injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
|
|
|
- Allyson Evangeline Johns
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body weight, tumor growth and serum PSA was measured weekly. Once serum PSA reached 50-75ng/ml, mice were surgically castrated (Cx). Upon recurrence of PSA to pre-castration levels, mice were randomized into 2 treatment groups and received either vehicle control or 10mg/kg ENZ daily by oral gavage (Tx). Body weight, tumor growth and serum PSA was monitored weekly until vehicle control treated CRPC, or tumors that recurred in the 10mg/kg ENZ treatment group (1 o ENZ R ) grew to the experimental endpoint. Select primary ENZR (1 o ENZ R ) tumors were excised at the experimental endpoint and tumor sections were allografted subcutaneously into bilateral flanks of castrated 8-10 week old athymic nude mice, which were dosed daily with 10mg/kg ENZ from day of tumor transplant and mice were monitored for growth of transplanted tumors, body weight and serum PSA (ENZ R T1). Serial transplant of select ENZ R T1 tumors was repeated for a second and third time (ENZ R T2 and ENZ R T3) as above into castrated mice dosed daily with 10mg/kg ENZ. In total, 35 ENZ R tumors were generated over 3 serial transplant generations from 4 out of 10 primary PSA + ENZ R tumors. Cell lines were generated from primary CRPC as well as primary and T1-3 transplanted ENZ R tumors. Specific cell lines used in the manuscript derived from CRPC, primary ENZ R (1 o ENZ R ) and transplanted ENZ R (ENZ R T1-3) tumors are listed as tumor derived cell lines in the schematic. Each cell line shown is representative of one line derived from one select tumor at each stage of transplantation. (B-C) Growth of exact primary and transplanted tumors grown in individual mice (M66, M18, M35, etc.) that gave rise to (B) 49C and 49F ENZ R cells and (C) 42C and 42F ENZ R cells are shown. Tumors that grew as PSA + are shown as blue lines, PSA - are shown as red (in C, only the tumor in M42 and source of 42D/F cells was PSA - ). In cell line nomenclature, numbers correspond to mouse number in which transplanted tumors were grown, letters denote the clone. Fig. S1C highlights that under selective pressure of ENZ, PSA+ tumors become PSA - (blue to red line) over the course of 2 serial transplants to generate the 1
2 42D and 42F ENZ R cell lines. (D) Representative IHC staining for AR and PSA protein expression in CRPC, PSA + tumor 49 (T49) and PSA - tumor 42 (T42) xenografts. (E) Differences in global gene expression were determined using multidimensional principle coordinate analysis of gene profiling data from CRPC and ENZ R cell lines. (F) Heat map showing fold increase in gene expression profiling analysis of AR target genes in 42F ENZR cells compared to 16D CRPC (=1). See also Table S1. (G) Proliferation of non-ar driven 42D and 42F ENZR vs. AR-driven 49F ENZR cells 72 hours after seeding in the presence of AR knockdown (siar) compared to control (sictr) measured by absorbance. Statistics were performed on pooled data from at least three independent experiments. ***p<0.001,****p< Figure S2: AR non-driven ENZ R cells display a NE differentiation signature: (A) Heat map showing fold increase in genes involved in NE differentiation in 42F ENZR cells compared to 16D CRPC (=1). (B-C) Representative IHC staining of BRN2 and CGA in (B) serially transplanted tumors which gave rise to 42D ENZR and 42F ENZR and in (C) cell line xenografts. (D) Relative mrna expression of NE markers in 16D CRPC compared to LNCaP cells. Statistics were performed on pooled data from at least three independent experiments. *p<0.05, **p<0.01. Figure S3: BRN2 expression is associated with PCa progression and a NE phenotype in human tumors: (A) Waterfall plot of BRN2 mrna expression in prostatic adenocarcinoma or CRPC tumors from the Grasso data set (1). (B-C) BRN2 mrna expression in metastatic vs. primary PCa (B) and correlation between BRN2 and CGA, CGB, SYP and nmyc mrna z scores (C) from the Taylor data set (2) analyzed using Cbioportal. (D) BRN2 expression in TCGA adenocarcinoma tumors vs. patient serum PSA (6). Figure S4: BRN2 expression is inversely related to AR activity and is required for ENZ-induced NE marker expression in CRPC: (A) Heat map showing fold increase in RNA sequencing reads per million of BRN2 and NE differentiation genes in 49F ENZR cells compared to 16D CRPC (=1). (B) Protein expression of AR, BRN2, CGA, NSE, PSA, SYP and VINC in 16D CRPC, 49C ENZR and 49F ENZR and 2
3 relative mrna expression of BRN2 and NE markers in 16D CRPC vs. 49F ENZR. (C) Relative activity of BRN2-luciferase reporter (normalized to Renilla) assessed 48 hours post-transfection in 49C ENZR and 49F ENZR cells compared to 16D CRPC (=1). (D) Representative IHC staining of BRN2 and CGA in serially transplanted tumors which gave rise to 49F ENZR and 49C ENZR. (E & F) Relative mrna expression of BRN2 and NE markers in (E) LAPC-4 transfected with BRN2 sirna (sibrn2) and (F) 16D CRPC cells with stable knockdown of BRN2 (sh-brn2) that were treated with 10µM ENZ compared to ENZ treated sictr (sictr=1) or empty vector transfected (sh-ctr=1). Statistics were performed on pooled data from at least three independent experiments. *p<0.05, **p<0.01, ***p< Figure S5: BRN2 overexpression induces NE marker expression and reciprocally regulates AR: (A-D) Relative mrna expression of BRN2 and NE markers in (A) 16D CRPC and (B) PC3 cells transfected with BRN2 overexpression vector (+BRN2), (C) LAPC-4 cells treated with 10 µm ENZ or overexpressing BRN2 (+BRN2) and (D) 49F ENZR cells overexpressing BRN2 (+BRN2) compared to control vector transfected (CTR=1). (E) GSEA graphs showing comparison of human NEPC genes in BRN2 overexpressed 16D CRPC vs. control cells with an independent study of human NEPC gene signature (4) as well as IPA analysis of pathways enriched in BRN2 overexpressing 16D CRPC compared to control (F) Relative mrna expression for AR and AR target genes in 49F ENZR cells cells overexpressing BRN2 (+BRN2) compared to control vector transfected (CTR=1). (G) Relative proliferation of control (CTR) or BRN2 overexpressing 49F ENZR cells (OE BRN2) when treated with 50 µm ENZ. Statistics were performed on pooled data from at least three independent experiments. *p<0.05, **p<0.01, ***p<0.001,****p< Figure S6: BRN2 activity and markers of NE differentiation are suppressed by androgens in CRPC and ENZ R cells. (A & B) Relative activity of BRN2 assessed 48 hours post-transfection with BRN2-luciferase reporter in (A) 42D ENZR or (B) 16D CRPC cells treated with 10nM R1881 for 24 hours compared to control treated cells (=1). Luciferase activity of BRN2 is normalized to Renilla. (C & D) Relative mrna expression of NE markers in (C) 42D ENZR or (D) 16D CRPC cells overexpressing BRN2 +/- 3
4 10nM R1881 for 24 hours compared to control treated cells (=1). (E) Relative mrna expression of BRN2 in LAPC4 cells treated with 10nM R1881 for 24 hours compared to control treated cells (=1). (F) Relative mrna expression of PSA, FKBP5, NKX3.1 and TMPRSS2 (TMP) in 42D ENZR cells treated with 10nM R1881 -/+ 200nM BRN2-ARE Ap for 48 hours compared to control treated cells (=1). Statistics were performed on pooled data from at least three independent experiments. *p<0.05, **p<0.01, ***p< Figure S7: SOX2 expression is induced by ENZ and suppressed by androgens. (A) Correlation between BRN2 and SOX2 mrna z scores from the Taylor data set (2) analyzed using Cbioportal. (B) Heat map of fold increase in reads per million of genes identified as co-bound by SOX2 and BRN2 in NPCs (30) in 42F ENZR cells compared to 16D CRPC (=1). (C) Relative mrna expression of SOX2 in 16D CRPC and LAPC-4 cells treated with 10 µm ENZ for 7 days compared to control treated cells (=1). (D) Relative mrna expression of SOX2 in 42D ENZR and 42F ENZR cells treated + R1881 for 24 hours compared to R1881 (=1). (E-L) Relative mrna expression of SOX2, BRN2 and/or NE markers in (E) PC-3 cells, (F) LAPC-4 cells or (G) NCIH660 cells transfected with different BRN2 sirnas, (H) PC-3, LAPC-4 and 49F ENZR cells transfected with BRN2 overexpression vector, (I) 42F ENZR cells treated with 10nM R1881 -/+ 200nM BRN2-ARE Ap for 48 hours, (J) PC-3, LAPC-4 and NCIH660 cells transfected with different SOX2 sirnas, (K) PC3 and (L) ENZ treated LAPC-4 cells transfected with SOX2 overexpression vector (+SOX2) or concomitant SOX2 overexpression with BRN2 knockdown (+SOX2/siBRN2) compared to unstimulated/ control vector/sirna (CTR=1). Statistics were performed on pooled data from at least three independent experiments. *p<0.05, **p<0.01, ***p< Figure S8: BRN2 is required for neuroendocrine marker expression and aggressive growth of CRPC cells in vitro. (A-D) Relative mrna expression of BRN2 and NE markers in (A) 42D ENZR, (B) 42F ENZR, (C) PC3 and (D) LAPC-4 cells transfected with two different BRN2 sirna (sibrn2) compared to control (sictr=1). For A-D, (E-G) 16D CRPC cells transfected with sh-brn2 (sh-brn2) compared to control transfected cells (sh-ctr) (=1) 72 hours after seeding were assessed for (E) relative 4
5 proliferation, (F) relative wound density in one dimensional scratch assay and (G) number of cells invaded through matrigel boyden chamber. Statistics were performed on pooled data from at least three independent experiments. *p<0.05, **p<0.01, ***p< SUPPLEMENTAL EXPERIMENTAL PROCEDURES Generation of ENZR Xenografts and Cell Lines (See also Fig. S1): 1x10 6 LNCaP cells suspended in 100ul matrigel (BD Labware) were injected subcutaneously into flanks of 6-8 week old male athymic nude-fox n1 mice (Harlan Sprauge-Dawley, Inc/Envigo) and body weight, tumor growth and serum PSA was measured weekly. Once serum PSA reached 50-75ng/ml, mice were surgically castrated. Upon recurrence of PSA to pre-castration levels, mice were randomized into 2 treatment groups and received either vehicle control or 10mg/kg ENZ daily by oral gavage. Body weight, tumor growth and serum PSA was monitored weekly until vehicle control treated CRPC, or tumors that recurred in the 10mg/kg ENZ treatment group grew to the experimental endpoint (10% of body weight). Select primary ENZR tumors were excised at the experimental endpoint and tumor sections were allografted subcutaneously into bilateral flanks of castrated 8-10 week old athymic nude mice, which were dosed daily with 10mg/kg ENZ from day of tumor transplant and mice were monitored for growth of transplanted tumors, body weight and serum PSA. Serial transplant of select tumors was repeated for a second and third time as above into castrated mice dosed daily with 10mg/kg ENZ. In total, 35 ENZ R tumors were generated over 3 serial transplant generations from 4 out of 10 primary PSA + ENZ R tumors. Cell lines were generated from primary CRPC as well as primary and transplanted ENZ R tumors by mincing tumor sections, filtering cells through a 10 µm cell strainer and maintaining adhered cells in complete media=rpmi-1640, 10% FBS, 100 U/mL penicillin-g, 100 mg/ml streptomycin (all Hyclone). Media for cells cultured from ENZ R tumors also contained +10 µm ENZ (Haoyuan Chemexpress). Public Data Set Analysis- cbioportal (3) was used to analyse BRN2 mrna expression in the Grasso et. al, 2012 data set (1) in metastatic vs. primary prostate cancer tumors and to generate correlations 5
6 between BRN2 and CGA, CGB, SYP, MYCN and SOX2 expressions in the Memorial Sloan Kettering Cancer Center Prostate Oncogenome Project data set (2). 6
7 REFERENCES 1. Grasso CS, Wu YM, Robinson DR, Cao X, Dhanasekaran SM, Khan AP, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature 2012;487(7406): doi /nature Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al. Integrative genomic profiling of human prostate cancer. Cancer cell 2010;18(1):11-22 doi /j.ccr Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cbio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer discovery 2012;2(5):401-4 doi / CD
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Figure S1. Figure S2. Figure S3.
Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-)
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Brett S Carver, MD Assistant Attending, Department of Surgery/Urology Prostate Cancer Therapeutics: A Changed
TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
A NOVEL CANCER STEM CELL (CSC) DRUG DISCOVERY PLATFORM. Collaborative Opportunity
A NOVEL CANCER STEM CELL (CSC) DRUG DISCOVERY PLATFORM Collaborative Opportunity March 2014 PURPOSE Cancer Research UK funded Investigators have established in vitro and in vivo models of CSCs for use
Clasificación Molecular del Cáncer de Próstata. JM Piulats
Clasificación Molecular del Cáncer de Próstata JM Piulats Introduction The Gleason score is the major method for prostate cancer tissue grading and the most important prognostic factor in this disease.
TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer
AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
N-Myc Induces an EZH2-Mediated Transcriptional Program Driving Neuroendocrine Prostate Cancer
Article N-Myc Induces an EZH2-Mediated Transcriptional Program Driving Neuroendocrine Prostate Cancer Graphical Abstract Authors Etienne Dardenne, Himisha Beltran, Matteo Benelli,..., Mark A. Rubin, Francesca
Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant
Research article Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant Shihua Sun, 1 Cynthia C.T. Sprenger, 1 Robert L. Vessella, 2,3 Kathleen
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M.
SUPPLEMENTARY DATA Gene expression profiling predicts clinical outcome of prostate cancer Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. Hoffman, William L. Gerald Table of Contents
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
PROSTATE CANCER (PC) IS the most commonly
0888-8809/06/$15.00/0 Molecular Endocrinology 20(8):1894 1911 Printed in U.S.A. Copyright 2006 by The Endocrine Society doi: 10.1210/me.2005-0284 Calcitonin Increases Tumorigenicity of Prostate Cancer
TMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
Outline. Outline. Phillip G. Febbo, MD. Genomic Approaches to Outcome Prediction in Prostate Cancer
Genomic Approaches to Outcome Prediction in Prostate Cancer Phillip G. Febbo, MD Duke Institute for Genome Science and Policy Department of Medicine Department of Molecular Genetics and Microbiology Duke
Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
CONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065
AWARD NUMBER: W81XWH-15-1-0277 TITLE: ERF is a Potential ERK-Modulated Tumor Suppressor in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Rohit Bose CONTRACTING ORGANIZATION: Sloan Kettering Institute for
Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer
AD Award Number: W81XWH-07-1-0155 TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Vanderbilt
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-1-1-176 TITLE: Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer PRINCIPAL INVESTIGATOR: Hsieh, Jer-Tsong CONTRACTING ORGANIZATION: University of Texas Southwestern
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies
Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/318/ra29/dc1 Supplementary Materials for Antagonism of EGFR and HER3 Enhances the Response to Inhibitors of the PI3K-Akt Pathway in Triple-Negative Breast Cancer
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
Page 1 09/10/2013 AD Award Number: W81XWH-12-1-0453 TITLE: The cytoplasm translocation of the androgen receptor cofactor p44 as a target for prostate cancer treatment PRINCIPAL INVESTIGATOR: Zhengxin Wang
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are
Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma
Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma cells were treated with celecoxib ( 5.0 M) and/or sildenafil (, 2.0 M). ls were isolated after
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Vanderbilt University Nashville, TN U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-14-1-0312 TITLE: The Role of NFIB in Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Magdalena Grabowska CONTRACTING ORGANIZATION: Vanderbilt University Nashville, TN 37240 REPORT
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Overcoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate
AWARD NUMBER: W81XWH-12-1-0529 TITLE: Cancer Overcoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate PRINCIPAL INVESTIGATOR: Christopher Evans, M.D. CONTRACTING ORGANIZATION: University
TITLE: Effect of COX-2 (PGE2) and IL-6 on Prostate Cancer Bone Mets
AD Award Number: W81XWH-05-1-0166 TITLE: Effect of COX-2 (PGE2) and IL-6 on Prostate Cancer Bone Mets PRINCIPAL INVESTIGATOR: Alice C. Levine, M.D. CONTRACTING ORGANIZATION: Mount Sinai School of Medicine
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
Fatty acid activated PPAR promotes tumorigenicity of prostate cancer cells by up regulating VEGF via PPAR responsive elements of the promoter.
University of Plymouth PEARL https://pearl.plymouth.ac.uk 01 University of Plymouth Research Outputs University of Plymouth Research Outputs 2016-02-23 Fatty acid activated PPAR promotes tumorigenicity
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Award Number: W81XWH TITLE: Dependency on SRC-Family Kinases for Recurrence of Androgen- Independent Prostate Cancer
AD Award Number: W81XWH-08-1-0026 TITLE: Dependency on SRC-Family Kinases for Recurrence of Androgen- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Irwin H. Gelman, Ph.D. CONTRACTING ORGANIZATION:
Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Glucocorticoid Receptor Confers Resistance to Antiandrogens by Bypassing Androgen Receptor Blockade
Glucocorticoid Receptor Confers Resistance to Antiandrogens by Bypassing Androgen Receptor Blockade Vivek K. Arora, 1,2 Emily Schenkein, 1 Rajmohan Murali, 1,3 Sumit K. Subudhi, 2 John Wongvipat, 1 Minna
A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding
Supplementary Information A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding Qilai Huang 1,2*, Thomas Whitington 3,4*, Ping Gao 1,2, Johan
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties
SUPPLEMENTAL INFORMATION Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties Anurag N Paranjape 1, *, Rama Soundararajan 1, *, Steven
Supplementary Figure 1
Supplementary Figure 1 # nonsynonymous mutations (tngs, 1561 genes) 600 p=0.056 500 250 200 150 100 50 0 HLA-DR (-) HLA-DR (+) Supplementary Figure 1: HLA-DR(+) melanoma cell lines are associated with
TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0588 TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Timothy Ratliff CONTRACTING ORGANIZATION:
SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
Simplify the relations between genes and diseases into typed binary relations. PubMed BioText GoPubMed
Simplify the relations between genes and diseases into typed binary relations PubMed BioText GoPubMed biological events An example sentence Gene Expression and Cancer We conclude that MMP-7 over-expression
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer
Research article ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer Changmeng Cai, 1 Hongyun Wang, 1 Housheng Hansen He, 2,3 Sen Chen, 1 Lingfeng He, 1 Fen Ma, 1 Lorelei Mucci,
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
TITLE: A Changing Landscape of Advanced Prostate Cancer: Understanding Mechanisms of Resistance to Potent Hormonal Therapies
AWARD NUMBER: W81XWH-13-1-0275 TITLE: A Changing Landscape of Advanced Prostate Cancer: Understanding Mechanisms of Resistance to Potent Hormonal Therapies PRINCIPAL INVESTIGATOR: Himisha Beltran, M.D.
Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative
SUPPLEMENTARY INFORMATION Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative breast cancer Roman Camarda, Alicia Y. Zhou, Rebecca A. Kohnz, Sanjeev Balakrishnan, Celine
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Color Key PCA. mir- 15a let-7c 106b let-7b let-7a 16 10b 99a 26a 20b 374b 19b 135b 125b a-5p 199b-5p 93 92b MES PN.
1123 83 528 816 84 2 17 718 Comp3 3 2 1 1 2 3 4 Comp2 a b Color Key MES PN PCA 3 2 1 1 2 3 4 Comp1 1 2 3 1 2 3 4-2 -1 1 2 mi- 15a let-7c 16b let-7b let-7a 16 1b 99a 26a 2b 374b 19b 135b 125b 9 34 125a-5p
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Nuove opzioni terapeutiche nel Carcinoma della Prostata: IMMUNOTERAPIA. Andrea Sbrana U.O. Oncologia Medica 2 Universitaria AOU Pisana
Nuove opzioni terapeutiche nel Carcinoma della Prostata: IMMUNOTERAPIA Andrea Sbrana U.O. Oncologia Medica 2 Universitaria AOU Pisana Until now: Some success Kantoff et al, N Engl J Med 2010 Kantoff et