BioMed Research International Volume 2016, Article ID 1302914, 7 pages http://dx.doi.org/10.1155/2016/1302914 Research Article Mutation Analysis of the Common Deafness Genes in Patients with Nonsyndromic
SUPPLEMENTAL FIGURE 1
SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.
(Case 5 A ) c g>a Exon 24 splice acceptor Splicing defect - Splicing defect
Supplementary table S1. Pathogenic potential of identified DYNC2H1 mutations Family Nucleotide Change Mutation GERP PhyloP SIFT PolyPhen-2 Mutation Taster JATD-1 c. 90443A>G p.d3015g 6.17 5.3 Tolerated
Supplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
Molecular Genetic Testing for the Diagnosis of Haematological Malignancies
Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Dr Anthony Bench Haemto-Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge UK Molecular
Spectrum of somatically acquired mutations identified by combining WES and genome-wide DNA array analysis in the discovery cohort of 30 JMML cases.
Supplementary Figure 1 Spectrum of somatically acquired mutations identified by combining WES and genome-wide DNA array analysis in the discovery cohort of 30 JMML cases. A total of 85 somatically acquired
Supplemental information
Supplemental information Frequent reconstitution of IDH2 mutant clonal multilineage hematopoiesis following chemotherapy for acute myeloid leukemia Daniel H. Wiseman, Emma L. Williams, Deepti P. Wilks,
Liquid biopsies to track clonal evolution and resistance to EGFR inhibition in mcrc
Liquid biopsies to track clonal evolution and resistance to EGFR inhibition in mcrc Alberto Bardelli Candiolo Cancer Center IRCCs University of Torino - Medical School Disclosures Horizon discovery Biocartis
State of the Art in Tumor Profiling
State of the Art in Tumor Profiling Dora Dias-Santagata, PhD, FACMG ddiassantagata@partners.org Translational Research Laboratory Massachusetts General Hospital Harvard Medical School Boston, MA Disclosures
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
Mutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark
Clin Genet 2016: 90: 247 251 Printed in Singapore. All rights reserved Short Report 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12692 Mutational and
KRAS, NRAS and BRAF mutations in Greek and Romanian patients with colorectal cancer: a cohort study
Research KRAS, NRAS and BRAF mutations in Greek and Romanian patients with colorectal cancer: a cohort study Serban Negru, 1 Eirini Papadopoulou, 2 Angela Apessos, 2 Dana Lucia Stanculeanu, 3 Eliade Ciuleanu,
Frequency of mosaicism points towards mutation prone early cleavage cell divisions.
Frequency of mosaicism points towards mutation prone early cleavage cell divisions. Chad Harland, Wouter Coppieters, Latifa Karim, Carole Charlier, Michel Georges Germ-line de novo mutations Definition:
SUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha