High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA
|
|
- Roderick Foster
- 5 years ago
- Views:
Transcription
1 High Throughput Screening as a Research Tool Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA
2 Structure of this seminar Applications of High Throughput Screening The Drug Discovery Workflow old and new Adaptive Diseases Case Study: Biofilms Case Study: Prostate Cancer Case Study: Cancer Stem Cells
3 High Throughput Screening as a Research Tool Functional Genomics sirna Screens Lentiviral Screens cdna screens Drug Discovery Targeted Libraries Druglike Libraries Diverse Libraries HighThroughput Screening Materials Characterization Automated Toxicity Profiling Profiling on Live Cells Using Functional/Chemical Genomics Chemical Genomics FDA Approved Drugs Bioactives Natural Products Materials Discovery Highthroughput Chemistry Highthroughput QC
4 Target Centric Drug Discovery pregenomic Disease Disease relevant process Disease modifying target High Throughput Screening Campaign
5 Drug Discovery postgenomic Disease Disease relevant process, pathway or phenotype High Throughput Screening Campaign Target Discovery
6 What changed? More targets are known than can be reasonably screened Not all players in a disease relevant pathway are known or accessible for screening Novel technology such as High Content Screening (HCS) allows for black box screening approaches Target discovery for hits from screens has become more feasible using Functional Genomics using High Throughput Screening
7 General Screening Workflow Integrated Novel Target Screening Strategy Assay Technology Library Choice Taken from: Molecular Screening by R. Damoiseaux, Ph.D. in Development of Therapeutic Agents Handbook Forthcoming from Wiley and Sons Novel Target(s) Screen Validation and Execution Small Molecule Probe for Chemical Genomics Target Discovery Data Mining,rescreening and secondary screening Novel agonist or antagonist Unknown Target Further specificity profiling Known Target Compound rejected Lead discovery
8 Using HTS as a Research Tool Adaptive Diseases diseases which are able to adjust to the selective pressure exerted by the treatment with drugs. Examples: Cancer: e.g. occurrence of resistance to chemotherapy Infectious diseases: occurrence of resistance to e.g. anti virals, antibiotics etc.
9 Overcoming Adaptive Diseases Examples: HIV: Development of HAART Cancer Therapy: Multidrug therapy Acute Disease Chronic Disease
10 HTS as Research tool : Case Studies Biofilm: Modulation A macroscopic of Bacterial structure Biofilms by on compounds a biological and (e.g. drugs mucous membrane) or inert surface consisting of bacteria and extracellular matrix Prostate consisting Cancerof polyglycans. Cancer Biofilms Stem are not cellseasily permeated by antibiotics Biofilms are not easily accessible to the immune system Biofilms are a bacterial resistance mechanism causing many problems in the medical area.
11 Biofilm assay examples BFU media control Biofilm In a 384 well plate biofilm forming Haemophilus Influencae bacteria or media control were incubated over night, the resulting biofilm detected in a fully automated fashion.
12 Biofilm assay examples % Biofilm Modulation % Biofilm Modulation 70 0 Frequency 0 Frequency A set of about 2 k compounds was incubated with biofilm forming bacteria and the amount of biofilm production measured.
13 Biofilm assay examples Bacteriocidal and biofilm stimulating Bacteriocidal and not biofilm stimulating
14 Exploring the HER kinase androgen receptor interaction in prostate cancer Using Chemical Genomics to explore the HER kinase axis in Prostate Cancer
15 In 2008, an estimated 186,320 new cases will occur in the US. Prostate cancer is the most frequently diagnosed cancer and the leading cause of cancer death in men with an estimated 28,660 deaths in 2008 alone. American Cancer Society
16 ADPC Androgendependent prostate cancer PSA PSA AIPC Androgenindependent prostate cancer PSA
17 Activation of growth promoting signaling pathways: BCL2 antiapoptotic pathway Protein kinase A Phosphatidylinositol 3 kinase Ras/Raf/MAPK Receptor tyrosine kinases
18 Activation of growth promoting signaling pathways: BCL2 antiapoptotic pathway Protein kinase A Phosphatidylinositol 3 kinase Ras/Raf/MAPK Receptor tyrosine kinases Activating HER2/HER3 dimerization supports prostate cancer progression.
19 Cell membrane HER1 HER2 HER3 HER4 HRG 2C4 HRG HER2 HER3 HER2 HER3 P P Cell death No Cell death
20 Relative luminescence lightoutput 500K 450K 400K 350K 300K 250K 200K 150K 100K 50K A: Bar Graph 25nM HRG 50nM HRG 0 No treatment 2C4 HRG HRG+2C4 B: Scatter Plot Zfactor = 0.65 HRG HRG+2C Sample Replicates
21 AD AI AI
22 Mechanism of HRG induced cell kill Starved HRG 2C4 What is the mechanism of HRG induced cell kill in LNCap cells? Why does it occur in the LNCap AD prostate cancer cell model and not in the isogenic AI models?
23 Figure 3C: Representative cellular pictures with various treatments (Hoechst 33342PIstained cells). Control 2C4 R1881 EGF4 HRG2.5 2C4+HRG2.5 R1881+HRG2.5
24 Develop a highthroughput assay to effectively screen for compounds that rescue LNCap cells from HRG induced cell kill. Prestwick Chemical Library 1120 molecules dissolved in DMSO 90% are marketed drugs Biomol bioactive lipid library 201 bioactive lipids Biomol enzyme library Kinase phosphatase inhibitors (80 known kinase inhibitors and 33 known phosphatase inhibitors)
25 384 well highthroughput format 1200 cells/well are plated in RPMI/10%serum. 10μM compound is added the next day followed by 10nM HRG. 24hrs later viable cells are quantified using the ATPlite 1step, single addition luminescence ATP detection Assay system. Percent viability of cells is calculated with respect to DMSO treated cells. Normalized data is uploaded in the CDD database to screen for hits.
26 HRG High viability Low viability DMSO control
27 HRG: average viability: 25.5 %
28
29 Add EGFR inhibitor
30 Prestwick compounds Rescuing Heregulin induced Prostate Cell Kill Glucocorticoid steroid C 21 steroid hormone Hormone precursor to aldosterone Cardenolide Corticosteroid Topical corticosteroids
31 C4 R1881+ HRG25 R1881+HRG2.5 R1881 R1881+2C4 EGF4+2C4 EGF4 HRG 25+ 2C4 HRG C4 HRG 25nM HRG 2.5nM Control Percent PI positive LNCaP cells (Percent cellular killing normalized to total cell number)
32 AR amplifications and mutations have been involved in AI prostate cancer. androgens AR HSP HSP AR AR AR nucleus AR AR
33 Normalized Relative LUC Activity PSA promoter TATA Luciferase Zfactor = R1881(1) HRG(2.5) HRG(25) 2C
34 Develop a highthroughput luminescence assay to detect cell viability in prostate cancer cells and identify several compounds and categories of compounds namely steroids that prevent HRG induced cell kill. Use compound screening to connect two pathways together, to better understand the biology of HER2/HER3 mediated cell kill in AD prostate cancer cells.
35 HRG HER2 HER3 androgens P P AR HSP HSP AR AR AR Cell death nucleus AR AR
36 HRG HER2 HER3 androgens P P AR HSP HSP AR AR AR Cell death nucleus AR AR
37 Identify molecules involved in connecting the HER2/HER3 and AR pathway by using sirna and overexpression screens. Create several options to successfully inhibit AR in advanced prostate cancer patients.
38 Jack Altura, Talar Kechichian CSMC Robert D. Damoiseaux MSSR UCLA Barry A Bunin CDD Kellan Gregory CDD NIH Prostate Cancer Foundation
Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway
Pre-made Reporter for JAK-STAT Signaling Pathway Cat# Product Name Amounts LVP937-P or: LVP937-P-PBS ISRE-GFP (Puro) LVP938-P or: LVP938-P-PBS ISRE-RFP (Puro) LVP939-P or: LVP939-P-PBS ISRE-Luc (Puro)
More informationIdentification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.
Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification
More informationFOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
More informationBowel Disease Research Foundation
Research Project Annual Report Lead investigator Dr Ricky Sharma Institution Department of Oncology, University of Oxford Project Title Making radiotherapy for rectal cancer more effective by identifying
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationPre-made Reporter Lentivirus for MAPK/ERK Signal Pathway
Pre-made Reporter for MAPK/ERK Signal Pathway Cat# Product Name Amounts LVP957-P or: LVP957-P-PBS SRE-GFP (Puro) LVP958-P or: LVP958-P-PBS SRE-RFP (Puro) LVP959-P or: LVP959-P-PBS SRE-Luc (Puro) LVP960-P
More informationCellular Screening in 2D and 3D. Identification of cancer specific modulators. ELRIG.de, March 2013
Cellular Screening in 2D and 3D Identification of cancer specific modulators ELRIG.de, March 2013 Introduction International FP7 program Aim is the identification of novel compounds with anti-cancer properties
More informationValidation & Assay Performance Summary
Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation
More informationDevelopment of Screening Tools to Identify Nicotinic Subtype-Selective Compounds
Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds Glenn Kirsch, PhD Discovery Services Charles River Cleveland, Ohio USA Aurora Ion Channel Retreat July 7-9, 2015 Tobacco
More informationSupplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*
Supplementary Information for Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling Elissaveta Petrova 1,5, Jessica Rios-Esteves 1,2, Ouathek Ouerfelli 3, J. Fraser Glickman 4, and Marilyn
More informationNature Biotechnology: doi: /nbt.2435
Supplementary Figure 1: Characterization of expanded FD-NC. a, Survival rate after thawing of frozen FD-NC. b, Population doubling time of expanded FD-NC. c, Cell cycle analysis of expanded FD-NC. d, Representative
More informationPre-made Reporter Lentivirus for NF-κB Signal Pathway
Pre-made Reporter for NF-κB Signal Pathway Cat# Product Name Amounts LVP965-P or: LVP965-P-PBS NFKB-GFP (Puro) LVP966-P or: LVP966-P-PBS NFKB-RFP (Puro) LVP967-P or: LVP967-P-PBS NFKB-Luc (Puro) LVP968-P
More informationA High-Content Biosensor-Based Screen Identifies Cell-Permeable Activators and Inhibitors of EGFR Function: Implications in Drug Discovery
446174JBXXXX10.1177/1087057112446174An tczak et al.journal of Biomolecular Screening 2012 A High-Content Biosensor-Based Screen Identifies Cell-Permeable Activators and Inhibitors of EGFR Function: Implications
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationSupplementary materials
Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds
More informationGlucose Assay Kit. Catalog Number KA assays Version: 07. Intended for research use only.
Glucose Assay Kit Catalog Number KA0831 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials Supplied...
More information7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview
Emerging mutations as predictive biomarkers in lung cancer: Overview Kirtee Raparia, MD Assistant Professor of Pathology Cancer Related Deaths: United States Men Lung and bronchus 28% Prostate 10% Colon
More informationCell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule
Cell Communication Cell Communication Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the ligand binds (may be on the plasma membrane or within
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationChemistry 106: Drugs in Society Lecture 19: How do Drugs Elicit an Effect? Interactions between Drugs and Macromolecular Targets 11/02/17
Chemistry 106: Drugs in Society Lecture 19: How do Drugs Elicit an Effect? Interactions between Drugs and Macromolecular Targets 11/02/17 Targets for Therapeutic Intervention: A Comparison of Enzymes to
More information~Lentivirus production~
~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce
More informationPage 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION
Page 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION 1. Feedback a. Negative feedback mechanisms maintain dynamic homeostasis for a particular condition (variable) by regulating physiological processes,
More informationGenome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department
Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause
More informationCONTRACTING ORGANIZATION: University of Michigan Medical School Ann Arbor, MI
AD Award Number: W81XWH-11-1-0219 TITLE: Multiplexed Promoter-dependent Screen for Selective Androgen Receptor Modulators PRINCIPAL INVESTIGATOR: Diane M. Robins, Ph.D. CONTRACTING ORGANIZATION: University
More informationSupplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
More informationIn Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines
In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationTITLE: Establishing a Role for Ecto-phosphatases in Multidrug Resistance in Breast Cancer
»- < AD Award Number: DAMD17-00-1-0694 TITLE: Establishing a Role for Ecto-phosphatases in Multidrug Resistance in Breast Cancer PRINCIPAL INVESTIGATOR: Alan M. Lloyd, Ph.D. CONTRACTING ORGANIZATION: The
More informationSteps to writing a lab report on: factors affecting enzyme activity
Steps to writing a lab report on: factors affecting enzyme activity This guide is designed to help you write a simple, straightforward lab report. Each section of the report has a number of steps. By completing
More informationLecture 1: Carcinogenesis
Lecture 1: Carcinogenesis Anti-cancer (oncology agents): These are perhaps the most dangerous of drugs, other than the narcotic analgesics. This is due to their toxicities. Killing or inhibiting cancer
More informationNew Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일
New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일 Castrate-Resistant Prostate Cancer (CRPC) Current standard therapy Androgen receptor (AR) in CRPC New systemic therapies Hormonal therapy
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationData Sheet. Notch Pathway Reporter Kit Catalog # 60509
Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling
More informationDiagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
More informationProtocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic
More informationUNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD
More informationReport on the Development of HP8 a Natural Herbal Formulation for Prostate Health
P. G. Waterman Product Development Report for HP8 page 1 Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health Prepared for InterHealth Biosciences Australia (IBA) by Professor
More informationTITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer
AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health
More informationBL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:
More informationPropagation of the Signal
OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More informationSystem. xcelligence System RTCA HT Instrument. Application Note No. 14 /January Long-Term High-Throughput Cytotoxicity Profiling
System Application Note No. 14 /January 2013 xcelligence System RTCA HT Instrument Long-Term High-Throughput Cytotoxicity Profiling For life science research only. Not for use in diagnostic procedures.
More informationTITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The
More informationChallenges to Drug Development in Academia. Charles L. Sawyers, M.D.
Challenges to Drug Development in Academia Charles L. Sawyers, M.D. Chair, Human Oncology and Pathogenesis Program (HOPP) Investigator, Howard Hughes Medical Institute Memorial Sloan-Kettering Cancer Center;
More informationPoster#8. December 7 th 2017
Poster#8 Advanced Development and Validation of 3D Spheroid Culture of Primary Cancer Cells using Nano3D Technology This work is supported by the NCI IMAT Award R33 CA26949 Assist. Prof. Timothy Spicer-
More informationPlate-Based Assay Methods for the Assessment of Cellular Health
Plate-Based Assay Methods for the Assessment of Cellular Health Andrew L. Niles, Senior Research Scientist 2012, Promega Corporation. Biological Outcomes in Cell Culture Treatment -Small molecule -Bio-molecule
More informationIntroduction. Figure 1 Experimental Strategy
Beyond s: Interrogating the Purinome Tony A. Klink, Karen Kleman-Leyer, Matt Staeben, Robert G. Lowery BellBrook Labs, Madison, Wisconsin, USA 53711 Introduction The development of ATP-site ligands as
More informationLecture 1: Carcinogenesis
Lecture 1: Carcinogenesis Anti-cancer (oncology agents): These are perhaps the most dangerous of drugs, other than the narcotic analgesics. This is due to their toxicities. Killing or inhibiting cancer
More informationSupplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
More informationViruses. Picture from:
Viruses Understand the structure of bacteriophages & human immunodeficiency virus (HIV) Appreciate that viruses replicate in host cells (thereby destroying them) Picture from: http://eands.caltech.edu/articles/lxvii1/viruses.html
More informationThe Application of Cell-Based Impedance Technology in Drug Discovery
The Application of Cell-Based Impedance Technology in Drug Discovery Yama A. Abassi, PhD Sr. Director Cell Biology and Assay Development ACEA Biosciences ACEA Biosciences Founded in early Located in San
More informationCRYOSENSITIZERS: Ablation at the Edge
CRYOSENSITIZERS: Ablation at the Edge John G. Baust Institute of Biomedical Technology State University of New York Binghamton, NY USA JGBaust@binghamton.edu Precision targeting Challenge Uncertain margin
More informationBacterial Survival In Synovial Fluid: Is S. aureus in the Knee Joint Persisting Despite Antibiotic Treatment?
Bacterial Survival In Synovial Fluid: Is S. aureus in the Knee Joint Persisting Despite Antibiotic Treatment? Sana Dastgheyb 1, Sommer Hammoud 2, Constantinos Ketonis, MD 3, James Purtill, MD 3, Michael
More informationOris Assays: An Innovative Platform for the Study of Cell Migration & Cell Invasion
Bringing Science to the Surface Oris Assays: An Innovative Platform for the Study of Cell Migration & Cell Invasion AMS Biotechnology (Europe) - www.amsbio.com - info@amsbio.com UK +44 (0) 1235 828200
More informationBy the name of Allah
By the name of Allah Receptors function and signal transduction ( Hormones and receptors Types) We were talking about receptors of the neurotransmitters; we have 2 types of receptors: 1- Ionotropic receptors
More informationACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are
More informationCell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator
Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and
More informationDiscovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck
Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf
More informationSupplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationChapter 11 Guided Reading: Cell Communication
Name Chapter 11 Guided Reading: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
More informationLipids and Membranes
Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationCombining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists
Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists Marco Scarsi Biozentrum - Swiss Institute of Bioinformatics Drug discovery and development 12-15 years of
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationinjected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP
More informationCancer agents - Problem set #3
Cancer agents - Problem set #3 1. Define the term angiogenesis (use complete sentences). In your answer explain whether solid or liquid tumors should be more sensitive to altering angiogenesis. (Two short
More informationBio 111 Study Guide Chapter 11 Cell Communication
Bio 111 Study Guide Chapter 11 Cell Communication BEFORE CLASS: Reading: Read the introduction on p. 210, and for Concept 11.1, read from the first full paragraph on p. 212. Read all of Concept 11.2. Pay
More informationA Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology
A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology Jian Huang, Jay Liu and Robert Bostwick Lead Discovery Department AstraZeneca Pharmaceuticals Background The receptor
More informationUtilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint
APPLICATION NOTE AlphaLISA Technology Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint Introduction
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationGoals and Challenges of Communication. Communication and Signal Transduction. How Do Cells Communicate?
Goals and Challenges of Communication Reaching (only) the correct recipient(s) Imparting correct information Timeliness Causing the desired effect Effective termination Communication and Signal Transduction
More informationSupplemental Material can be found at:
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 30, pp. 20891 20901, July 28, 2006 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Diverse Antiapoptotic
More informationTargeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer
Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics TMPRSS2-ERG
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-07-1-0441 TITLE: A Novel Approach to Identify Genes that Modulate Response of Human Ovarian Cancer Cells to Chemotherapeutic Agents Using High-Throughput RNA Interference PRINCIPAL
More informationIntroduction to HIV/AIDS
HIV/AIDS Seminar 5 Welcome Back Introduction to HIV/AIDS History of HIV/AIDS It is now thought that HIV came from a similar virus found in chimpanzees - SIV. HIV probably entered North America around 1970
More informationTranslational Bioinformatics: Connecting Genes with Drugs
Translational Bioinformatics: Connecting Genes with Drugs Aik Choon Tan, Ph.D. Associate Professor of Bioinformatics Division of Medical Oncology Department of Medicine aikchoon.tan@ucdenver.edu 11/14/2017
More information609G: Concepts of Cancer Genetics and Treatments (3 credits)
Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,
More information33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0367 TITLE: Exploring AR-NFkappaB/p52-Targeted Inhibitors as Novel Therapy Against Castration-Resistant Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Farideh Mehraein-Ghomi,
More informationUsing Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T)
Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T) Vashu Pamnani, PhD. Cambridge Bioscience T Cells Non-Adherent
More information(3) Cyclic Nucleotide Gated (CNG) Assay Technology. (4) Developing uhts CNG Assays on the FLIPR Tetra
Miniaturized Cyclic Nucleotide-Gated (CNG) Channel Assays to Discover Neuropeptide Y Receptor Modulators Sanjay Saldanha, PhD, HTS/Lead ID Department Slide 1 Presentation Outline (1) Intro to Scripps Florida
More informationHORMONES (Biomedical Importance)
hormones HORMONES (Biomedical Importance) Hormones are the chemical messengers of the body. They are defined as organic substances secreted into blood stream to control the metabolic and biological activities.
More informationCANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
More informationTITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
More informationHow to Integrate Cellular Metabolism Assays Into Your Research: Considerations and Challenges
How to Integrate Cellular Metabolism Assays Into Your Research: Considerations and Challenges Donna Leippe Sr Research Scientist Outline for Today s Webinar Introduction to Cell Metabolism Metabolite Detection
More informationClaudia Adams Barr Program in Innovative Cancer Research Dana-Farber Cancer Institute BARR PROGRAM IMPACT STATEMENTS
Claudia Adams Barr Program in Innovative Cancer Research Dana-Farber Cancer Institute BARR PROGRAM IMPACT STATEMENTS Brain Cancer New Treatment Opportunities - Discovery of new pathways in brain cancers
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2012-2013 MICROBIOLOGY BIO-2B28 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in
More informationIntracellular signalling cascades associated with TRP channels
Gerald Thiel Intracellular signalling cascades associated with TRP channels Current state of investigations and potential applications Saarland University, Germany Campus Saarbrücken Department of Medical
More informationComprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease
Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,
More informationIntegrated platform for liquid biopsy-based personalized cancer medicine
Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy Personalized cancer therapy Primary tumor single tumor
More informationINTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
More informationFounded in 2016 to develop life-changing therapies against debilitating aggressive cancers that have limited treatment options
Founded in 2016 to develop life-changing therapies against debilitating aggressive cancers that have limited treatment options Integrated platform technology for discovery of novel molecular targets and
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More information