High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA

Size: px
Start display at page:

Download "High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA"

Transcription

1 High Throughput Screening as a Research Tool Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA

2 Structure of this seminar Applications of High Throughput Screening The Drug Discovery Workflow old and new Adaptive Diseases Case Study: Biofilms Case Study: Prostate Cancer Case Study: Cancer Stem Cells

3 High Throughput Screening as a Research Tool Functional Genomics sirna Screens Lentiviral Screens cdna screens Drug Discovery Targeted Libraries Druglike Libraries Diverse Libraries HighThroughput Screening Materials Characterization Automated Toxicity Profiling Profiling on Live Cells Using Functional/Chemical Genomics Chemical Genomics FDA Approved Drugs Bioactives Natural Products Materials Discovery Highthroughput Chemistry Highthroughput QC

4 Target Centric Drug Discovery pregenomic Disease Disease relevant process Disease modifying target High Throughput Screening Campaign

5 Drug Discovery postgenomic Disease Disease relevant process, pathway or phenotype High Throughput Screening Campaign Target Discovery

6 What changed? More targets are known than can be reasonably screened Not all players in a disease relevant pathway are known or accessible for screening Novel technology such as High Content Screening (HCS) allows for black box screening approaches Target discovery for hits from screens has become more feasible using Functional Genomics using High Throughput Screening

7 General Screening Workflow Integrated Novel Target Screening Strategy Assay Technology Library Choice Taken from: Molecular Screening by R. Damoiseaux, Ph.D. in Development of Therapeutic Agents Handbook Forthcoming from Wiley and Sons Novel Target(s) Screen Validation and Execution Small Molecule Probe for Chemical Genomics Target Discovery Data Mining,rescreening and secondary screening Novel agonist or antagonist Unknown Target Further specificity profiling Known Target Compound rejected Lead discovery

8 Using HTS as a Research Tool Adaptive Diseases diseases which are able to adjust to the selective pressure exerted by the treatment with drugs. Examples: Cancer: e.g. occurrence of resistance to chemotherapy Infectious diseases: occurrence of resistance to e.g. anti virals, antibiotics etc.

9 Overcoming Adaptive Diseases Examples: HIV: Development of HAART Cancer Therapy: Multidrug therapy Acute Disease Chronic Disease

10 HTS as Research tool : Case Studies Biofilm: Modulation A macroscopic of Bacterial structure Biofilms by on compounds a biological and (e.g. drugs mucous membrane) or inert surface consisting of bacteria and extracellular matrix Prostate consisting Cancerof polyglycans. Cancer Biofilms Stem are not cellseasily permeated by antibiotics Biofilms are not easily accessible to the immune system Biofilms are a bacterial resistance mechanism causing many problems in the medical area.

11 Biofilm assay examples BFU media control Biofilm In a 384 well plate biofilm forming Haemophilus Influencae bacteria or media control were incubated over night, the resulting biofilm detected in a fully automated fashion.

12 Biofilm assay examples % Biofilm Modulation % Biofilm Modulation 70 0 Frequency 0 Frequency A set of about 2 k compounds was incubated with biofilm forming bacteria and the amount of biofilm production measured.

13 Biofilm assay examples Bacteriocidal and biofilm stimulating Bacteriocidal and not biofilm stimulating

14 Exploring the HER kinase androgen receptor interaction in prostate cancer Using Chemical Genomics to explore the HER kinase axis in Prostate Cancer

15 In 2008, an estimated 186,320 new cases will occur in the US. Prostate cancer is the most frequently diagnosed cancer and the leading cause of cancer death in men with an estimated 28,660 deaths in 2008 alone. American Cancer Society

16 ADPC Androgendependent prostate cancer PSA PSA AIPC Androgenindependent prostate cancer PSA

17 Activation of growth promoting signaling pathways: BCL2 antiapoptotic pathway Protein kinase A Phosphatidylinositol 3 kinase Ras/Raf/MAPK Receptor tyrosine kinases

18 Activation of growth promoting signaling pathways: BCL2 antiapoptotic pathway Protein kinase A Phosphatidylinositol 3 kinase Ras/Raf/MAPK Receptor tyrosine kinases Activating HER2/HER3 dimerization supports prostate cancer progression.

19 Cell membrane HER1 HER2 HER3 HER4 HRG 2C4 HRG HER2 HER3 HER2 HER3 P P Cell death No Cell death

20 Relative luminescence lightoutput 500K 450K 400K 350K 300K 250K 200K 150K 100K 50K A: Bar Graph 25nM HRG 50nM HRG 0 No treatment 2C4 HRG HRG+2C4 B: Scatter Plot Zfactor = 0.65 HRG HRG+2C Sample Replicates

21 AD AI AI

22 Mechanism of HRG induced cell kill Starved HRG 2C4 What is the mechanism of HRG induced cell kill in LNCap cells? Why does it occur in the LNCap AD prostate cancer cell model and not in the isogenic AI models?

23 Figure 3C: Representative cellular pictures with various treatments (Hoechst 33342PIstained cells). Control 2C4 R1881 EGF4 HRG2.5 2C4+HRG2.5 R1881+HRG2.5

24 Develop a highthroughput assay to effectively screen for compounds that rescue LNCap cells from HRG induced cell kill. Prestwick Chemical Library 1120 molecules dissolved in DMSO 90% are marketed drugs Biomol bioactive lipid library 201 bioactive lipids Biomol enzyme library Kinase phosphatase inhibitors (80 known kinase inhibitors and 33 known phosphatase inhibitors)

25 384 well highthroughput format 1200 cells/well are plated in RPMI/10%serum. 10μM compound is added the next day followed by 10nM HRG. 24hrs later viable cells are quantified using the ATPlite 1step, single addition luminescence ATP detection Assay system. Percent viability of cells is calculated with respect to DMSO treated cells. Normalized data is uploaded in the CDD database to screen for hits.

26 HRG High viability Low viability DMSO control

27 HRG: average viability: 25.5 %

28

29 Add EGFR inhibitor

30 Prestwick compounds Rescuing Heregulin induced Prostate Cell Kill Glucocorticoid steroid C 21 steroid hormone Hormone precursor to aldosterone Cardenolide Corticosteroid Topical corticosteroids

31 C4 R1881+ HRG25 R1881+HRG2.5 R1881 R1881+2C4 EGF4+2C4 EGF4 HRG 25+ 2C4 HRG C4 HRG 25nM HRG 2.5nM Control Percent PI positive LNCaP cells (Percent cellular killing normalized to total cell number)

32 AR amplifications and mutations have been involved in AI prostate cancer. androgens AR HSP HSP AR AR AR nucleus AR AR

33 Normalized Relative LUC Activity PSA promoter TATA Luciferase Zfactor = R1881(1) HRG(2.5) HRG(25) 2C

34 Develop a highthroughput luminescence assay to detect cell viability in prostate cancer cells and identify several compounds and categories of compounds namely steroids that prevent HRG induced cell kill. Use compound screening to connect two pathways together, to better understand the biology of HER2/HER3 mediated cell kill in AD prostate cancer cells.

35 HRG HER2 HER3 androgens P P AR HSP HSP AR AR AR Cell death nucleus AR AR

36 HRG HER2 HER3 androgens P P AR HSP HSP AR AR AR Cell death nucleus AR AR

37 Identify molecules involved in connecting the HER2/HER3 and AR pathway by using sirna and overexpression screens. Create several options to successfully inhibit AR in advanced prostate cancer patients.

38 Jack Altura, Talar Kechichian CSMC Robert D. Damoiseaux MSSR UCLA Barry A Bunin CDD Kellan Gregory CDD NIH Prostate Cancer Foundation

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway Pre-made Reporter for JAK-STAT Signaling Pathway Cat# Product Name Amounts LVP937-P or: LVP937-P-PBS ISRE-GFP (Puro) LVP938-P or: LVP938-P-PBS ISRE-RFP (Puro) LVP939-P or: LVP939-P-PBS ISRE-Luc (Puro)

More information

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification

More information

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked

More information

Bowel Disease Research Foundation

Bowel Disease Research Foundation Research Project Annual Report Lead investigator Dr Ricky Sharma Institution Department of Oncology, University of Oxford Project Title Making radiotherapy for rectal cancer more effective by identifying

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway Pre-made Reporter for MAPK/ERK Signal Pathway Cat# Product Name Amounts LVP957-P or: LVP957-P-PBS SRE-GFP (Puro) LVP958-P or: LVP958-P-PBS SRE-RFP (Puro) LVP959-P or: LVP959-P-PBS SRE-Luc (Puro) LVP960-P

More information

Cellular Screening in 2D and 3D. Identification of cancer specific modulators. ELRIG.de, March 2013

Cellular Screening in 2D and 3D. Identification of cancer specific modulators. ELRIG.de, March 2013 Cellular Screening in 2D and 3D Identification of cancer specific modulators ELRIG.de, March 2013 Introduction International FP7 program Aim is the identification of novel compounds with anti-cancer properties

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds

Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds Glenn Kirsch, PhD Discovery Services Charles River Cleveland, Ohio USA Aurora Ion Channel Retreat July 7-9, 2015 Tobacco

More information

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6* Supplementary Information for Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling Elissaveta Petrova 1,5, Jessica Rios-Esteves 1,2, Ouathek Ouerfelli 3, J. Fraser Glickman 4, and Marilyn

More information

Nature Biotechnology: doi: /nbt.2435

Nature Biotechnology: doi: /nbt.2435 Supplementary Figure 1: Characterization of expanded FD-NC. a, Survival rate after thawing of frozen FD-NC. b, Population doubling time of expanded FD-NC. c, Cell cycle analysis of expanded FD-NC. d, Representative

More information

Pre-made Reporter Lentivirus for NF-κB Signal Pathway

Pre-made Reporter Lentivirus for NF-κB Signal Pathway Pre-made Reporter for NF-κB Signal Pathway Cat# Product Name Amounts LVP965-P or: LVP965-P-PBS NFKB-GFP (Puro) LVP966-P or: LVP966-P-PBS NFKB-RFP (Puro) LVP967-P or: LVP967-P-PBS NFKB-Luc (Puro) LVP968-P

More information

A High-Content Biosensor-Based Screen Identifies Cell-Permeable Activators and Inhibitors of EGFR Function: Implications in Drug Discovery

A High-Content Biosensor-Based Screen Identifies Cell-Permeable Activators and Inhibitors of EGFR Function: Implications in Drug Discovery 446174JBXXXX10.1177/1087057112446174An tczak et al.journal of Biomolecular Screening 2012 A High-Content Biosensor-Based Screen Identifies Cell-Permeable Activators and Inhibitors of EGFR Function: Implications

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

Supplementary materials

Supplementary materials Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds

More information

Glucose Assay Kit. Catalog Number KA assays Version: 07. Intended for research use only.

Glucose Assay Kit. Catalog Number KA assays Version: 07. Intended for research use only. Glucose Assay Kit Catalog Number KA0831 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials Supplied...

More information

7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview

7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview Emerging mutations as predictive biomarkers in lung cancer: Overview Kirtee Raparia, MD Assistant Professor of Pathology Cancer Related Deaths: United States Men Lung and bronchus 28% Prostate 10% Colon

More information

Cell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule

Cell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule Cell Communication Cell Communication Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the ligand binds (may be on the plasma membrane or within

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Chemistry 106: Drugs in Society Lecture 19: How do Drugs Elicit an Effect? Interactions between Drugs and Macromolecular Targets 11/02/17

Chemistry 106: Drugs in Society Lecture 19: How do Drugs Elicit an Effect? Interactions between Drugs and Macromolecular Targets 11/02/17 Chemistry 106: Drugs in Society Lecture 19: How do Drugs Elicit an Effect? Interactions between Drugs and Macromolecular Targets 11/02/17 Targets for Therapeutic Intervention: A Comparison of Enzymes to

More information

~Lentivirus production~

~Lentivirus production~ ~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce

More information

Page 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION

Page 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION Page 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION 1. Feedback a. Negative feedback mechanisms maintain dynamic homeostasis for a particular condition (variable) by regulating physiological processes,

More information

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

More information

CONTRACTING ORGANIZATION: University of Michigan Medical School Ann Arbor, MI

CONTRACTING ORGANIZATION: University of Michigan Medical School Ann Arbor, MI AD Award Number: W81XWH-11-1-0219 TITLE: Multiplexed Promoter-dependent Screen for Selective Androgen Receptor Modulators PRINCIPAL INVESTIGATOR: Diane M. Robins, Ph.D. CONTRACTING ORGANIZATION: University

More information

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in

More information

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

TITLE: Establishing a Role for Ecto-phosphatases in Multidrug Resistance in Breast Cancer

TITLE: Establishing a Role for Ecto-phosphatases in Multidrug Resistance in Breast Cancer »- < AD Award Number: DAMD17-00-1-0694 TITLE: Establishing a Role for Ecto-phosphatases in Multidrug Resistance in Breast Cancer PRINCIPAL INVESTIGATOR: Alan M. Lloyd, Ph.D. CONTRACTING ORGANIZATION: The

More information

Steps to writing a lab report on: factors affecting enzyme activity

Steps to writing a lab report on: factors affecting enzyme activity Steps to writing a lab report on: factors affecting enzyme activity This guide is designed to help you write a simple, straightforward lab report. Each section of the report has a number of steps. By completing

More information

Lecture 1: Carcinogenesis

Lecture 1: Carcinogenesis Lecture 1: Carcinogenesis Anti-cancer (oncology agents): These are perhaps the most dangerous of drugs, other than the narcotic analgesics. This is due to their toxicities. Killing or inhibiting cancer

More information

New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일

New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일 New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일 Castrate-Resistant Prostate Cancer (CRPC) Current standard therapy Androgen receptor (AR) in CRPC New systemic therapies Hormonal therapy

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509 Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling

More information

Diagnostic test Suggested website label Description Hospitals available

Diagnostic test Suggested website label Description Hospitals available Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular

More information

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic

More information

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD

More information

Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health

Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health P. G. Waterman Product Development Report for HP8 page 1 Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health Prepared for InterHealth Biosciences Australia (IBA) by Professor

More information

TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer

TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health

More information

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr. BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:

More information

Propagation of the Signal

Propagation of the Signal OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

System. xcelligence System RTCA HT Instrument. Application Note No. 14 /January Long-Term High-Throughput Cytotoxicity Profiling

System. xcelligence System RTCA HT Instrument. Application Note No. 14 /January Long-Term High-Throughput Cytotoxicity Profiling System Application Note No. 14 /January 2013 xcelligence System RTCA HT Instrument Long-Term High-Throughput Cytotoxicity Profiling For life science research only. Not for use in diagnostic procedures.

More information

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The

More information

Challenges to Drug Development in Academia. Charles L. Sawyers, M.D.

Challenges to Drug Development in Academia. Charles L. Sawyers, M.D. Challenges to Drug Development in Academia Charles L. Sawyers, M.D. Chair, Human Oncology and Pathogenesis Program (HOPP) Investigator, Howard Hughes Medical Institute Memorial Sloan-Kettering Cancer Center;

More information

Poster#8. December 7 th 2017

Poster#8.  December 7 th 2017 Poster#8 Advanced Development and Validation of 3D Spheroid Culture of Primary Cancer Cells using Nano3D Technology This work is supported by the NCI IMAT Award R33 CA26949 Assist. Prof. Timothy Spicer-

More information

Plate-Based Assay Methods for the Assessment of Cellular Health

Plate-Based Assay Methods for the Assessment of Cellular Health Plate-Based Assay Methods for the Assessment of Cellular Health Andrew L. Niles, Senior Research Scientist 2012, Promega Corporation. Biological Outcomes in Cell Culture Treatment -Small molecule -Bio-molecule

More information

Introduction. Figure 1 Experimental Strategy

Introduction. Figure 1 Experimental Strategy Beyond s: Interrogating the Purinome Tony A. Klink, Karen Kleman-Leyer, Matt Staeben, Robert G. Lowery BellBrook Labs, Madison, Wisconsin, USA 53711 Introduction The development of ATP-site ligands as

More information

Lecture 1: Carcinogenesis

Lecture 1: Carcinogenesis Lecture 1: Carcinogenesis Anti-cancer (oncology agents): These are perhaps the most dangerous of drugs, other than the narcotic analgesics. This is due to their toxicities. Killing or inhibiting cancer

More information

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50

More information

Viruses. Picture from:

Viruses. Picture from: Viruses Understand the structure of bacteriophages & human immunodeficiency virus (HIV) Appreciate that viruses replicate in host cells (thereby destroying them) Picture from: http://eands.caltech.edu/articles/lxvii1/viruses.html

More information

The Application of Cell-Based Impedance Technology in Drug Discovery

The Application of Cell-Based Impedance Technology in Drug Discovery The Application of Cell-Based Impedance Technology in Drug Discovery Yama A. Abassi, PhD Sr. Director Cell Biology and Assay Development ACEA Biosciences ACEA Biosciences Founded in early Located in San

More information

CRYOSENSITIZERS: Ablation at the Edge

CRYOSENSITIZERS: Ablation at the Edge CRYOSENSITIZERS: Ablation at the Edge John G. Baust Institute of Biomedical Technology State University of New York Binghamton, NY USA JGBaust@binghamton.edu Precision targeting Challenge Uncertain margin

More information

Bacterial Survival In Synovial Fluid: Is S. aureus in the Knee Joint Persisting Despite Antibiotic Treatment?

Bacterial Survival In Synovial Fluid: Is S. aureus in the Knee Joint Persisting Despite Antibiotic Treatment? Bacterial Survival In Synovial Fluid: Is S. aureus in the Knee Joint Persisting Despite Antibiotic Treatment? Sana Dastgheyb 1, Sommer Hammoud 2, Constantinos Ketonis, MD 3, James Purtill, MD 3, Michael

More information

Oris Assays: An Innovative Platform for the Study of Cell Migration & Cell Invasion

Oris Assays: An Innovative Platform for the Study of Cell Migration & Cell Invasion Bringing Science to the Surface Oris Assays: An Innovative Platform for the Study of Cell Migration & Cell Invasion AMS Biotechnology (Europe) - www.amsbio.com - info@amsbio.com UK +44 (0) 1235 828200

More information

By the name of Allah

By the name of Allah By the name of Allah Receptors function and signal transduction ( Hormones and receptors Types) We were talking about receptors of the neurotransmitters; we have 2 types of receptors: 1- Ionotropic receptors

More information

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are

More information

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and

More information

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Chapter 11 Guided Reading: Cell Communication

Chapter 11 Guided Reading: Cell Communication Name Chapter 11 Guided Reading: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists

Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists Marco Scarsi Biozentrum - Swiss Institute of Bioinformatics Drug discovery and development 12-15 years of

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP

More information

Cancer agents - Problem set #3

Cancer agents - Problem set #3 Cancer agents - Problem set #3 1. Define the term angiogenesis (use complete sentences). In your answer explain whether solid or liquid tumors should be more sensitive to altering angiogenesis. (Two short

More information

Bio 111 Study Guide Chapter 11 Cell Communication

Bio 111 Study Guide Chapter 11 Cell Communication Bio 111 Study Guide Chapter 11 Cell Communication BEFORE CLASS: Reading: Read the introduction on p. 210, and for Concept 11.1, read from the first full paragraph on p. 212. Read all of Concept 11.2. Pay

More information

A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology

A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology Jian Huang, Jay Liu and Robert Bostwick Lead Discovery Department AstraZeneca Pharmaceuticals Background The receptor

More information

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint APPLICATION NOTE AlphaLISA Technology Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint Introduction

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Goals and Challenges of Communication. Communication and Signal Transduction. How Do Cells Communicate?

Goals and Challenges of Communication. Communication and Signal Transduction. How Do Cells Communicate? Goals and Challenges of Communication Reaching (only) the correct recipient(s) Imparting correct information Timeliness Causing the desired effect Effective termination Communication and Signal Transduction

More information

Supplemental Material can be found at:

Supplemental Material can be found at: THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 30, pp. 20891 20901, July 28, 2006 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Diverse Antiapoptotic

More information

Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer

Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics TMPRSS2-ERG

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-07-1-0441 TITLE: A Novel Approach to Identify Genes that Modulate Response of Human Ovarian Cancer Cells to Chemotherapeutic Agents Using High-Throughput RNA Interference PRINCIPAL

More information

Introduction to HIV/AIDS

Introduction to HIV/AIDS HIV/AIDS Seminar 5 Welcome Back Introduction to HIV/AIDS History of HIV/AIDS It is now thought that HIV came from a similar virus found in chimpanzees - SIV. HIV probably entered North America around 1970

More information

Translational Bioinformatics: Connecting Genes with Drugs

Translational Bioinformatics: Connecting Genes with Drugs Translational Bioinformatics: Connecting Genes with Drugs Aik Choon Tan, Ph.D. Associate Professor of Bioinformatics Division of Medical Oncology Department of Medicine aikchoon.tan@ucdenver.edu 11/14/2017

More information

609G: Concepts of Cancer Genetics and Treatments (3 credits)

609G: Concepts of Cancer Genetics and Treatments (3 credits) Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,

More information

33VASTVNGATSANNHGEPPS51PADARPR58

33VASTVNGATSANNHGEPPS51PADARPR58 Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0367 TITLE: Exploring AR-NFkappaB/p52-Targeted Inhibitors as Novel Therapy Against Castration-Resistant Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Farideh Mehraein-Ghomi,

More information

Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T)

Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T) Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T) Vashu Pamnani, PhD. Cambridge Bioscience T Cells Non-Adherent

More information

(3) Cyclic Nucleotide Gated (CNG) Assay Technology. (4) Developing uhts CNG Assays on the FLIPR Tetra

(3) Cyclic Nucleotide Gated (CNG) Assay Technology. (4) Developing uhts CNG Assays on the FLIPR Tetra Miniaturized Cyclic Nucleotide-Gated (CNG) Channel Assays to Discover Neuropeptide Y Receptor Modulators Sanjay Saldanha, PhD, HTS/Lead ID Department Slide 1 Presentation Outline (1) Intro to Scripps Florida

More information

HORMONES (Biomedical Importance)

HORMONES (Biomedical Importance) hormones HORMONES (Biomedical Importance) Hormones are the chemical messengers of the body. They are defined as organic substances secreted into blood stream to control the metabolic and biological activities.

More information

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

More information

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University

More information

How to Integrate Cellular Metabolism Assays Into Your Research: Considerations and Challenges

How to Integrate Cellular Metabolism Assays Into Your Research: Considerations and Challenges How to Integrate Cellular Metabolism Assays Into Your Research: Considerations and Challenges Donna Leippe Sr Research Scientist Outline for Today s Webinar Introduction to Cell Metabolism Metabolite Detection

More information

Claudia Adams Barr Program in Innovative Cancer Research Dana-Farber Cancer Institute BARR PROGRAM IMPACT STATEMENTS

Claudia Adams Barr Program in Innovative Cancer Research Dana-Farber Cancer Institute BARR PROGRAM IMPACT STATEMENTS Claudia Adams Barr Program in Innovative Cancer Research Dana-Farber Cancer Institute BARR PROGRAM IMPACT STATEMENTS Brain Cancer New Treatment Opportunities - Discovery of new pathways in brain cancers

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2012-2013 MICROBIOLOGY BIO-2B28 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in

More information

Intracellular signalling cascades associated with TRP channels

Intracellular signalling cascades associated with TRP channels Gerald Thiel Intracellular signalling cascades associated with TRP channels Current state of investigations and potential applications Saarland University, Germany Campus Saarbrücken Department of Medical

More information

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,

More information

Integrated platform for liquid biopsy-based personalized cancer medicine

Integrated platform for liquid biopsy-based personalized cancer medicine Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy Personalized cancer therapy Primary tumor single tumor

More information

INTERACTION DRUG BODY

INTERACTION DRUG BODY INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

More information

Founded in 2016 to develop life-changing therapies against debilitating aggressive cancers that have limited treatment options

Founded in 2016 to develop life-changing therapies against debilitating aggressive cancers that have limited treatment options Founded in 2016 to develop life-changing therapies against debilitating aggressive cancers that have limited treatment options Integrated platform technology for discovery of novel molecular targets and

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information