Supplementary Materials for

Size: px
Start display at page:

Download "Supplementary Materials for"

Transcription

1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine Kinases Guanglei Zhuang, Kebing Yu, Zhaoshi Jiang, Alicia Chung, Jenny Yao, Connie Ha, Karen Toy, Robert Soriano, Benjamin Haley, Elizabeth Blackwood, Deepak Sampath, Carlos Bais, Jennie R. Lill, Napoleone Ferrara* *Corresponding author. Published 16 April 2013, Sci. Signal. 6, ra25 (2013) DOI: /scisignal This PDF file includes: Fig. S1. KinomeView profiling of endothelial cells. Fig. S2. Quality control of phosphoproteomic experiments. Fig. S3. Regulation of PI3K-mTORC2-Akt-FoxO1 axis by VEGF. Fig. S4. Different classes of small-molecule inhibitors used in the study. Fig. S5. VEGF signaling mechanisms to regulate phosphorylation. Fig. S6. mtor kinase inhibitors in endothelial RTK reprogramming. Fig. S7. Feedback activation of endothelial RTKs. Fig. S8. PI3K inhibitors in endothelial RTK reprogramming. Other Supplementary Material for this manuscript includes the following: (available at Table S1 (Microsoft Excel format). The complete data set for identified phosphopeptides. Table S2 (Microsoft Excel format). VEGF-regulated phosphopeptides and membership values in fuzzy c-means clustering. Table S3 (Microsoft Excel format). Gene ontology and pathway analysis of the VEGF-regulated proteins. Table S4 (Microsoft Excel format). Gene list and sirna sequences for RNAi screen. Table S5 (Microsoft Excel format). Kinase enrichment analysis of the VEGFregulated phosphoproteins. Table S6 (Microsoft Excel format). Microarray analysis of HUVECs stimulated with VEGF. Table S7 (Microsoft Excel format). NanoString ncounter analysis of HUVECs stimulated with VEGF.

2 Table S8 (Microsoft Excel format). Microarray analysis of HUVECs treated with mtor kinase inhibitors.

3 Figure S1. KinomeView profiling of endothelial cells. A. Experimental overview. Illustration reproduced courtesy of Cell Signaling Technology, Inc. ( B. HUVECs were treated with VEGF (50 ng/ml) or sorafenib (50 µg/ml) and then analyzed by Western blot with the indicated phospho-motif antibodies. Data represent two independent experiments.

4 Figure S2. Quality control of phosphoproteomic experiments. A. Scatter plots of raw data showed linear correlation between control and VEGF-treated HUVECs. B. Distribution of changes in phosphorylation from control or sorafenib-treated HUVECs. Scatter plot of raw data is inset. Phospho-peptides with decreased (zscore < 1.5) or increased (z-score > 1.5) phosphorylation are indicated. C. Distribution of changes in phosphorylation from control or VEGF-treated HUVECs

5 across different time points. Phospho-peptides with decreased (z-score < 1.5) or increased (z-score > 1.5) phosphorylation are indicated.

6 Figure S3. Regulation of PI3K-mTORC2-Akt-FoxO1 axis by VEGF. A. Quantification of VEGF-induced would closure (n=3 biological replicates; *p<0.01, Kruskal-Wallis test followed by Mann-Whitney tests). B. Mass spectra of a phospho-peptide from FoxO1. C. HUVECs were stimulated with VEGF (50 ng/ml) as indicated. Components of the PI3K-mTORC2-Akt pathway were immunoblotted with phospho-specific antibodies. Data represent two independent experiments.

7 Figure S4. Different classes of small-molecule inhibitors used in the study. The concentrations were determined for the inhibitors to inhibit corresponding pathways upon VEGF activation. Data represent two independent experiments.

8

9 Figure S5. VEGF signaling mechanisms to regulate phosphorylation. A. HUVECs were pre-treated with PI3K inhibitors (0.5 µm), stimulated with VEGF (50 ng/ml), and analyzed by Western blot with the AKT motif antibody. Data represent two independent experiments. B. HUVEC viability in the presence of emerolimus was measured by CellTiter-Glo luminescent assays (n=8 biological replicates). C. Raptor, rictor or mtor was knocked down in HUVECs and cell viability was assessed by CellTiter-Glo luminescent assays (n=8 biological replicates). D. Quantification of HUVEC sprouts in response to different inhibitors (n=3 biological replicates; *p<0.01, ANOVA followed by Dunnett tests). E. Microarray analysis of the VEGF gene signature (n=3 biological replicates). F. The ratio of the amount of FoxO1 Thr 24 to that of total FoxO1 (n=3 biological replicates; *p<0.05, Kruskal-Wallis test followed by Mann-Whitney tests). G. Percentage of HUVECs that showed FoxO1 nuclear localization (n=4 biological replicates; *p<0.01, Kruskal-Wallis test followed by Mann-Whitney tests).

10 Figure S6. mtor kinase inhibitors in endothelial RTK reprogramming. A. Protein phosphorylation following PI3K inhibition was probed with AKT motif antibody. Data represent two independent experiments. B. Western blot analysis of total protein abundance. Data represent two independent experiments. C. The ratio of the amount of phospho-proteins to that of total proteins (n=3 biological replicates).

11 Figure S7. Feedback activation of endothelial RTKs. A. The ratio of the amount of phospho-proteins to that of total proteins; and the ratio of the amount of total proteins to that of actin (n=3 biological replicates). B. Gene expression of RTKs was analyzed by quantitative PCR (n=4 biological replicates).

12 Figure S8. PI3K inhibitors in endothelial RTK reprogramming. A. The ratio of the amount of phospho-proteins to that of total proteins; and the ratio of the amount of total proteins to that of Actin (n=3 biological replicates). B. HUVECs were treated with GDC-0980, GDC-0941 or everolimus (0.5 µm) for 24 hours, and cell lysates were analyzed by phospho-rtk antibody array. Data represent two independent experiments. C. HUVECs were treated with GDC-0941 (0.5 µm). Cell lysates were analyzed by immunoblotting with indicated antibodies. Data represent two independent experiments.

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/398/rs12/dc1 Supplementary Materials for Quantitative phosphoproteomics reveals new roles for the protein phosphatase PP6 in mitotic cells Scott F. Rusin, Kate

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Nature Structural & Molecular Biology: doi: /nsmb.3218

Nature Structural & Molecular Biology: doi: /nsmb.3218 Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/2/43/43ra55/dc1 Supplementary Materials for Pathway-Based Identification of Biomarkers for Targeted Therapeutics: Personalized Oncology with PI3K Pathway

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/318/ra29/dc1 Supplementary Materials for Antagonism of EGFR and HER3 Enhances the Response to Inhibitors of the PI3K-Akt Pathway in Triple-Negative Breast Cancer

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas. Supplementary Figure 1 Experimental design and workflow utilized to generate the WMG Protein Atlas. (a) Illustration of the plant organs and nodule infection time points analyzed. (b) Proteomic workflow

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

Phosphoserine Detection Kit

Phosphoserine Detection Kit Kit 0701/PSER-KIT 02/080507 Background and Specificity extracellular signals to the nucleus. Phosphorylated epitopes may serve as docking sites for the assembley of protein complexes or may alter the 3-dimensional

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

4.2 RESULTS AND DISCUSSION

4.2 RESULTS AND DISCUSSION phosphorylated proteins on treatment with Erlotinib.This chapter describes the finding of the SILAC experiment. 4.2 RESULTS AND DISCUSSION This is the first global report of its kind using dual strategies

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Department of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada.

Department of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada. Phosphoproteome dynamics of Saccharomyces cerevisiae under heat shock and cold stress Evgeny Kanshin 1,5, Peter Kubiniok 1,2,5, Yogitha Thattikota 1,3, Damien D Amours 1,3 and Pierre Thibault 1,2,4 * 1

More information

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland

More information

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway AWARD NUMBER: W81XWH-12-1-0560 TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway PRINCIPAL INVESTIGATOR: Andrew S. Kraft, MD CONTRACTING ORGANIZATION:

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral

More information

Protein SD Units (P-value) Cluster order

Protein SD Units (P-value) Cluster order SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor

More information

Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer

Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang

More information

Supporting Information

Supporting Information Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

2015 EUROPEAN CANCER CONGRESS

2015 EUROPEAN CANCER CONGRESS 2015 EUROPEAN CANCER CONGRESS 25-29 September 2015 Vienna, Austria SUMMARY The European Cancer Congress (ECC 2015) combined the 40th European Society for Medical Oncology (ESMO) congress with the 18th

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

mtorc2 controls actin polymerization required for consolidation of long-term memory

mtorc2 controls actin polymerization required for consolidation of long-term memory CORRECTION NOTICE Nat. Neurosci.; doi:1.138/nn.3351 mtorc2 controls actin polymerization required for consolidation of long-term memory Wei Huang, Ping Jun Zhu, Shixing Zhang, Hongyi Zhou, Loredana Stoica,

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

Nature Immunology: doi: /ni.3866

Nature Immunology: doi: /ni.3866 Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.

Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Information. Table of contents

Supplementary Information. Table of contents Supplementary Information Table of contents Fig. S1. Inhibition of specific upstream kinases affects the activity of the analyzed readouts Fig. S2. Down-regulation of INCENP gene induces the formation

More information

Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity

Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Manuscript EMBO-2010-76298 Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Yuki Fujita, Shota Endo, Toshiyuki Takai and Toshihide Yamashita Corresponding author: Toshihide

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,

More information

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes

More information

Kinex Reverse Lysate Microarray KRLM-1.0. Case Study

Kinex Reverse Lysate Microarray KRLM-1.0. Case Study Kinex Reverse Lysate Microarray KRLM-1. Case Study Probing with an Anti-phospho-ERK1/2 Antibody The Kinex Reverse Lysate Microarray (KRLM) is a powerful tool for rapid characterization of a protein for

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855 Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,

More information

Expanded View Figures

Expanded View Figures EMO Molecular Medicine Proteomic map of squamous cell carcinomas Hanibal ohnenberger et al Expanded View Figures Figure EV1. Technical reproducibility. Pearson s correlation analysis of normalised SILC

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer

Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics TMPRSS2-ERG

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/487/eaag2476/dc1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

HA-Sin1-N (aa 1-137), HA-Sin1-CRIM (aa ) and HA-Sin1-RBD (aa ) were constructed by

HA-Sin1-N (aa 1-137), HA-Sin1-CRIM (aa ) and HA-Sin1-RBD (aa ) were constructed by EXTENDED METHODS Plasmids HA-Sin1-N (aa 1-137), HA-Sin1-CRIM (aa 138-266) and HA-Sin1-RBD (aa 267-376) were constructed by cloning the corresponding cdnas into psuper-ha-cdna3 vector via BamHI/BglII and

More information

Phosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J.

Phosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J. UvA-DARE (Digital Academic Repository) Phosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J. Link to publication Citation for published version (APA): Keune, W. J. H.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

Supplementary Information

Supplementary Information Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information