Supplementary Information. Exome sequencing identifies distinct mutational patterns in liver fluke related and noninfection-related

Transcription

1 Supplementary Information Exome sequencing identifies distinct mutational patterns in liver fluke related and noninfection-related bile duct cancers Waraporn Chan-on 1,2,3*, Maarja-Liisa Nairismägi 1,2*, Choon Kiat Ong 1,2*, Weng Khong Lim 1,2*, Simona Dima 4, Chawalit Pairojkul 3, Kiat Hon Lim 5, John R. McPherson 6, Ioana Cutcutache 6, Hong Lee Heng 1,2, London Ooi 7, Alexander Chung 7, Pierce Chow 7, Peng Chung Cheow 7, Ser Yee Lee 7, Su Pin Choo 8, Iain Bee Huat Tan 8, Dan Duda 9, Anca Nastase 4, Swe Swe Myint 1,2, Bernice Huimin Wong 1,2, Anna Gan 1,2, Vikneswari Rajasegaran 1,2, Cedric Chuan Young Ng 1,2, Sanjanaa Nagarajan 1,2, Apinya Jusakul 1,2, Shenli Zhang 2, Priya Vohra 2, Willie Yu 1,2,10, DaChuan Huang 1,2, Paiboon Sithithaworn 3, Puangrat Yongvanit 3, Sopit Wongkham 3, Narong Khuntikeo 3, Vajaraphongsa Bhudhisawasdi 3, Irinel Popescu 4,#, Steven G. Rozen 6,#, Patrick Tan 2,11,12,#, Bin Tean Teh 1,2,12,# 1 NCCS-VARI Translational Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore, 11 Hospital Drive, , Singapore 2 Division of Cancer and Stem Cell Biology, Duke-NUS Graduate Medical School, 8 College Road, , Singapore 3 Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002, Thailand 4 Center of Digestive Diseases and Liver Transplantation, Fundeni Clinical Institute, Bucharest, , Romania 5 Department of Pathology, Singapore General Hospital, 20 College Road, , Singapore 6 Division of Neuroscience and Behavioral Disorders, Duke-NUS Graduate Medical School, 8 College Road, , Singapore 7 Department of General Surgery, Singapore General Hospital, 20 College Road, , Singapore 8 Department of Medical Oncology, National Cancer Centre Singapore, 11 Hospital Drive, , Singapore 9 Edwin L. Steele Laboratory for Tumor Biology, Department of Radiation Oncology, Massachusetts General Hospital and Harvard Medical School, MA 02114, Boston, USA 10 National University of Singapore Graduate School for Integrative Sciences and Engineering, 28 Medical Drive, , Singapore 11 Genome Institute of Singapore, 60 Biopolis Street, Genome, , Singapore 12 Cancer Science Institute of Singapore, National University of Singapore, 28 Medical Drive, , Singapore *These authors contributed equally to the work #Co-corresponding authors Correspondence should be addressed to B.T.T. (teh.bin.tean@singhealth.com.sg), P.T. (gmstanp@duke-nus.edu.sg), S.G.R. (steve.rozen@duke-nus.edu.sg) and I.P. (irinel.popescu@icfundeni.ro). 1

2 Index of all supplementary tables and figures Supplementary Tables Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 Supplementary Table 5 Supplementary Table 6 Supplementary Table 7 Supplementary Table 8 Supplementary Table 9 Supplementary Table 10 Supplementary Table 11 Supplementary Table 12 Supplementary Table 13 Supplementary Table 14 Supplementary Table 15 Supplementary Table 16 Supplementary Table 17 Supplementary Table 18 Clinicopathological characteristics of 101 non-o. viverriniassociated CCA cases in the discovery and the prevalence set Summary of sequencing data obtained from 10 Asian and 5 European non-o. viverrini-associated CCA exomes A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverrini-associated samples in the discovery set Recurrently mutated genes identified in 15 samples in discovery set Clinicopathological characteristics of 108 O. viverrini-associated CCA cases in the prevalence set Serum IgG antibody against O. viverrini crude antigen Summary of mutations in KRAS, IDH1 and IDH2 identified using ultra-deep amplicon sequencing compared to Sanger sequencing Mutation frequencies of commonly mutated genes in Asian CCAs stratified by anatomical subtypes Mutation frequencies of commonly mutated genes in Asian and European non-o. viverrini-associated CCAs Frequently mutated genes identified in 101 non-o. viverriniassociated CCAs Frequently mutated genes identified in 108 O. viverriniassociated CCAs Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in non-o. viverrini-associated CCAs in discovery (N = 15) and prevalence set (N = 86) Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs Sequencing primers for the evaluation of BAP1, IDH1 and IDH2 mutations by Sanger sequencing A list of hotspots in KRAS, IDH1 and IDH2 sequenced by ultradeep amplicon sequencing Sequencing primers for the evaluation of KRAS, IDH1 and IDH2 mutations by ultra-deep amplicon sequencing A list of sirnas A list of antibodies 2

3 Supplementary Figures Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Illustration of mutation types in 15 non-o. viverrini-associated CCA exomes Mutation spectra of 15 non-o. viverrini-associated CCAs compared to 8 O. viverrini-associated CCAs Analysis of copy number alterations in 15 discovery samples Enhancement in cell proliferation rates in ARID1A- and BAP1- silenced cells using multiple individual sirnas Quantification of BAP1 transcript levels in BAP1 over-expressing cells IDH1/2 mutations mediate hypermethylator phenotype in CCA tumors 3

4 Supplementary Table 1. Clinicopathological characteristics of 101 non-o. viverrini-associated CCA cases in the discovery and the prevalence set No Sample ID Sex Age Origin Race Anatomical subtype anti-o. viverrini IgG F 77 Singapore Chinese Extrahepatic N/A F 73 Singapore Chinese Intrahepatic N/A F 69 Singapore Chinese Intrahepatic Negative F 61 Singapore Chinese Intrahepatic N/A F 67 Singapore Chinese Intrahepatic N/A F 51 Singapore N/A Intrahepatic N/A M 61 Singapore Chinese Intrahepatic N/A M 51 Singapore N/A Intrahepatic N/A M 55 Singapore Chinese Intrahepatic N/A M 49 Singapore Chinese Intrahepatic N/A M 38 Singapore Chinese Intrahepatic Negative F 52 Singapore Chinese Intrahepatic N/A F 67 Singapore Chinese Intrahepatic N/A F 55 Singapore N/A Intrahepatic N/A F 26 Singapore Chinese Intrahepatic N/A M 60 Singapore Chinese Intrahepatic N/A F 60 Singapore Chinese Intrahepatic N/A F 78 Singapore Chinese Intrahepatic N/A F 61 Singapore Chinese Intrahepatic N/A M 55 Singapore N/A Intrahepatic Positive M 32 Singapore Indian Intrahepatic N/A T M 51 Singapore N/A Intrahepatic Negative M 53 Singapore Chinese Intrahepatic N/A T M 57 Singapore Malay Intrahepatic N/A F 39 Singapore N/A Intrahepatic N/A M 63 Singapore N/A Intrahepatic Negative F 60 Singapore Chinese Intrahepatic N/A M 74 Singapore Chinese Intrahepatic N/A F 74 Singapore N/A Intrahepatic N/A 30 Z321 F 59 Singapore Chinese Intrahepatic N/A 31 Z508 M 63 Singapore Chinese Intrahepatic N/A 32 Z639 M 56 Singapore Chinese Intrahepatic N/A 33 Z2403T F 77 Singapore Chinese Intrahepatic N/A 34 Z2778 M 35 Singapore N/A Intrahepatic Negative 4

5 Supplementary Table 1 (continued). Clinicopathological characteristics of 101 non-o. viverrini-associated CCA cases in the discovery and the prevalence set No Sample ID Sex Age Origin Race Anatomical subtype anti-o. viverrini IgG 35 Z2807T F 76 Singapore Chinese Intrahepatic N/A 36 Z3534T F 61 Singapore Chinese Intrahepatic Positive 37 Z3722 M 75 Singapore Chinese Intrahepatic N/A M 42 Singapore Chinese Extrahepatic N/A M 68 Singapore Chinese Extrahepatic N/A M 47 Singapore Chinese Extrahepatic N/A M 54 Singapore Chinese Extrahepatic N/A M 55 Singapore Chinese Extrahepatic N/A F 45 Singapore Chinese Extrahepatic Negative 44 Z397 M 72 Singapore Chinese Extrahepatic N/A 45 Z1326 M 62 Singapore Chinese Extrahepatic Negative 46 Z2526 F 68 Singapore Chinese Extrahepatic N/A 47 Z2911 F 59 Singapore Chinese Extrahepatic N/A 48 Z3561 F 46 Singapore N/A Extrahepatic N/A 49 Z3585 F 71 Singapore Malay Extrahepatic N/A 50 Z2293 F 70 Singapore Burmese Extrahepatic N/A M 65 Singapore Chinese Extrahepatic Negative M 64 Romania Caucasian Extrahepatic Negative M 68 Romania Caucasian Extrahepatic Negative M 70 Romania Caucasian Extrahepatic Negative F 49 Romania Caucasian Extrahepatic Negative F 69 Romania Caucasian Intrahepatic Negative M 47 Romania Caucasian Extrahepatic Negative M 40 Romania Caucasian Extrahepatic N/A M 49 Romania Caucasian Extrahepatic Negative F 54 Romania Caucasian Extrahepatic Positive M 31 Romania Caucasian Extrahepatic Negative M 44 Romania Caucasian Extrahepatic Positive F 69 Romania Caucasian Extrahepatic Negative M 61 Romania Caucasian Extrahepatic Negative M 58 Romania Caucasian Extrahepatic Negative M 72 Romania Caucasian Extrahepatic Negative M 46 Romania Caucasian Extrahepatic Positive 5

6 Supplementary Table 1 (continued). Clinicopathological characteristics of 101 non-o. viverrini-associated CCA cases in the discovery and the prevalence set No Sample ID Sex Age Origin Race Anatomical subtype anti-o. viverrini IgG M 30 Romania Caucasian Extrahepatic N/A M 51 Romania Caucasian Extrahepatic Negative F 53 Romania Caucasian Extrahepatic Positive M 59 Romania Caucasian Extrahepatic Negative F 65 Romania Caucasian Extrahepatic Negative M 61 Romania Caucasian Extrahepatic Positive F 66 Romania Caucasian Extrahepatic Negative F 58 Romania Caucasian Extrahepatic Positive F 61 Romania Caucasian Extrahepatic Negative F 58 Romania Caucasian Extrahepatic Negative M 70 Romania Caucasian Extrahepatic Negative M 68 Romania Caucasian Extrahepatic Negative F 63 Romania Caucasian Extrahepatic N/A G M 56 Romania Caucasian Extrahepatic N/A I F 50 Romania Caucasian Intrahepatic N/A P F 45 Romania Caucasian Intrahepatic Negative C F 62 Romania Caucasian Intrahepatic Negative M 45 Romania Caucasian Intrahepatic Negative M 64 Romania Caucasian Intrahepatic Negative M 65 Romania Caucasian Intrahepatic Negative F 61 Romania Caucasian Intrahepatic N/A F 49 Romania Caucasian Intrahepatic Negative F 44 Romania Caucasian Intrahepatic N/A M 50 Romania Caucasian Intrahepatic Negative M 62 Romania Caucasian Intrahepatic Negative M 69 Romania Caucasian Intrahepatic Negative F 75 Romania Caucasian Intrahepatic Positive F 66 Romania Caucasian Intrahepatic Negative F 52 Romania Caucasian Intrahepatic Negative M 66 Romania Caucasian Intrahepatic Negative M 72 Romania Caucasian Intrahepatic Negative M 49 Romania Caucasian Intrahepatic Negative M 78 Romania Caucasian Intrahepatic Negative F 75 Romania Caucasian Intrahepatic Negative Samples in the discovery set are highlighted. N/A., Not available. 6

7 Supplementary Table 2. Summary of sequencing data obtained from 10 Asian and 5 European non-o. viverrini-associated CCA exomes Pair Sample Sample Type Origin Bases in Target Region* SureSelect Capturing Kit Reads Mapped to Target Region** Ave. Depth Per Targeted Base Targeted Bases with Depth at Least 1X (%) Targeted Bases with Depth at Least 20X (%) Validated somatic mutations N Normal Singapore 37,792,881 V1 49,026, T Tumor Singapore 37,792,881 V1 53,913, N Normal Singapore 37,792,881 V1 48,913, T Tumor Singapore 37,792,881 V1 47,228, N Normal Singapore 37,792,881 V1 127,502, T Tumor Singapore 37,792,881 V1 42,091, N Normal Singapore 37,792,881 V1 55,375, T Tumor Singapore 37,792,881 V1 60,491, N Normal Singapore 37,792,881 V1 53,653, T Tumor Singapore 37,792,881 V1 59,293, N Normal Singapore 37,792,881 V1 58,741, T Tumor Singapore 37,792,881 V1 60,170, N Normal Singapore 37,792,881 V4+UTR 45,643, T Tumor Singapore 37,792,881 V4+UTR 42,266, N Normal Singapore 37,792,881 V4+UTR 47,268, T Tumor Singapore 37,792,881 V4+UTR 42,924, N Normal Singapore 37,792,881 V4+UTR 49,944, T Tumor Singapore 37,792,881 V4+UTR 49,684, N Normal Singapore 37,792,881 V4+UTR 126,824, T Tumor Singapore 37,792,881 V4+UTR 119,615,

8 Supplementary Table 2 (continued). Summary of sequencing data obtained from 10 Asian and 5 European non-o. viverriniassociated CCA exomes Pair Sample Sample Type Origin Bases in Target Region* SureSelect Capturing Kit Reads Mapped to Target Region** Ave. Depth Per Targeted Base Targeted Bases with Depth at Least 1X (%) Targeted Bases with Depth at Least 20X (%) Validated somatic mutations 0715N Normal Romania 37,792,881 V1 51,976, T Tumor Romania 37,792,881 V1 52,105, N Normal Romania 37,792,881 V1 53,318, T Tumor Romania 37,792,881 V1 52,342, N Normal Romania 37,792,881 V1 55,348, T Tumor Romania 37,792,881 V1 52,291, N Normal Romania 37,792,881 V1 51,923, T Tumor Romania 37,792,881 V1 50,976, N Normal Romania 37,792,881 V4+UTR 59,435, T Tumor Romania 37,792,881 V4+UTR 54,651, Average 37,792,881 59,164, *Sequencing data of all non-o. viverrini-associated CCA samples was mapped to the same target reference (37,792,881) regardless of exome capturing version. ** Based on the NCBI human reference genome GRCh37 (hg19) 8

9 Supplementary Table 3. A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverrini-associated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 1 ACCN CCDS g.chr7: G>A c.389 G>A p.g130d Missense 2 ACVR2A CCDS g.chr2: insa c.1303 insa fs Indel 3 ADAMTS CCDS g.chr9: A>G c.664 A>G p.i222v Missense 4 AGPAT CCDS g.chr8: G>A c.382 G>A p.d128n Missense 5 AGPAT CCDS g.chr8: A>G c.1220 A>G p.k407r Missense 6 AGTPBP CCDS g.chr9: C>G c.2326 G>C p.v776l Missense 7 ALDH1L CCDS g.chr3: C>T c.769 G>A p.e257k Missense 8 ANKAR CCDS g.chr2: G>T c.517 G>T p.e173x Nonsense 9 ANO CCDS g.chr12: G>A c.1913 G>A p.r638k Missense 10 AP1AR 1202 CCDS g.chr4: G>T c.395 G>T p.r132i Missense 11 APOB CCDS g.chr2: G>T c.9881 C>A p.s3294x Nonsense 12 ARHGAP CCDS g.chr10: T>C c.266 A>G p.n89s Missense 13 ARHGAP CCDS g.chr2: T>C c.533 T>C p.l178s Missense 14 ARHGEF CCDS g.chr2: G>A c.1949 G>A p.r650h Missense 15 ARID1A 3001 CCDS285.1 g.chr1: G>T c.2791 G>T p.g931x Nonsense 16 ARID1A CCDS285.1 g.chr1: insa c.3217 insa fs Indel 17 ARID1A CCDS285.1 g.chr1: G>T IVS8+1 G>T Splice site Splice site 18 ARID1A CCDS285.1 g.chr1: delc c.1558 delc fs Indel 19 ASAP1 715 CCDS g.chr8: C>G c.1483 G>C p.e495q Missense 20 ATP10A 1202 CCDS g.chr15: A>T c.3220 T>A p.l1074m Missense 21 ATP10A CCDS g.chr15: T>C c.2720 A>G p.d907g Missense 22 ATP8B4 824 CCDS g.chr15: G>C c.1588 C>G p.q530e Missense 23 ATRN CCDS g.chr20: A>C c.1118 A>C p.d373a Missense 24 BAP CCDS g.chr3: c.826_832 delcttgaga deltctcaag fs Indel 25 BAP CCDS g.chr3: delt c.1511 dela fs Indel 9

10 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 26 BAP CCDS g.chr3: inst c.1360 insa fs Indel 27 BAP CCDS g.chr3: G>T c.1881 C>A p.y627x Nonsense 28 BDH CCDS g.chr3: G>A c.331 C>T p.q111x Nonsense 29 BMPR CCDS g.chr2: A>G c.526 A>G p.t176a Missense 30 BPTF CCDS g.chr17: C>T c.8572 C>T p.r2858x Nonsense 31 BRPF3 824 CCDS g.chr6: C>T c.1132 C>T p.r378c Missense 32 BRPF CCDS g.chr6: C>T c.2537 C>T p.s846f Missense 33 C11orf CCDS g.chr11: G>C c.2094 G>C p.q698h Missense 34 C12orf ENST g.chr12: T>A c.943 T>A p.c315s Missense 35 C12orf CCDS g.chr12: T>A c.865 T>A p.c289s Missense 36 C15orf CCDS g.chr15: G>T c.2363 G>T p.s788i Missense 37 C19orf ENST g.chr19: insg c.1100 insc fs Indel 38 C2orf CCDS g.chr2: G>T c.1231 G>T p.g411c Missense 39 C3orf CCDS g.chr3: G>T c.182 G>T p.s61i Missense 40 C3orf CCDS g.chr3: c.4272_4278 delctgaagt delacttcag fs Indel 41 C4A 3001 CCDS g.chr6: deltc c.3321_3322 deltc fs Indel 42 C7orf CCDS g.chr7: C>T c.671 G>A p.g224d Missense 43 CAMTA CCDS g.chr1: C>T c.3377 C>T p.a1126v Missense 44 CARD CCDS g.chr17: C>T c.451 C>T p.r151w Missense 45 CCDC CCDS g.chr15: G>A c.956 G>A p.r319h Missense 46 CCT8L CCDS g.chr22: C>T c.322 G>A p.v108m Missense 47 CCT8L CCDS g.chr22: C>T c.751 G>A p.a251t Missense 48 CDC CCDS734.1 g.chr1: C>T c.1105 C>T p.q369x Nonsense 49 CHD1L CCDS927.1 g.chr1: G>A c.1716 G>A p.m572i Missense 50 CHPF CCDS g.chr7: G>T c.2237 G>T p.r746l Missense 10

11 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 51 CHST CCDS g.chr16: A>T c.859 A>T p.t287s Missense 52 CLCN7 824 CCDS g.chr16: C>T c.1307 G>A p.r436q Missense 53 CLK2 824 CCDS g.chr1: G>A c.139 C>T p.r47x Nonsense 54 CLPS 1202 CCDS g.chr6: T>A c.80 A>T p.n27i Missense 55 CLSPN CCDS396.1 g.chr1: T>C c.3305 A>G p.h1102r Missense 56 CNBP CCDS g.chr3: G>C c.477 C>G p.n159k Missense 57 CNTN6 824 CCDS g.chr3: G>A c.733 G>A p.v245i Missense 58 COL1A2 824 CCDS g.chr7: G>A c.2330 G>A p.r777h Missense 59 COLEC CCDS g.chr8: C>T c.214 C>T p.p72s Missense 60 CPXM CCDS g.chr20: C>T c.2183 G>A p.r728q Missense 61 CREB3L CCDS g.chr1: G>C c.173 G>C p.c58s Missense 62 CSRP2 824 CCDS g.chr12: G>T c.47 C>A p.t16n Missense 63 CTCF CCDS g.chr16: C>T c.1061 C>T p.s354f Missense 64 CTNND CCDS g.chr5: G>C c.517 C>G p.h173d Missense 65 CTSW 1202 CCDS g.chr11: C>A c.103 C>A p.p35t Missense 66 CWH CCDS g.chr4: A>G c.490 A>G p.t164a Missense 67 CXorf CCDS g.chrx: C>A c.443 G>T p.r148l Missense 68 CYB5R CCDS g.chr22: T>G c.732 A>C p.e244d Missense 69 CYLD 824 CCDS g.chr16: T>C IVS4-4 T>C Splice site Splice site 70 CYP4A CCDS g.chr1: C>T c.155 C>T p.p52l Missense 71 DAPK CCDS g.chr19: C>T c.1261 G>A p.e421k Missense 72 DCX CCDS g.chrx: T>C IVS2 +4 A>G Splice site Splice site 73 DDX CCDS g.chr10: G>A IVS5+1 G>A Splice site Splice site 74 DGCR6L CCDS g.chr22: G>A c.322 C>T p.r108w Missense 75 DLG CCDS g.chr3: T>C c.1859 A>G p.d620g Missense 11

12 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 76 DMXL CCDS g.chr15: G>A c.8971 C>T p.r2991x Nonsense 77 DSEL 824 CCDS g.chr18: C>T c.3547 G>A p.e1183k Missense 78 DUXA CCDS g.chr19: inst c.64 insa fs Indel 79 DZIP3 824 CCDS g.chr3: A>C c.2243 A>C p.k748t Missense 80 EGR CCDS g.chr5: C>G c.56 C>G p.p19r Missense 81 EIF4E2 824 CCDS g.chr2: G>C c.443 G>C p.w148s Missense 82 ELF CCDS g.chr1: delactg c.123_126 delactg fs Indel 83 ELTD CCDS g.chr1: C>T c.592 G>A p.v198m Missense 84 ENOPH CCDS g.chr4: C>T c.340 C>T p.q114x Nonsense 85 EYA CCDS g.chr8: G>T c.144 C>A p.s48r Missense 86 F CCDS g.chrx: C>G c.4934 G>C p.w1645s Missense 87 FBN CCDS g.chr5: G>A c.1151 C>T p.t384m Missense 88 FBN CCDS g.chr19: T>A c.943 A>T p.r315w Missense 89 FBXW7 824 CCDS g.chr4: G>A c.1393 C>T p.r465c Missense 90 FGF CCDS g.chr13: C>G c.271 C>G p.r91g Missense 91 FLNA CCDS g.chrx: C>T c.973 G>A p.g325r Missense 92 FLNC CCDS g.chr7: C>T c.1208 C>T p.a403v Missense 93 FNTB 824 CCDS g.chr14: G>T c.225 G>T p.r75s Missense 94 FRMD4A 1202 CCDS g.chr10: C>T c.923 G>A p.w308x Nonsense 95 FSCN CCDS g.chr7: G>A c.341 G>A p.r114h Missense 96 FZD CCDS g.chr17: G>T c.1595 G>T p.g532v Missense 97 GAPDH CCDS g.chr12: G>T c.103 G>T p.d35y Missense 98 GCDH CCDS g.chr19: G>C c.121 G>C p.a41p Missense 99 GCFC CCDS g.chr21: deltga c.463_465 deltca In frame Indel 100 GDPD5 930 CCDS g.chr11: G>A c.700 C>T p.r234c Missense 12

13 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 101 GFRA1 824 CCDS g.chr10: G>C c.1232 C>G p.t411r Missense 102 GIT CCDS g.chr12: G>A c.271 C>T p.r91c Missense 103 GLI CCDS g.chr7: G>T c.3609 C>A p.n1203k Missense 104 GLRB 1202 CCDS g.chr4: T>A c.908 T>A p.i303n Missense 105 GLYATL CCDS g.chr11: G>A IVS1+5 C>T Splice site Splice site 106 GNPAT 1202 CCDS g.chr1: delg c.780 delg fs Indel 107 GPBP1L CCDS528.1 g.chr1: T>C c.572 A>G p.q191r Missense 108 GPR CCDS g.chrx: T>A c.5320 T>A p.f1774i Missense 109 GPR CCDS g.chrx: A>G c.6719 A>G p.k2240r Missense 110 GRID2 824 CCDS g.chr4: A>G c.187 A>G p.i63v Missense 111 GRIN2A CCDS g.chr16: G>T c.3145 C>A p.p1049t Missense 112 HECTD CCDS g.chr1: C>T c.2509 G>A p.v837i Missense 113 HIF3A CCDS g.chr19: G>A c.1198 G>A p.a400t Missense 114 HMCN CCDS g.chr1: C>G c.2074 C>G p.q692e Missense 115 HMCN CCDS g.chr1: T>C c.3272 T>C p.v1091a Missense 116 HMGCR CCDS g.chr5: delc c.1723 delc fs Indel 117 HSPG CCDS g.chr1: C>A c G>T p.c3871f Missense 118 IDH CCDS g.chr2: G>A c.394 C>T p.r132c Missense 119 IDH CCDS g.chr2: G>A c.394 C>T p.r132c Missense 120 IDH CCDS g.chr2: G>A c.394 C>T p.r132c Missense 121 IGSF CCDS g.chr3: T>C c.3910 A>G p.k1304e Missense 122 IGSF CCDS g.chr1: T>C c.398 A>G p.n133s Missense 123 IGSF CCDS g.chr1: C>T c.682 G>A p.v228i Missense 124 ITGB CCDS g.chr7: G>A c.1906 G>A p.e636k Missense 125 IVNS1ABP CCDS g.chr1: T>G c.653 A>C p.e218a Missense 13

14 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 126 KCNQ CCDS g.chr8: C>A c.1354 G>T p.a452s Missense 127 KLHL CCDS g.chr16: C>T c.1229 C>T p.a410v Missense 128 KRAS 930 CCDS g.chr12: C>A c.35 G>T p.g12v Missense 129 KRAS 1202 CCDS g.chr12: C>T c.35 G>A p.g12d Missense 130 KRAS CCDS g.chr12: C>T c.35 G>A p.g12d Missense 131 LMO CCDS g.chr13: G>T c.2653 G>T p.a885s Missense 132 LRCH CCDS g.chr3: delatc c.326_328 delatc In frame Indel 133 LRRIQ CCDS g.chr12: G>T IVS6-1 G>T Splice site Splice site 134 LRRIQ CCDS g.chr12: A>T c.5137 A>T p.s1713c Missense 135 LYVE CCDS g.chr11: inst c.876 insa fs Indel 136 MAGEC CCDS g.chrx: A>C c.3138 A>C p.k1046n Missense 137 MAP2K1 715 CCDS g.chr15: T>G c.357 T>G p.h119q Missense 138 MCM ENST g.chr22: A>G IVS5-2 A>G Splice site Splice site 139 MORC CCDS g.chr3: C>A c.337 G>T p.d113y Missense 140 MPO 824 CCDS g.chr17: G>T c.1078 C>A p.l360m Missense 141 MUC ENST g.chr3: G>A c.344 C>T p.a115v Missense 142 MUC CCDS g.chr7: A>G c A>G p.m4294v Missense 143 MYEOV CCDS g.chr11: G>A c.626 G>A p.g209e Missense 144 MYH CCDS g.chr14: inscg c.4085 insgc fs Indel 145 MYH CCDS g.chr14: G>A c.5134 C>T p.r1712w Missense 146 NAP1L CCDS g.chrx: G>T c.1336 C>A p.p446t Missense 147 NELL CCDS g.chr11: C>A c.1235 C>A p.t412k Missense 148 NLGN CCDS g.chr3: C>G c.450 C>G p.s150r Missense 149 NLGN4X CCDS g.chr: C>T c.1435 G>A p.e479k Missense 150 NLRP3 824 CCDS g.chr1: G>A c.1390 G>A p.a464t Missense 14

15 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 151 NNT CCDS g.chr5: A>G c.2056 A>G p.i686v Missense 152 OR10J CCDS g.chr1: T>G c.604 A>C p.s202r Missense 153 OR13H CCDS g.chrx: delc c.855 delc fs Indel 154 OR13H CCDS g.chrx: C>A c.856 C>A p.p286t Missense 155 OR1C CCDS g.chr1: G>A c.166 C>T p.h56y Missense 156 OR4A5 824 CCDS g.chr11: G>A c.664 C>T p.l222f Missense 157 OR5B CCDS g.chr11: G>A c.250 C>T p.r84w Missense 158 OR8B CCDS g.chr11: C>G c.226 G>C p.v76l Missense 159 OTX CCDS g.chr2: C>T c.286 C>T p.q96x Nonsense 160 PALLD 824 CCDS g.chr4: T>C c.2635 T>C p.c879r Missense 161 PARL CCDS g.chr3: T>A c.469 A>T p.k157x Nonsense 162 PCDH CCDS g.chr5: G>A c.2405 C>T p.a802v Missense 163 PCDHA CCDS g.chr5: G>A c.1117 G>A p.v373i Missense 164 PCDHA CCDS g.chr5: G>A c.191 G>A p.r64q Missense 165 PCSK2 930 CCDS g.chr20: C>T c.844 C>T p.r282w Missense 166 PDP CCDS g.chr16: C>G c.1225 C>G p.l409v Missense 167 PITPNM CCDS g.chr11: C>G c.3423 G>C p.q1141h Missense 168 PIWIL CCDS g.chr12: C>G c.374 C>G p.p125r Missense 169 PIWIL CCDS g.chr11: T>G c.2370 T>G p.d790e Missense 170 PKNOX CCDS g.chr11: A>G c.536 A>G p.d179g Missense 171 PLCE1 824 CCDS g.chr10: G>A c.1600 G>A p.e534k Missense 172 PLXNA CCDS g.chr7: G>A c.4108 C>T p.r1370c Missense 173 POLB 1202 CCDS g.chr8: C>T c.64 C>T p.l22f Missense 174 PPFIBP1 824 CCDS g.chr12: C>T IVS16+4 C>T Splice site Splice site 175 PREX2 824 CCDS g.chr8: G>T c.3915 G>T p.r1305s Missense 15

16 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 176 PRG CCDS g.chr1: A>G c.2180 A>G p.k727r Missense 177 PRMT CCDS g.chr16: G>T c.1644 G>T p.m548i Missense 178 PRR CCDS g.chr5: C>T c.503 C>T p.p168l Missense 179 PRRT CCDS g.chr6: G>A c.557 C>T p.t186m Missense 180 PTPN6 824 CCDS g.chr12: G>A c.310 G>A p.d104n Missense 181 PTPRC 1202 CCDS g.chr1: G>A c.1022 G>A p.r341k Missense 182 RABEP2 824 CCDS g.chr16: C>T c.721 G>A p.g241s Missense 183 RB CCDS g.chr13: C>T c.1654 C>T p.r552x Nonsense 184 RBM CCDS g.chrx: delg c.1482 delg fs Indel 185 RBM CCDS g.chr12: T>A IVS5-2 A>T Splice site Splice site 186 RGS CCDS g.chr1: G>C c.688 G>C p.d230h Missense 187 RGS CCDS g.chr1: C>A c.874 G>T p.e292x Nonsense 188 RHOBTB CCDS g.chr5: C>A c.144 C>A p.s48r Missense 189 RNF CCDS g.chr2: G>A c.712 C>T p.r238c Missense 190 RPL3L 3001 CCDS g.chr16: T>A c.335 A>T p.d112v Missense 191 RTEL CCDS g.chr20: G>T c.1080 G>T p.q360h Missense 192 RWDD CCDS g.chr6: G>C c.184 G>C p.d62h Missense 193 SAE CCDS g.chr19: G>A c.631 G>A p.v247m Missense 194 SBNO CCDS g.chr12: G>T c.1603 C>A p.l535m Missense 195 SCEL 824 CCDS g.chr13: A>T c.23 A>T p.k8i Missense 196 SCN11A 1202 CCDS g.chr3: T>G c.5129 A>C p.k1710t Missense 197 SCRN CCDS g.chr17: C>A c.176 G>T p.c59f Missense 198 SFSWAP CCDS g.chr12: C>T c.673 C>T p.q225x Nonsense 199 SH2D CCDS g.chr1: G>T c.417 C>A p.c139x Nonsense 200 SLC12A CCDS g.chr7: G>A c.704 G>A p.r235q Missense 16

17 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 201 SLC13A5 824 CCDS g.chr17: G>C c.1430 C>G p.a477g Missense 202 SLC18A CCDS g.chr8: C>T c.1484 G>A p.c495y Missense 203 SLC20A CCDS g.chr8: C>T c.848 G>A p.s283n Missense 204 SLC35C CCDS g.chr20: G>A c.525 C>T p.s130l Missense 205 SLC36A CCDS g.chr5: T>A c.943 A>T p.k315x Nonsense 206 SLC4A CCDS g.chr3: G>C c.1527 C>G p.d509e Missense 207 SLC5A CCDS g.chr11: A>G IVS7+2 T>C Splice site Splice site 208 SMARCA CCDS g.chr19: G>A c.92 G>A p.s31n Missense 209 SORCS1 824 CCDS g.chr10: T>A c.578 A>T p.k193m Missense 210 SPA CCDS g.chr11: G>T c.289 G>T p.e97x Nonsense 211 SPINK CCDS g.chr5: C>T c.1196 C>T p.t399i Missense 212 SPP CCDS g.chr4: A>C c.518 A>C p.k173t Missense 213 SYMPK CCDS g.chr19: T>C c.527 A>G p.n176s Missense 214 SYNE CCDS g.chr6: T>G c.9451 A>C p.k3151q Missense 215 SYNE CCDS g.chr14: G>T c G>T p.d6608y Missense 216 TAB CCDS g.chrx: G>T c.370 C>A p.p124t Missense 217 TDRD6 824 CCDS g.chr6: G>A c.440 C>T p.p147l Missense 218 TERT CCDS g.chr5: C>T c.2852 G>A p.r951q Missense 219 TGFBR CCDS g.chr9: T>G c.194 T>G p.v65g Missense 220 TLL CCDS g.chr10: G>T c.2805 C>A p.f935l Missense 221 TMEM CCDS g.chr17: G>C c.157 C>G p.l53v Missense 222 TMEM CCDS g.chr9: A>T c.3478 T>A p.s1160t Missense 223 TNIP CCDS g.chr4: T>C c.988 A>G p.k330e Missense 224 TP CCDS g.chr17: C>A c.814 G>T p.v272l Missense 225 TP CCDS g.chr17: C>T c.473 G>A p.r158h Missense 17

18 Supplementary Table 3 (continued). A list of confirmed nonsynonymous somatic mutations identified in 15 non-o. viverriniassociated samples in the discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 226 TP CCDS g.chr17: delg c.80 delc fs Indel 227 TPO CCDS g.chr2: G>C IVS6+1 G>C Splice site Splice site 228 TPP CCDS g.chr13: G>T c.2215 G>T p.a739s Missense 229 TRIM CCDS376.1 g.chr1: C>T c.421 G>A p.d141n Missense 230 TRPM CCDS g.chr9: C>T c.2245 G>A p.a749t Missense 231 TSPAN CCDS g.chr10: G>T c.11 G>T p.g4v Missense 232 TSR CCDS g.chr16: A>G c.487 T>C p.s163p Missense 233 TTBK CCDS g.chr6: C>T c.772 C>T p.r258w Missense 234 UGT2B CCDS g.chr4: A>T c.593 T>A p.m198k Missense 235 UPP CCDS g.chr2: G>T c.509 G>T p.s170i Missense 236 VPS13B 824 CCDS g.chr8: C>T c.1193 C>T p.t398m Missense 237 VWF 930 CCDS g.chr12: G>A c.6908 C>T p.t2303m Missense 238 XIRP CCDS g.chr2: C>G c.9661 C>G p.l3221v Missense 239 ZBTB CCDS g.chr11: insc c.350 insg fs Indel 240 ZHX2 715 CCDS g.chr8: C>G c.2285 C>G p.a762g Missense 241 ZMYM3 930 CCDS g.chrx: C>A c.232 G>T p.e78x Nonsense 242 ZNF CCDS g.chr6: T>A c.218 A>T p.k73i Missense 243 ZNF CCDS g.chr9: G>A c.1955 G>A p.r652h Missense 244 ZNF CCDS731.1 g.chr1: T>C c.557 A>G p.n186s Missense 245 ZNF CCDS g.chr15: G>T c.1924 G>T p.d642y Missense 18

19 Supplementary Table 4. Recurrently mutated genes identified in 15 samples in discovery set No Gene Symbol Sample Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type AGPAT CCDS g.chr8: G>A c.382 G>A p.d128n Missense AGPAT CCDS g.chr8: A>G c.1220 A>G p.k407r Missense ARID1A 3001 CCDS285.1 g.chr1: G>T c.2791 G>T p.g931x Nonsense ARID1A CCDS285.1 g.chr1: delc c.1558 delc fs Indel ARID1A CCDS285.1 g.chr1: insa c.3217 insa fs Indel ARID1A CCDS285.1 g.chr1: G>T IVS8+1 G>T Splice site Splice site ATP10A 1202 CCDS g.chr15: A>T c.3220 T>A p.l1074m Missense ATP10A CCDS g.chr15: T>C c.2720 A>G p.d907g Missense BAP CCDS g.chr3: delcttgaga c.826_832 deltctcaag fs Indel BAP CCDS g.chr3: delt c.1511 dela fs Indel BAP CCDS g.chr3: inst c.1360 insa fs Indel BAP CCDS g.chr3: G>T c.1881 C>A p.y627x Nonsense BRPF3 824 CCDS g.chr6: C>T c.1132 C>T p.r378c Missense BRPF CCDS g.chr6: C>T c.2537 C>T p.s846f Missense CCT8L CCDS g.chr22: C>T c.322 G>A p.v108m Missense CCT8L CCDS g.chr22: C>T c.751 G>A p.a251t Missense GPR CCDS g.chrx: T>A c.5320 T>A p.f1774i Missense GPR CCDS g.chrx: A>G c.6719 A>G p.k2240r Missense HMCN CCDS g.chr1: C>G c.2074 C>G p.q692e Missense HMCN CCDS g.chr1: T>C c.3272 T>C p.v1091a Missense IDH CCDS g.chr2: G>A c.394 C>T p.r132c Missense IDH CCDS g.chr2: G>A c.394 C>T p.r132c Missense IDH CCDS g.chr2: G>A c.394 C>T p.r132c Missense KRAS 930 CCDS g.chr12: C>A c.35 G>T p.g12v Missense KRAS 1202 CCDS g.chr12: C>T c.35 G>A p.g12d Missense KRAS CCDS g.chr12: C>T c.35 G>A p.g12d Missense LRRIQ CCDS g.chr12: A>T c.5137 A>T p.s1713c Missense LRRIQ CCDS g.chr12: G>T IVS6-1 G>T Splice site Splice site TP CCDS g.chr17: C>A c.814 G>T p.v272l Missense TP CCDS g.chr17: delg c.80 delc fs Indel TP CCDS g.chr17: C>T c.473 G>A p.r158h Missense 19

20 Supplementary Table 5. Clinicopathological characteristics of 108 O. viverrini-associated CCA cases in the prevalence set No Sample ID Sex Age Origin Race Anatomical subtype anti-o. viverrini IgG 1 A028 F 59 Thailand Thai Intrahepatic Positive 2 A035 F 49 Thailand Thai Intrahepatic Positive 3 A039 F 72 Thailand Thai Intrahepatic Negative 4 A042 F 52 Thailand Thai Intrahepatic Positive 5 A043 M 45 Thailand Thai Intrahepatic Positive 6 A074 M 55 Thailand Thai Intrahepatic Positive 7 A105 M 53 Thailand Thai Intrahepatic Positive 8 A106 M 51 Thailand Thai Intrahepatic Positive 9 A107 M 54 Thailand Thai Intrahepatic Positive 10 A119 F 51 Thailand Thai Intrahepatic Positive 11 A120 F 53 Thailand Thai Intrahepatic Positive 12 A128 M 61 Thailand Thai Intrahepatic Positive 13 A142 F 38 Thailand Thai Intrahepatic N/A 14 A162 M 68 Thailand Thai Intrahepatic N/A 15 B032 M 53 Thailand Thai Intrahepatic N/A 16 B048 F 51 Thailand Thai Intrahepatic Positive 17 B083 F 53 Thailand Thai Intrahepatic Positive 18 B085 M 73 Thailand Thai Intrahepatic Negative 19 B087 M 56 Thailand Thai Intrahepatic Positive 20 B099 M 48 Thailand Thai Intrahepatic Positive 21 B113 M 61 Thailand Thai Intrahepatic Positive 22 R104 F 64 Thailand Thai Intrahepatic N/A 23 R134 M 50 Thailand Thai Intrahepatic N/A 24 T003 M 52 Thailand Thai Intrahepatic N/A 25 U027 F 66 Thailand Thai Intrahepatic Positive 26 W012 F 61 Thailand Thai Intrahepatic Positive 27 W039 M 66 Thailand Thai Intrahepatic N/A 28 W040 M 56 Thailand Thai Intrahepatic N/A 29 Y002 F 45 Thailand Thai Intrahepatic Positive 30 Y008 F 65 Thailand Thai Intrahepatic Positive 31 Y019 M 70 Thailand Thai Intrahepatic Negative 32 Y020 M 50 Thailand Thai Intrahepatic Positive 33 Y023 M 62 Thailand Thai Intrahepatic Positive 34 Y032 M 69 Thailand Thai Intrahepatic Positive 35 Y033 F 51 Thailand Thai Intrahepatic Positive 36 Y035 F 64 Thailand Thai Intrahepatic Positive 20

21 Supplementary Table 5 (continued). Clinicopathological characteristics of 108 O. viverriniassociated CCA cases in the prevalence set No Sample ID Sex Age Origin Race Anatomical subtype anti-o. viverrini IgG 37 Y057 M 57 Thailand Thai Intrahepatic Negative 38 Y065 M 63 Thailand Thai Intrahepatic N/A 39 Y072 M 61 Thailand Thai Intrahepatic Positive 40 Y074 F 40 Thailand Thai Intrahepatic Positive 41 Y140 F 56 Thailand Thai Intrahepatic Positive 42 Y149 M 69 Thailand Thai Intrahepatic Positive 43 C004 M 53 Thailand Thai Intrahepatic Positive 44 C008 M 47 Thailand Thai Intrahepatic N/A 45 C054 M 44 Thailand Thai Intrahepatic N/A 46 C078 M 42 Thailand Thai Intrahepatic Positive 47 C080 F 69 Thailand Thai Intrahepatic Positive 48 C084 M 62 Thailand Thai Intrahepatic Positive 49 C095 M 56 Thailand Thai Intrahepatic Positive 50 C096 F 79 Thailand Thai Intrahepatic Positive 51 C105 F 48 Thailand Thai Intrahepatic Positive 52 C107 F 49 Thailand Thai Intrahepatic Positive 53 C110 M 59 Thailand Thai Intrahepatic Negative 54 C128 F 43 Thailand Thai Intrahepatic Negative 55 C144 M 52 Thailand Thai Intrahepatic Positive 56 C151 M 73 Thailand Thai Intrahepatic Positive 57 C154 M 59 Thailand Thai Intrahepatic N/A 58 C164 F 60 Thailand Thai Intrahepatic Negative 59 C167 M 64 Thailand Thai Intrahepatic Positive 60 D017 F 52 Thailand Thai Intrahepatic Negative 61 D029 M 64 Thailand Thai Intrahepatic N/A 62 D039 F 66 Thailand Thai Intrahepatic N/A 63 A159 M 55 Thailand Thai Extrahepatic N/A 64 B070 M 61 Thailand Thai Extrahepatic Positive 65 B149 M 63 Thailand Thai Extrahepatic Positive 66 R100 F 49 Thailand Thai Extrahepatic N/A 67 R149 M 37 Thailand Thai Extrahepatic N/A 68 T026 M 52 Thailand Thai Extrahepatic N/A 69 T151 M 73 Thailand Thai Extrahepatic Positive 70 T157 M 42 Thailand Thai Extrahepatic Positive 71 T160 M 46 Thailand Thai Extrahepatic Positive 72 U044 M 57 Thailand Thai Extrahepatic N/A 21

22 Supplementary Table 5 (continued). Clinicopathological characteristics of 108 O. viverriniassociated CCA cases in the prevalence set No Sample ID Sex Age Origin Race Anatomical subtype anti-o. viverrini IgG 73 Y091 F 51 Thailand Thai Extrahepatic Positive 74 Y123 M 55 Thailand Thai Extrahepatic Positive 75 A003 F 56 Thailand Thai Extrahepatic Positive 76 A004 M 52 Thailand Thai Extrahepatic Negative 77 A011 M 53 Thailand Thai Extrahepatic Positive 78 A026 M 52 Thailand Thai Extrahepatic Positive 79 A059 M 46 Thailand Thai Extrahepatic Positive 80 A064 M 49 Thailand Thai Extrahepatic Negative 81 A072 M 52 Thailand Thai Extrahepatic Negative 82 A080 M 50 Thailand Thai Extrahepatic Positive 83 A096 F 76 Thailand Thai Extrahepatic Positive 84 A100 M 53 Thailand Thai Extrahepatic Positive 85 A114 M 76 Thailand Thai Extrahepatic Positive 86 A118 F 63 Thailand Thai Extrahepatic Positive 87 A130 M 54 Thailand Thai Extrahepatic Positive 88 A132 M 61 Thailand Thai Extrahepatic Negative 89 A150 M 64 Thailand Thai Extrahepatic Positive 90 A153 M 60 Thailand Thai Extrahepatic Positive 91 A157 M 51 Thailand Thai Extrahepatic Positive 92 A169 M 66 Thailand Thai Extrahepatic Negative 93 B005 M 50 Thailand Thai Extrahepatic Positive 94 B011 M 60 Thailand Thai Extrahepatic Positive 95 B017 M 53 Thailand Thai Extrahepatic Positive 96 B027 M 57 Thailand Thai Extrahepatic Positive 97 B103 M 63 Thailand Thai Extrahepatic Positive 98 C006 M 62 Thailand Thai Extrahepatic Positive 99 C045 M 64 Thailand Thai Extrahepatic Positive 100 C061 F 60 Thailand Thai Extrahepatic Positive 101 C085 M 52 Thailand Thai Extrahepatic Positive 102 C115 M 66 Thailand Thai Extrahepatic Positive 103 C119 F 75 Thailand Thai Extrahepatic Positive 104 C140 M 52 Thailand Thai Extrahepatic Negative 105 C150 M 57 Thailand Thai Extrahepatic Positive 106 C163 M 55 Thailand Thai Extrahepatic Positive 107 C169 F 56 Thailand Thai Extrahepatic Positive 108 C176 M 49 Thailand Thai Extrahepatic Positive Samples previously reported in Ong et al. 1 are highlighted. 22

23 Supplementary Table 6. Serum IgG antibody against O. viverrini crude antigen Cohort of CCA samples Total Positive Negative N % (N) % (N) Non-O. viverrini-cca Singapore % (2) 83.3% (10) Romania 46 15% (7) 85% (39) O. viverrini-cca Thailand % (76) 15.6% (14) 23

24 Supplementary Table 7. Summary of mutations in KRAS, IDH1 and IDH2 identified using ultra-deep amplicon sequencing compared to Sanger sequencing a) KRAS mutations in 209 cholangiocarcinoma cases Gene Sample ID Origin Sample cohort Ultra-deep amplicon sequencing Total Reads Variant Reads Variant allele Frequency (%) No. of amplicons Amino acid change cdna change Sanger validation KRAS Singapore Non-O. viverrini-cca p.g12d c.35 G>A Yes KRAS Singapore Non-O. viverrini-cca p.g12d c.35 G>A Yes KRAS Singapore Non-O. viverrini-cca p.g12v c.35 G>T Yes KRAS Z3561 Singapore Non-O. viverrini-cca p.g12d c.35 G>A Yes KRAS Singapore Non-O. viverrini-cca p.g12d c.35 G>A Yes KRAS 2143 Romania Non-O. viverrini-cca p. Q61H c.183 A>C Yes KRAS 27 Romania Non-O. viverrini-cca p. G13D c.38 G>A Yes KRAS 962 Romania Non-O. viverrini-cca p.g12v c.35 G>T Yes KRAS 1441 Romania Non-O. viverrini-cca p.g12v c.35 G>T Yes KRAS 930 Romania Non-O. viverrini-cca p. G12V c.35 G>T Yes KRAS 1202 Romania Non-O. viverrini-cca p.g12d c.35 G>A Yes KRAS R104 Thailand O. viverrini-cca p. G13D c.38 G>A Yes KRAS Y149 Thailand O. viverrini-cca p.g12v c.35 G>T Yes KRAS C154 Thailand O. viverrini-cca p.g12c c.34 G>T Yes 24

25 a) (continued). KRAS mutations in 209 cholangiocarcinoma cases Gene Sample ID Origin Sample cohort Ultra-deep amplicon sequencing Total Reads Variant Reads Variant allele Frequency (%) No. of amplicons Amino acid change cdna change Sanger validation KRAS Y020 Thailand O. viverrini-cca p.g12v c.35 G>T Yes KRAS A003 Thailand O. viverrini-cca p.g12d c.35 G>A Yes KRAS Y019 Thailand O. viverrini-cca p.g12c c.34 G>T Yes KRAS W012 Thailand O. viverrini-cca p.g12a c.35 G>C Yes KRAS C078 Thailand O. viverrini-cca p.g12v c.35 G>T Yes KRAS B085 Thailand O. viverrini-cca p.g12a c.35 G>C Yes KRAS T151 Thailand O. viverrini-cca p.g12d c.35 G>A Yes KRAS U027 Thailand O. viverrini-cca p. G12S c.34 G>A Yes KRAS Y008 Thailand O. viverrini-cca p.g12d c.35 G>A Yes KRAS Y072 Thailand O. viverrini-cca p. A146T c.436 G>A Yes KRAS 2410 Romania Non-O. viverrini-cca p.g12d c.35 G>A Yes KRAS Y033 Thailand O. viverrini-cca p. G13D c.38 G>A No KRAS T160 Thailand O. viverrini-cca p. Q61H c.183 A>C No KRAS Singapore Non-O. viverrini-cca p.g12v c.35 G>T No Yes, Mutation was consistently detected by both ultra-deep amplicon and Sanger sequencing. No, Mutation was undetectable by Sanger sequencing. Mutated samples 28/209 25/209 Mutation frequency 13.4% 12.0% 25

26 b) IDH1 and IDH2 mutations in 209 cholangiocarcinoma cases Gene Sample ID Origin Sample cohort Ultra-deep amplicon sequencing Total Reads Varia nt Reads Variant allele Frequency (%) No. of amplicons Amino acid change cdna change Sanger validation IDH1 Z2778 Singapore Non-O. viverrini-cca p.r132g c.394 C>G Yes IDH Singapore Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH Singapore Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH Singapore Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH Singapore Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH Romania Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH1 004C Romania Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH Romania Non-O. viverrini-cca p.r132c c.394 C>T Yes IDH1 C085 Thailand O. viverrini-cca p.r132s c.394 C>A Yes IDH2 C105 Thailand O. viverrini-cca p.r172l c.515g>a Yes IDH1 A039 Thailand O. viverrini-cca p.r132v c.394_395 CG>GT Yes IDH2 Z639 Singapore Non-O. viverrini-cca p.r172w c.514 A>T Yes IDH * Singapore Non-O. viverrini-cca p.r132l c.395 G>T Yes IDH Singapore Non-O. viverrini-cca p.r132l c.395 G>T No IDH1 Z321 Singapore Non-O. viverrini-cca p.r132g c.394 C>G No Mutated samples 15/209 13/209 Mutation frequency 7.2% 6.2% Yes, Mutation was consistently detected by both ultra-deep amplicon and Sanger sequencing. No, Mutation was undetectable by Sanger sequencing. *Mutation detected by ultra-deep amplicon sequencing and later confirmed by Sanger sequencing in discovery sample but missed by whole exome sequencing. 26

27 Supplementary Table 8. Mutation frequencies a of commonly mutated genes in Asian CCAs stratified by anatomical subtypes Gene Newly identified Asian non-o. viverrini-cca b Asian O. viverrini-cca c Singapore f Thailand f Unadjusted Intrahepatic Extrahepatic P-value d FDRs e Intrahepatic Extrahepatic N=27 N=14 N=62 N=46 Unadjuste d P-value d BAP1 22.2% (6) % (2) 2.2% (1) ARID1A 7.4% (2) 7.1% (1) % (8) 23.9% (11) Differentially mutated TP53 7.4% (2) 14.2% (2) % (28) 32.6% (15) SMAD % (3) % (10) 23.9% (11) MLL % (7) 15.2% (7) GNAS % (3) 6.5% (3) IDH1/2* 22.2% (6) % (2) 2.2% (1) ROBO2 3.7% (1) 7.1% (1) % (3) 6.5% (3) RNF43 3.7% (1) 7.1% (1) % (4) 8.7% (4) KRAS* 7.4% (2) 21.4% (3) % (12) 6.5% (3) a Includes point mutations, indels and splice-site mutations. b Mutation frequencies in the independent validation samples only, excluding discovery samples. c Mutation frequencies in our previous study 1 and in new samples added in current study. d By two-sided Fisher's Exact Test. e False discovery rates (FDRs) were based on unadjusted P-values using the Benjamini-Hochberg method. f Number of samples with mutations are shown in parentheses. *Sequenced by ultra-deep amplicon sequencing (detailed in Supplementary Table 7). FDRs e 27

28 Supplementary Table 9. Mutation frequencies a of commonly mutated genes in Asian and European non-o. viverrini-associated CCAs Gene Non-O. viverrini-cca b Singapore c Romania c N=41 N=45 Unadjusted P-value d FDRs e Newly identified BAP1 14.6% (6) 6.7% (3) ARID1A 7.3% (3) 13.3% (6) Differentially mutated TP53 9.8% (4) 8.9% (4) SMAD4 7.3% (3) 4.4% (2) MLL % (3) GNAS IDH1/2* 14.6% (6) 4.4% (2) ROBO2 4.9% (2) RNF43 4.9% (2) 2.2% (1) KRAS* 12.2% (5) 11.1% (5) a Includes point mutations, indels and splice-site mutations. b Mutation frequencies in the independent validation samples only, excluding discovery samples. c Number of samples with mutations are shown in parentheses. d By two-sided Fisher's Exact Test. e False discovery rates (FDRs) were based on unadjusted P-values using the Benjamini-Hochberg method. *Sequenced by ultra-deep amplicon sequencing (detailed in Supplementary Table 7). 28

29 Supplementary Table 10. Frequently mutated genes identified in 101 non-o. viverrini-associated CCAs Gene Nonsynonymous somatic mutations Missense Nonsense, splice site or indel Synonymous Total mutations N:S ratio a Total samples harboring mutations Nonsynonymous somatic mutations Missense (N) Nonsense, splice site or indel (N) ARID1A % (13) b BAP % (2) 84.6% (11) IDH1/ % (12) 0 TP : % (7) 36.4% (4) KRAS % (13) 0 MLL : % (2) 33.3% (1) SMAD % (3) 40% (2) RNF % (3) ROBO % (2) 0 GNAS All synonymous and nonsynonymous mutations were confirmed by Sanger sequencing. Detailed information on each mutation is listed in Supplementary Table 12., no synonymous mutation was identified. a N:S, non- synonymous to synonymous mutation ratio. Nonsynonymous mutations in the N:S ratio exclude splice-site variants. b Sample that harbored both missense and indel/nonsense/splice site is classified in this group. 29

30 Supplementary Table 11. Frequently mutated genes identified in 108 O. viverrini-associated CCAs Gene ARID1A Nonsynonymous somatic mutations Missense Nonsense, splice site or indel Synonymous Total mutations N:S ratio a Total samples harboring mutations Nonsynonymous somatic mutations Missense (N) Nonsense, splice site or indel (N) % (2) 89.5% (17) b BAP % (3) IDH1/ % (3) 0 TP : % (27) 37.2% (16) KRAS % (15) 0 MLL : % (4) 71.4% (10) b SMAD : % (9) 57.1% (12) RNF % (4) 50% (4) ROBO : % (2) 66.7% (4) b GNAS % (6) 0 All synonymous and nonsynonymous mutations were confirmed by Sanger sequencing. Detailed information on BAP1 and ARID1A mutations is listed in Supplementary Table 13. Data was analyzed in the samples used in our previous study 1 and in the new samples added in the current study., no synonymous mutation was identified in this gene. a N:S, nonsynonymous to synonymous mutation ratio. Nonsynonymous mutations in the N:S ratio exclude splice-site variants. b Sample that harbored both missense and indel/nonsense/splice site is classified in this group. 30

31 Supplementary Table 12. Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in non-o. viverrini-associated CCAs in discovery (N = 15) and prevalence set (N = 86) No Gene Symbol Sample Sample Origin Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) 1 ARID1A Singapore CCDS285.1 g.chr1: delc c.1558 delc fs Indel 2 ARID1A Singapore CCDS285.1 g.chr1: insa c.3217 insa fs Indel Mutation type 3 ARID1A Singapore CCDS285.1 g.chr1: G>T IVS8+1 G>T Splice site Splice site 4 ARID1A 3001 Romania CCDS285.1 g.chr1: G>T c.2791 G>T p.g931x Nonsense 5 ARID1A Singapore CCDS285.1 g.chr1: insc c.1651 insc fs Indel 6 ARID1A Singapore CCDS285.1 g.chr1: delc c.2296 delc fs Indel 7 ARID1A * Singapore CCDS285.1 g.chr1: deltgagg c.5403_5407 deltgagg fs Indel 8 ARID1A 1774 Romania CCDS285.1 g.chr1: C>T c.4948 C>T p.q1650x Nonsense 9 ARID1A 1382 Romania CCDS285.1 g.chr1: dela c.2749 del A fs Indel 10 ARID1A 962 Romania CCDS285.1 g.chr1: deltcag c.3513_3516 del TCAG fs Indel 11 ARID1A 1178 Romania CCDS285.1 g.chr1: insgcct c.685_686 ins GCCT fs Indel 12 ARID1A 1178 Romania CCDS285.1 g.chr1: del TCCCCAGCCAGCAGACT ACAATGTATCAACAGCA c.4061_4094 del TCCCCAGCCAGCAGAC TACAATGTATCAACAGCA 13 ARID1A 004C Romania CCDS285.1 g.chr1: C>T c.4336 C>T p.r1446x Nonsense 14 ARID1A 1656 Romania CCDS285.1 g.chr1: insa c.608_609 ins A fs Indel 15 ARID1A 1656 Romania CCDS285.1 g.chr1: G>T c.6477 G>T p.k2159n Missense 16 BAP Singapore CCDS g.chr3: delcttgaga c.826_832 deltctcaag fs Indel 17 BAP Singapore CCDS g.chr3: inst c.1360 insa fs Indel 18 BAP Singapore CCDS g.chr3: delt c.1511 dela fs Indel 19 BAP Singapore CCDS g.chr3: G>T c.1881 C>A p.y627x Nonsense fs Indel 31

32 Supplementary Table 12 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in non-o. viverrini-associated CCAs in discovery (N = 15) and prevalence set (N = 86) No Gene Symbol Sample Sample Origin Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 20 BAP1 Z639 Singapore CCDS g.chr3: insat c.1930 insta fs Indel g.chr3: c.765_ BAP * Singapore CCDS fs Indel delagcctctagt delactagaggct 22 BAP * Singapore CCDS g.chr3: C>T c.31 G>A p.d11n Missense 23 BAP1 Z508* Singapore CCDS g.chr3: C>G c.1997 G>C p.r666t Missense 24 BAP Singapore CCDS g.chr3: dela c.647 delt fs Indel 25 BAP1 Z3534 Singapore CCDS g.chr3: insa c.2085 inst fs Indel 26 BAP Romania CCDS g.chr3: G>T c.814 C>T p.q272x Nonsense 27 BAP Romania CCDS g.chr3: delt c.1269 dela fs Indel 28 BAP1 004C Romania CCDS g.chr3: G>A c.1777 C>T p.q593x Nonsense 29 IDH Singapore CCDS g.chr2: G>A c.394 C>T p.r132c Missense 30 IDH Singapore CCDS g.chr2: G>A c.394 C>T p.r132c Missense 31 IDH Romania CCDS g.chr2: G>A c.394 C>T p.r132c Missense 32 IDH Singapore CCDS g.chr2: C>A c.395 G>T p.r132l Missense 33 IDH Singapore CCDS g.chr2: G>A c.394 C>T p.r132c Missense 34 IDH Singapore CCDS g.chr2: G>A c.394 C>T p.r132c Missense 35 IDH Romania CCDS g.chr2: G>A c.394 C>T p.r132c Missense 36 IDH1 Z2778 Singapore CCDS g.chr2: G>C c.394 C>G p.r132g Missense 37 IDH1 004C Romania CCDS g.chr2: G>A c.394 C>T p.r132c Missense 38 IDH Singapore CCDS g.chr2: C>A c.395 G>T p.r132l Missense 39 IDH1 Z321 Singapore CCDS g.chr2: G>C c.394 C>G p.r132g Missense 40 IDH2 Z639 Singapore CCDS g.chr15: T>A c.514 A>T p.r172w Missense 32

33 Supplementary Table 12 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in non-o. viverrini-associated CCAs in discovery (N = 15) and prevalence set (N = 86) No Gene Symbol Sample Sample Origin Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 41 KRAS Singapore CCDS g.chr12: C>T c.35 G>A p.g12d Missense 42 KRAS 930 Romania CCDS g.chr12: C>A c.35 G>T p.g12v Missense 43 KRAS 1202 Romania CCDS g.chr12: C>T c.35 G>A p.g12d Missense 44 KRAS Singapore CCDS g.chr12: C>A c.35 G>T p.g12v Missense 45 KRAS Singapore CCDS g.chr12: C>T c.35 G>A p.g12d Missense 46 KRAS 1441 Romania CCDS g.chr12: C>A c.35 G>T p.g12v Missense 47 KRAS Z3561 Singapore CCDS g.chr12: C>T c.35 G>A p.g12d Missense 48 KRAS Singapore CCDS g.chr12: C>T c.35 G>A p.g12d Missense 49 KRAS 27 Romania CCDS g.chr12: C>T c.35 G>A p.g12d Missense 50 KRAS 962 Romania CCDS g.chr12: C>A c.35 G>T p.g12v Missense 51 KRAS 2143 Romania CCDS g.chr12: T>G c.183 A>C p.q61h Missense 52 KRAS 2410 Romania CCDS g.chr12: C>T c.35 G>A p.g12d Missense 53 KRAS Singapore CCDS g.chr12: C>A c.35 G>T p.g12v Missense 54 MLL Romania CCDS g.chr7: insa c.4271 inst fs Indel 55 MLL3 890 Romania CCDS g.chr7: T>C c A>G p.h4339r Missense 56 MLL3 154 Romania CCDS g.chr7: G>T c.5511 C>A p.t1837t Synonymous 57 MLL Singapore CCDS g.chr7: G>A c.7540 C>T p.l2514l Synonymous 58 MLL Singapore CCDS g.chr7: T>A c.8748 A>T p.p2916p Synonymous 59 MLL Romania CCDS g.chr7: G>T c C>A p.p3513h Missense 60 RNF Singapore CCDS g.chr17: delg c.1425 del C fs Indel 33

34 Supplementary Table 12 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in non-o. viverrini-associated CCAs in discovery (N = 15) and prevalence set (N = 86) No Gene Symbol Sample Sample Origin Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 61 RNF Singapore CCDS g.chr17: delgg c.1978_1979 delcc + fs Indel + instga instca 62 RNF Romania CCDS g.chr17: delc c.1976 delg f.s Indel 63 ROBO Singapore CCDS g.chr3: G>A c.893 G>A p.r298q Missense 64 ROBO2 Z2403 Singapore CCDS g.chr3: A>G c.1739 A>G p.y580c Missense 65 SMAD * Singapore CCDS g.chr18: c.323_334 In frame Indel delaactaaaacatg delaactaaaacatg 66 SMAD Singapore CCDS g.chr18: C>T c.1081 C>T p.r361c Missense 67 SMAD Romania CCDS g.chr18: C>T c.1333 C>T p.r445x Nonsense 68 SMAD4 Z3585 Singapore CCDS g.chr18: C>T c.1081 C>T p.r361c Missense 69 SMAD Romania CCDS g.chr18: C>T c.1081 C>T p.r361c Missense 70 TP Singapore CCDS g.chr17: C>T c.473 G>A p.r158h Missense 71 TP Singapore CCDS g.chr17: C>T c.795 G>A p.l295l Synonymous 72 TP Singapore CCDS g.chr17: delg c.80 delc fs Indel 73 TP Romania CCDS g.chr17: C>A c.814 G>T p.v272l Missense 74 TP Singapore CCDS g.chr17: C>A c.747 G>T p.r249s Missense 75 TP Singapore CCDS g.chr17: C>A c.747 G>T p.r249s Missense 76 TP Romania CCDS g.chr17: T>C c.536 A>G p.h179r Missense 77 TP Romania CCDS g.chr17: G>A c.916 C>T p.r306x Nonsense 78 TP53 Z3585 Singapore CCDS g.chr17: C>T c.713 G>A p.c238y Missense 79 TP53 Z3561 Singapore CCDS g.chr17: G>A c.844 C>T p.r282w Missense 80 TP Romania CCDS g.chr17: delg c.80 delc fs Indel 81 TP T Romania CCDS g.chr17: delg c.1024 delc fs Indel Discovery samples are highlighted. *Mutations were verified in formalin fixed paraffin embedded (FFPE) samples which had both tumor and corresponding normal DNA. 34

35 Supplementary Table 13. Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs No Gene Symbol Sample Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 1 ARID1A A074 CCDS285.1 g.chr1: C>G c.1901 C>G p.s634x Nonsense 2 ARID1A R100 CCDS285.1 g.chr1: delttgaca c.5426_5441 AGCTTCCAGT delttgacaagcttccagt fs Indel 3 ARID1A R149 CCDS285.1 g.chr1: C>T c.4381 C>T p.r1461x Nonsense 4 ARID1A T026 CCDS285.1 g.chr1: C>T c.2632 C>T p.q878x Nonsense 5 ARID1A T151 CCDS285.1 g.chr1: C>A c.5729 C>A p.t1910n Missense 6 ARID1A U027 CCDS285.1 g.chr1: G>T c.6100 G>T p.e2034x Nonsense 7 ARID1A Y019 CCDS285.1 g.chr1: G>A c.6259 G>A p.g2087r Missense 8 ARID1A Y020 CCDS285.1 g.chr1: C>G c.1203 C>G p.y401x Nonsense 9 ARID1A Y057 CCDS285.1 g.chr1: deltagaggaca c.6596_6625 deltagaggacagcct GCCTTGCCGCCACACAGTTCC TGCCGCCACACAGTTCC In frame Indel 10 ARID1A Y065 CCDS285.1 g.chr1: C>A c.1820 C>A p.s607x Nonsense 11 ARID1A Y091 CCDS285.1 g.chr1: dela c.3482 dela fs Indel 12 ARID1A Y123 CCDS285.1 g.chr1: delacaaat IVS6-8 delacaaatag + c.2252_2270 Splice site fs AGGTTATATGCAGAGGAACCC delgttatatgcagaggaaccc + Indel 13 ARID1A D017 CCDS285.1 g.chr1: delg c.572 delg fs Indel 14 ARID1A C115 CCDS285.1 g.chr1: C>G c.1602 C>G p.y534x Nonsense 15 ARID1A C167 CCDS285.1 g.chr1: G>T c.1876 G>T p.e626x Nonsense 16 ARID1A C167 CCDS285.1 g.chr1: AGA>TT c.1938_1940 AGA>TT fs Indel 17 ARID1A A150 CCDS285.1 g.chr1: delg c.2245 delg fs Indel 18 ARID1A C176 CCDS285.1 g.chr1: C>T c.4270 C>T p.q1424x Nonsense 19 ARID1A A153 CCDS285.1 g.chr1: C>T c.4420 C>T p.q1474x Nonsense 20 ARID1A B011 CCDS285.1 g.chr1: G>T c.6259 G>T p.g2087x Nonsense 21 BAP1 W040 CCDS g.chr3: delgggt c.331_334 delaccc fs Indel 22 BAP1 C105 CCDS g.chr3: delag c.524_525 delct fs Indel 23 BAP1 A157 CCDS g.chr3: inst c.775 insa fs Indel 24 IDH1 A039 CCDS g.chr2: GC>AC c.394_395 CG>GT p.r132v Missense 25 IDH1 C085 CCDS g.chr2: G>T c.394 C>A p.r132s Missense 26 IDH2 C105 CCDS g.chr15: C>T c.515g>a p.r172l Missense 35

36 Supplementary Table 13 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs No Gene Symbol Sample Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 27 KRAS C078 CCDS g.chr12: C>A c.35 G>T p.g12v Missense 28 KRAS C154 CCDS g.chr12: C>T c.34 G>T p.g12c Missense 29 KRAS A003 CCDS g.chr12: C>T c.35 G>A p.g12d Missense 30 KRAS Y072 CCDS g.chr12: C>T c.436 G>A p. A146T Missense 31 KRAS Y033 CCDS g.chr12: C>T c.38 G>A p. G13D Missense 32 KRAS T160 CCDS g.chr12: T>G c.183 A>C p. Q61H Missense 33 KRAS B085 CCDS g.chr12: G>C c.35 G>C p.g12a Missense 34 KRAS R104 CCDS g.chr12: C>T c.38 C>T p.g13d Missense 35 KRAS T151 CCDS g.chr12: G>A c.35 G>A p.g12d Missense 36 KRAS U027 CCDS g.chr12: G>A c.34 G>A p.g12s Missense 37 KRAS W12 CCDS g.chr12: G>C c.35 G>C p.g12a Missense 38 KRAS Y008 CCDS g.chr12: G>A c.35 G>A p.g12d Missense 39 KRAS Y019 CCDS g.chr12: G>T c.34 G>T p.g12c Missense 40 KRAS Y020 CCDS g.chr12: G>T c.35 G>T p.g12v Missense 41 KRAS Y149 CCDS g.chr12: G>T c.35 G>T p.g12v Missense 42 MLL3 B011 CCDS g.chr7: G>T c.734 C>A p.s245y Missense 43 MLL3 B011 CCDS g.chr7: T>G c.4126 A>C p.s1376r Missense 44 MLL3 B011 CCDS g.chr7: G>A c.4333 C>T p.l1445f Missense 45 MLL3 B011 CCDS g.chr7: G>A c.4889 C>T p.s1630l Missense 46 MLL3 B011 CCDS g.chr7: C>A c.5482 G>T p.e1828x Nonsense 47 MLL3 B011 CCDS g.chr7: A>C c.9265 T>G p.f3089v Missense 48 MLL3 B011 CCDS g.chr7: G>T c C>A p.f3689l Missense 49 MLL3 B011 CCDS g.chr7: G>A c C>T p.r3995x Nonsense 50 MLL3 B011 CCDS g.chr7: G>A c C>T R4806X Nonsense 51 MLL3 C164 CCDS g.chr7: C>T c.4385 G>A p.g1462d Missense 52 MLL3 C078 CCDS g.chr7: TT>CA c.4423_4424 AA>TG p.n1475c Missense 36

37 Supplementary Table 13 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs No Gene Symbol Sample Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 53 MLL3 A157 CCDS g.chr7: G>A c.5614 C>T p.q1872x Nonsense 54 MLL3 A157 CCDS g.chr7: C>A c.6683 G>T p.r2228m Missense 55 MLL3 C080 CCDS g.chr7: G>A c.6082 C>T p.r2028x Nonsense 56 MLL3 A096 CCDS g.chr7: insa c.8082 inst fs Indel 57 MLL3 T026 CCDS g.chr7: G>T c G>T p.e4881x Nonsense 58 MLL3 W039 CCDS g.chr7: G>T c G>T p.s4050x Nonsense 59 MLL3 R100 CCDS g.chr7: insTT c.11908_11909 ins TT fs Indel 60 MLL3 R149 CCDS g.chr7: C>T c.9934 C>T p.q3312x Nonsense 61 MLL3 Y023 CCDS g.chr7: G>A c G>A p.w4360x Nonsense 62 MLL3 Y057 CCDS g.chr7: A>T c.411 A>T p.q147h Missense 63 MLL3 Y091 CCDS g.chr7: T>C c T>C p.v4527a Missense 64 MLL3 B149 CCDS g.chr7: C>A IVS2+2 C>A Splice site Splice site 65 MLL3 U027 CCDS g.chr7: G>C c G>C p.l4331l Synonymous 66 RNF43 A080 CCDS g.chr17: inst c.88 insa fs Indel 67 RNF43 C144 CCDS g.chr17: C>G c.619 G>C p.g207r Missense 68 RNF43 A157 CCDS g.chr17: delc c.1976 delg fs Indel 69 RNF43 A074 CCDS g.chr17: C>G c.611 C>G p.t204r Missense 70 RNF43 A159 CCDS g.chr17: C>T c.337 C>T p.r113x Nonsense 71 RNF43 R104 CCDS g.chr17: A>G c.355 T>C p.c119r Missense 72 RNF43 U044 CCDS g.chr17: A>T c.500 A>T p.n167i Missense 73 RNF43 W12 CCDS g.chr17: C>T c.2167 C>T p.q723x Nonsense 74 ROBO2 B011 CCDS g.chr3: C>A c.1370 C>A p.t457n Missense 75 ROBO2 B011 CCDS g.chr3: G>A c.2189 G>A p.r730h Missense 76 ROBO2 B011 CCDS g.chr3: C>T c.2647 C>T p.r883x Nonsense 77 ROBO2 B011 CCDS g.chr3: A>C c.2493 A>C p.831 I>I Synonymous 78 ROBO2 W039 CCDS g.chr3: insC c.3234 insc fs Indel 37

38 Supplementary Table 13 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs No Gene Symbol Sample Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 79 ROBO2 T026 CCDS g.chr3: C>T c.1585 C> T p.q529x Nonsense 80 ROBO2 A159 CCDS g.chr3: T>A c.3999 T>A p.s1322r Missense 81 ROBO2 Y020 CCDS g.chr3: G>T c.712 G>T p.e238x Nonsense 82 ROBO2 T003 CCDS g.chr3: C>T c.2039 C>T p.a680v Missense 83 SMAD4 B103 CCDS g.chr18: G>T c.212 G>T p.c71f Missense 84 SMAD4 A064 CCDS g.chr18: delg c.568 delg fs Indel 85 SMAD4 A153 CCDS g.chr18: c.1005_1022 del delaggagagacatttaaggt AGGAGAGACATTTAAGGT In frame Indel 86 SMAD4 D017 CCDS g.chr18: C>T c.1081 C>A p.r361s Missense 87 SMAD4 A011 CCDS g.chr18: G>C c.1082 G>C p.r361p Missense 88 SMAD4 C054 CCDS g.chr18: deltcaact c.1095_1116 deltcaactc CTCCAATGTCCACAGG TCCAATGTCCACAGG fs Indel 89 SMAD4 A004 CCDS g.chr18: G>T c.1116 G>T p.r372s Missense 90 SMAD4 C164 CCDS g.chr18: C>T c.1333 C>T p.r445x Nonsense 91 SMAD4 D029 CCDS g.chr18: deltta c.1536_1538 del TTA In frame Indel 92 SMAD4 C061 CCDS g.chr18: delac c.1563_1564 del AC fs Indel 93 SMAD4 A169 CCDS g.chr18: G>T c.1612 G>T p.e538x Nonsense 94 SMAD4 C080 CCDS g.chr18: insa c.1588 ins A fs Indel 95 SMAD4 B011 CCDS g.chr18: G>A c.573 G>A p.s191s Synonymous 96 SMAD4 A080 CCDS g.chr18: T>A c.1047 T>A p.t349t Synonymous 97 SMAD4 A039 CCDS g.chr18: T>C c633 T>C p.t211t Synonymous 98 SMAD4 A105 CCDS g.chr18: delga c.90 delga fs Indel 99 SMAD4 A159 CCDS g.chr18: G>A c.988 G>A p.e330k Missense 100 SMAD4 A035 CCDS g.chr18: A>G c.1659 A>G p.x553w Missense 101 SMAD4 B070 CCDS g.chr18: C>T c.346 C>T p.q116x Nonsense 102 SMAD4 B099 CCDS g.chr18: T>C c.428 A>C p.k428t Missense 103 SMAD4 B149 CCDS g.chr18: G>A c.404 G>A p.r135q Missense 104 SMAD4 B149 CCDS g.chr18: C>T c.1081 C>T p.r361c Missense 38

39 Supplementary Table 13 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs No Gene Symbol Sample Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 105 SMAD4 R104 CCDS g.chr18: delagta c.1447 delagta fs Indel 106 SMAD4 U044 CCDS g.chr18: C>T c.547 C>T p.q183x Nonsense 107 SMAD4 W012 CCDS g.chr18: G>T c.394 C>G p.h132d Missense 108 TP53 D029 CCDS g.chr17: insa c.211 inst fs Indel 109 TP53 A011 CCDS g.chr17: C>A c.314 G>T p.g105v Missesne 110 TP53 C164 CCDS g.chr17: C>A IVS4+1 G>T Splice site Splice site 111 TP53 C154 CCDS g.chr17: C>T IVS4-1 G>A Splice site Splice site 112 TP53 A153 CCDS g.chr17: C>T c.524 G>A p.r175h Missesne 113 TP53 C061 CCDS g.chr17: C>T c.524 G>A p.r175h Missesne 114 TP53 C110 CCDS g.chr17: G>T c.534 C>A p.h178q Missesne 115 TP53 A064 CCDS g.chr17: T>C c.614 A>G p.y205c Missesne 116 TP53 B005 CCDS g.chr17: A>C c.581 T>G p.l194r Missesne 117 TP53 C176 CCDS g.chr17: C>T c.713 G>A p.c238y Missesne 118 TP53 C008 CCDS g.chr17: c.735_749 delcatga delggcctccggttcatg ACCGGAGGCC In frame Indel 119 TP53 C045 CCDS g.chr17: inscagtgtgat c.763 insatcacactg In frame Indel 120 TP53 D017 CCDS g.chr17: C>T c.814 G>A p.v272m Missesne 121 TP53 C144 CCDS g.chr17: G>A c.817 C>T p.r273c Missesne 122 TP53 A080 CCDS g.chr17: G>A c.817 C>T p.r273c Missesne 123 TP53 C095 CCDS g.chr17: C>T c.818 G>A p.r273h Missesne 124 TP53 C080 CCDS g.chr17: C>T c.818 G>A p.r273h Missesne 125 TP53 A004 CCDS g.chr17: C>T c.853 G>A p.e285k Missesne 126 TP53 A114 CCDS g.chr17: C>T c.856 G>A p.e286k Missesne 127 TP53 A042 CCDS g.chr17: delt c.582 delt fs Indel 128 TP53 A105 CCDS g.chr17: T>G c.981 T>G p.y327x Nonsense 129 TP53 A107 CCDS g.chr17: A>G c.578 A>G p.h193r Missense 130 TP53 A119 CCDS g.chr17: C>T c.844 C>T p.r282w Missense 131 TP53 A120 CCDS g.chr17: G>A c.818 G>A p.r273h Missense 132 TP53 A142 CCDS g.chr17: G>A c.673 G>A p.v225i Missense 39

40 Supplementary Table 13 (continued). Somatic mutations in frequently mutated genes including BAP1, ARID1A, IDH1, IDH2, TP53, KRAS, SMAD4, MLL3, RNF43, GNAS and ROBO2 in 108 O. viverrini-associated CCAs No Gene Symbol Sample Transcript Accession ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type 133 TP53 A159 CCDS g.chr17: C>T c.916 C>T p.r306x Nonsense 134 TP53 A162 CCDS g.chr17: A>G c.395 A>G p.k132r Missense 135 TP53 B032 CCDS g.chr17: C>G c.832 C>G p.p278s Missense 136 TP53 B070 CCDS g.chr17: C>T c.707 C>T p.y236c Missense 137 TP53 B083 CCDS g.chr17: T>C c.403 T>C p.c135r Missense 138 TP53 B099 CCDS g.chr17: G>T & inst c.686 G>T & ins T fs Indel 139 TP53 R134 CCDS g.chr17: G>T c.1027 G>T p.e343x Nonsense 140 TP53 R149 CCDS g.chr17: G>A c. 853 G>A p.e285k Missense 141 TP53 T157 CCDS g.chr17: G>A c.375 G>A p.t125t Synonymous 142 TP53 T026 CCDS g.chr17: insG c.216 insg fs Indel 143 TP53 U044 CCDS g.chr17: G>A c.310 C>T p.q104x Nonsense 144 TP53 W012 CCDS g.chr17: G>A c.742 C>T p.r248w Missense 145 TP53 W040 CCDS g.chr17: insT c.716 ins T fs Indel 146 TP53 Y002 CCDS g.chr17: C>T c.586 C>T p.r196x Nonsense 147 TP53 Y008 CCDS g.chr17: G>A c.644 G>A p.s215n Missense 148 TP53 Y020 CCDS g.chr17: T>G c.489 T>G p.y163x Nonsense 149 TP53 Y035 CCDS g.chr17: C>T c.817 C>T p.r273c Missense 150 TP53 Y072 CCDS g. chr17: _ del c. del 750bp fs Indel 151 TP53 Y149 CCDS g.chr17: C>T c.817 C>T p.r273h Missense 152 GNAS A157 CCDS g.chr20: C>T c.601 C>T p.r201c Missense 153 GNAS A074 CCDS g.chr20: G>T c.602 G>T p.r201l Missense 154 GNAS B149 CCDS g.chr20: C>T c.601 C>T p.r201c Missense 155 GNAS T026 CCDS g.chr20: C>T c.601 C>T p.r201c Missense 156 GNAS W012 CCDS g.chr20: C>T c.601 C>T p.r201c Missense 157 GNAS Y149 CCDS g.chr20: G>A c.602 G>A p.r201h Missense Data previously reported by Ong et al. 1 is highlighted. 40

41 Supplementary Table 14. Sequencing primers for the evaluation of BAP1, IDH1 and IDH2 mutations by Sanger sequencing Gene Primer Name Primer sequence (5' -> 3') Region BAP1 IDH1 IDH2 BAP1-Ex1_3-F BAP1-Ex1_3-R BAP1-Ex1-seq-R BAP1-Ex2_3-seq-F BAP1-Ex4-F BAP1-Ex4-R BAP1-Ex5-F BAP1-Ex5-R BAP1-Ex6-7-F BAP1-Ex6-7-R BAP1-Ex8-F BAP1-Ex8-R BAP1-Ex9-F BAP1-Ex9-R BAP1-Ex10-F BAP1-Ex10-R BAP1-Ex11-F BAP1-Ex11-R BAP1-Ex12-F BAP1-Ex12-R BAP1-Ex13-F BAP1-Ex13-R BAP1-Ex14-F BAP1-Ex14-R BAP1-Ex15-16-F BAP1-Ex15-16-R BAP1-Ex15-16-seq-F BAP1-Ex17-F BAP1-Ex17-R IDH1-Ex2-F IDH1-Ex2-R IDH2-Ex4-F IDH2-Ex4-R GTCCGACAGGCGGAAGACGAG CAAGGCTGCTGCTTTCTGTGAG CGAAATCTTCCACGAGCAG GAATAAGGGCTGGCTGGAG CACTTCAGACACAGTGTTGGGAAG CGTTCTGCCAGAGGATTTCTGTAG GAGTTGTCCAGATATGACTGACCTG GGAAACTCTCCTCCCTCCCTAG GTTCGTCTGTGTTCCTTCCGATTC CTGGTCGGGCAATATGGTGTAG CTACACCATATTGCCCGACCAG CTAAGCCTGATCTTGCCAGATTCAC GTGCCTGGCATGTATGGCTAGTC GTGGTTAGCTGAAGCCCAGATC CTGTGAGTGAATGGGTAGAGCCAAG CTGCTCTCCCTCTACCTTCTGAC CTTAGAGCTTGCTGACTCCCATTG CATATCAGGCAGAGGAACCTAGCAAC CTATCCAGTGTAAGTGGGTGGCAG CTCCGCAGGTGCTCAACATTATC GTTGCTTGGACCAAGTATAAGGAG CTCTGGGAAGAGAGGTCACAAG GACAGGTGGGCCTTGGACTG CAACCCAGAAAGTCTTCTGGCAC GTGCCAGAAGACTTTCTGGGTTG CAGGGCATTCCAGTTAAGACAG CTTGATAGGCATGGACTCGCTG CTGTCTTAACTGGAATGCCCTG CTGGTTCCTCCCATTCCCAG ATGAGAAGAGGGTTGAGGAGTT TGTTGAGATGGACGCCTATTTGT GTTGCTTGGGGTTCAAATTCTGG TGTCAAGGAGTGGGAAGTGTAC PCR product size (bp) Ex Ex4 430 Ex5 450 Ex Ex8 333 Ex9 410 Ex Ex Ex Ex Ex Ex Ex Ex2 393 Ex

42 Supplementary Table 15. A list of hotspots in KRAS, IDH1 and IDH2 sequenced by ultra-deep amplicon sequencing Gene Transcript ID Hotspot Region p.k5 KRAS ENST p.g10 p. A11 p.g12 p.g13 p.v14 p.l19 p.t58 Exon2 p.a59 p.g60 p.q61 p.e63 p.k117 p.a146 Exon3 Exon4 p.g70 IDH1 CCDS p.v71 p. I99M p.r100 p.r132 Exon2 IDH2 CCDS p.r140 p.r172 Exon4 42

43 Supplementary Table 16. Sequencing primers for the evaluation of KRAS, IDH1 and IDH2 mutations by ultra-deep amplicon sequencing Gene Region Primer Name Primer sequence (5' -> 3') Exon2 Exon3 KRAS Exon4 KRAS-Ex2-1F-N1 TTATAAGGCCTGCTGAAAATGACTGAA KRAS-Ex2-1R-N1 CCTCTATTGTTGGATCATATTCGTCC KRAS-Ex2-2F-N1 GTGTATTAACCTTATGTGTGACATGTTCT KRAS-Ex2-2R-N1 CTGAATTAGCTGTATCGTCAAGGCAC KRAS-Ex2-3F-N1 CTGGTGGAGTATTTGATAGTGTATTAACC KRAS-Ex2-3R-N1 GTCAAGGCACTCTTGCCTACG KRAS-Ex2-4F-N1 GCCTGCTGAAAATGACTGAATATAAAC KRAS-Ex2-4R-N1 GGTCCTGCACCAGTAATATGCA KRAS-Ex3-1F-N1 TCAGGATTCCTACAGGAAGCAAGTAG KRAS-Ex3-1R-N1 TGGCAAATACACAAAGAAAGCC KRAS-Ex3-2F-N1 GTAATAATCCAGACTGTGTTTCTCCCT KRAS-Ex3-2R-N1 TCCCCAGTCCTCATGTACTGGTC KRAS-Ex3-3F-N1 GTGTTTCTCCCTTCTCAGGATTCC KRAS-Ex3-3R-N1 CAAAGAAAGCCCTCCCCAGTC KRAS-Ex4a-1F-N1 CCCAGAGAACAAATTAAAAGAGTTAAGG KRAS-Ex4a-1R-N1 CCATAACTTCTTGCTAAGTCCTGAGC KRAS-Ex4a-2F-N1 AAAGAGTTAAGGACTCTGAAGATGTACC KRAS-Ex4a-2R-N1 CCTGTCTTGTCTTTGCTGATGTTTC KRAS-Ex4a-3F-N1 CTGAAGATGTACCTATGGTCCTAGTAGG KRAS-Ex4a-3R-N1 CAGTGTTACTTACCTGTCTTGTCTTTGC KRAS-Ex4a-4F-N1 GCTCAGGACTTAGCAAGAAGTTATGG KRAS-Ex4a-4R-N1 CAGTTATGATTTTGCAGAAAACAGATC KRAS-Ex4a-5F-N1 GAACAGTAGACACAAAACAGGCTCAG KRAS-Ex4a-5R-N1 CAGTTATGATTTTGCAGAAAACAGATC KRAS-Ex4a-6F-N1 GGACTTAGCAAGAAGTTATGGAATTCC KRAS-Ex4a-6R-N1 CCTAGTATAGCATAATTGAGAGAAAAACTG PCR product size (bp)

44 Supplementary Table 16 (continued). Sequencing primers for the evaluation of KRAS, IDH1 and IDH2 mutations by ultra-deep amplicon sequencing Gene Region Primer Name Primer sequence (5' -> 3') PCR product size (bp) IDH1 IDH2 Exon2 Exon4 IDH1-G F IDH1-G R IDH1-G F IDH1-G R IDH1-G F IDH1-G R IDH1-R100-1F IDH1-R100-1R IDH1-R100-2F IDH1-R100-2R IDH1-R100-3F IDH1-R100-3R IDH1-R132-1F IDH1-R132-1R IDH1-R132-2F IDH1-R132-2R IDH1-R132-3F IDH1-R132-3R IDH2-R140-1F IDH2-R140-1R IDH2-R140-2F IDH2-R140-2R IDH2-R140-3F IDH2-R140-3R IDH2-R172-1F IDH2-R172-1R IDH2-R172-2F IDH2-R172-2R IDH2-R172-3F IDH2-R172-3R CACCAACGACCAAGTCACCAAG GAATATTTCGTATGGTGCCATTTGG AATCGTGATGCCACCAACGAC CCATTTGGTGATTTCCACATTTG GCTATGATTTAGGCATAGAGAATCGTG TGAACTCCTCAACCCTCTTCTCATC GATGAGAAGAGGGTTGAGGAGTTCA GGTTTTACCCATCCACTCACAAGC AGGAGTTCAAGTTGAAACAAATGTGG ATAAGCATGACGACCTATGATGATAGG TCAAATGTGCCACTATCACTCCTGA GCAGATAATGGCTTCTCTGAAGACC GGCACCATACGAAATATTCTGGG TGCCAACATGACTTACTTGATCCC GAAATATTCTGGGTGGCACGGTC CATGCAAAATCACATTATTGCCAAC GGTCTTCAGAGAAGCCATTATCTGC GCAAAATCACATTATTGCCAACATGAC GTTGAAAGATGGCGGCTGCA ATGGGCTCCCGGAAGACAGT TATCTCTGTCCTCACAGAGTTCAAGCT TGGTGATGGGCTTGGTCCAG CAGAGTTCAAGCTGAAGAAGATGTGG GTGCCTGCCAATGGTGATG TCATCTGCAAAAACATCCCACG AAGAGGATGGCTAGGCGAGGAG CCTAGTCCCTGGCTGGACCAA CTTGTACTGCAGAGACAAGAGGATGG GGAGCCCATCATCTGCAAAAAC AGGTCAGTGGATCCCCTCTCCA

45 Supplementary Table 17. A list of sirnas Gene sirna sirna code Vendor ARID1A Individual sirna_1 ON-TARGETplus ARID1A sirna (J ) Dharmacon, IL ARID1A Individual sirna_2 ON-TARGETplus ARID1A sirna (J ) Dharmacon, IL ARID1A Individual sirna_3 ON-TARGETplus ARID1A sirna (J ) Dharmacon, IL BAP1 Individual sirna_1 ON-TARGETplus BAP1 sirna (J ) Dharmacon, IL BAP1 Individual sirna_2 ON-TARGETplus BAP1 sirna (J ) Dharmacon, IL BAP1 Individual sirna_3 ON-TARGETplus BAP1 sirna (J ) Dharmacon, IL BAP1 SMARTpool ON-TARGETplus BAP1 sirna (L ) Dharmacon, IL Control Scrambled sirna ON-TARGETplus Non-targeting sirna #1 (D ) Dharmacon, IL 45

46 Supplementary Table 18. A list of antibodies Antibody Catalog number Type Provider Mouse Anti-Human-ARID1A sc (PSG3) Monoclonal Santa Cruz Biotechnology Mouse Anti-Human-BAP1 sc (C-4) Monoclonal Santa Cruz Biotechnology Mouse Anti-Human-β-Actin A5441 (clone AC-15) Monoclonal Sigma-Aldrich Goat Anti-Mouse IgG (H+L)-HRP HRP Conjugate Bio-Rad Goat Anti-Human IgG (H+L)-HRP HRP Conjugate Zymed 46

47 Nonsense 8.2% Indel 8.6% Splice site 4.5% Missense 78.8% Mutation Type Number Missense 193 Nonsense 20 Indel 21 Splice site 11 Total 245 Supplementary Figure 1. Illustration of mutation types in 15 non-o. viverrini-associated CCA exomes. Majority of somatic mutations identified in the tumors analyzed are missense while a relatively small fraction of mutations comprised of indels, nonsense and splice site mutations. 47

48 Supplementary Figure 2. Mutation spectra of 15 non-o. viverrini-associated CCAs compared to 8 O. viverrini-associated CCAs. Mutations belonging to the different categories are represented. (a) Non-O. viverrini-associated CCAs display a dominant C>T or G>A spectrum (left panel) that commonly occurs at CpG dinucleotides (right panel). (b) Similar mutation spectrum is observed in O. viverrini-associated CCAs. 48

49 49

50 50

51 51

52 52

53 53

54 54

55 55

56 Supplementary Figure 3. Analysis of copy number alterations in 15 discovery samples. The plots demonstrate Affymetrix SNP Array 6.0 data from paired tumor and non-tumor DNA analyzed by ASCAT 2.0 (Allele-Specific Copy number Analysis of Tumors, see Online Methods). Log R ratio (Top panel) represents the log base 2 of the ratio of total signal intensity of the tumor sample and of the matched non-tumor sample. Each red dot represents the Log R value at a heterozygous position in the non-tumor sample. The green dots show the segmentation (i.e. smoothing) of these data. B Allele Frequency (Middle panel) demonstrates the relative presence of each of the two alternative nucleotides at each SNP locus in the tumor sample, at sites that are heterozygous in the matched non-tumor sample. The green dots, which are analogous to the Log R ratio, show the segmentation of these data. The regions where the green dots are simultaneously displaced to values higher and lower than 0.5 are regions of LOH or allelic imbalance (more or fewer copies of one allele than the other). Allele Specific Copy Numbers (Bottom panel) shows the estimated genomic copy number of the two parental copies of each chromosome along the y-axis (red: major allele copy number, green: minor allele copy number). 56

57 There is a wide spread of green dots observed across multiple chromosomes in all the 16 discovery samples (a-o) including the samples that harbored 5 somatic mutations (g-j), indicating allelic imbalance or copy number alterations in these samples. Figure a-c refers to ARID1A mutated tumors ( , and 3001, respectively). Figure d-g refers to BAP1 mutated tumors ( , , and , respectively). In ARID1A mutated tumors (a-c), green dots are widely separated at the short arm of chromosome 1 (arrow). Similarly, there is a wide spread of green dots at the short arm of chromosome 3 (arrow) in BAP1 mutated tumors (d-g). These indicate allelic imbalance in both cases. Allele Specific Copy Numbers (Bottom panel) shows the estimated genomic copy number of the two parental copies of each chromosome along the y-axis (red: major allele copy number, green: minor allele copy number). ASCAT shows that one parental chromosome at chromosome 1p (including the region of ARID1A) and at chromosome 3p (including the region where BAP1 is located) is deleted. 57

58 58

59 59

60 Supplementary Figure 4. Enhancement in cell proliferation rates in ARID1A- and BAP1- silenced cells using multiple individual sirnas. Knock-down of ARID1A (a-c) and BAP1 (d-f) using non-overlapping sirnas in three cell lines consistently promoted cell proliferation. Depletion of ARID1A and BAP1 was confirmed by Western blot after 72 hours of sirna treatment. Relative proliferation rates were compared against a scrambled sirna control (sicontrol). All the results are expressed as mean ± SEM of at least three independent experiments. Error bars, SEM (standard error of the mean). P-values were computed by onesided paired t-tests on the data at day 5. * indicates P < 0.05, ** indicates P <

61 Supplementary Figure 5. Quantification of BAP1 transcript levels in BAP1 over-expressing cells. Expression of BAP1 was assessed by real-time PCR due to lack of specific antibody against truncated BAP1 mutant protein. BAP1 transcript levels in H69 (a), EGI-1 (b) and HuCCT-1 cells (c) transfected with wild-type (WT) or mutant BAP1 (K453f.s) are higher compared to the empty vector (mock) treated control cells. This indicates that both the wild-type and the mutant BAP1 were successfully expressed in the cells tested. Error bars, SEM (N = 3). 61

62 62