Nature Biotechnology: doi: /nbt.2435

Transcription

1 Supplementary Figure 1: Characterization of expanded FD-NC. a, Survival rate after thawing of frozen FD-NC. b, Population doubling time of expanded FD-NC. c, Cell cycle analysis of expanded FD-NC. d, Representative image of Ki-67 staining with expanded FD-NC. e, Left panel: Quantification of NC marker expression in expanded FD-NC; Right panel: representative image of S100b staining. f, Neuronal potential of expanded FD-NC. Scale bars, 50 m.

2 Supplementary Figure 2: Optimization of FD-NC culture condition for 384 well plate. a, Representative images of plated FD-NC (DAPI and CalceinAM staining) for evaluating coating reagents. FD-NC plating efficiency using the optimized in-house coating protocol was compared plating to that on Corning CellBIND microtiter plates or on plates pre-coated for shorter periods b, Metabolic and cell growth responds to different DMSO concentrations at 72 (gray), and 96 (black) hours post seeding. c, Optimal cell seeding density in 384-well microtiter plates at 48 (white), 72 (gray), and 96 (black) hours post seeding. d, Design of primers for WT and MU-IKBKAP transcript based on previous work of the S. Slaugenhaupt lab.

3 Supplementary Figure 3: Work flow of chemical screening in FD-NC precursors. Summary of the day-by-day work flow from cell plating to qrt-pcr analysis under HTS conditions. PP*= Personal Pipettor

4 Supplementary Figure 4: Quality control data of the chemical screen. a,b, Three-dimensional scatter plot of the run data for WT- and MU-IKBKAP and 18S in each of the three replicate sets. c-e Box plots of the Ct values for WT- and MU-IKBKAP and 18S (black) under both control conditions and in the presence of compounds for each of the three replicate sets. f,g, Z score calculated for internal controls of each of the plates of the screen for both WT- and MU-IKBKAP.

5 Supplementary Figure 5: Validating impact of treatment with 8 compounds on WT-IKBKAP expression in various cell types and on MU IKBKAP transcripts levels. a-c Assessment of WT- IKBKAP expression in 6-well plate format in undifferentiated FD-iPC (a), FD-fibroblasts (b) and FD-lymphoblasts (c). d. qrt-pcr result of 8 compound treatment on WT NC (from H9). e. Effect of THIA on different FDNC derived from independent FD-hiPSC clones. f, MU-IKBKAP transcript level after treatment with 8 compounds. g,h The correlation between WT-IKBKAP (g) or MU-IKBKAP (h) transcript levels with IKAP protein. n = 3-4; * P < All values are mean and s.d. F.C., Fold Change based on DMSO.

6 Supplementary Figure 6: Validating impact of treatment with 8 compounds on proliferation of FD-iPSC derived NC precursors. a, Percentage of Ki-67 positive cells in FD-NC cultures. n = 3, All values are mean and s.d.

7 Supplementary Figure 7: Validating impact of short- or long-term treatment with 8 compounds on. a,b, ASCL1 (a) and SCG10 (b) expression of FD-NC after 48 hours treatment of 8 compounds. c,d, Level of HNK1+ cells (c) and WT-IKBKAP expression (d) of FD-NC after long term treatment with 8 compounds during the differentiation of FD-iPSC into FD-NCs. e, Dose response curve of SKF over WT-IKBKAP expression. n = 3-4; * P < All values are mean and s.d. F.C., Fold Change based on DMSO.

8 Supplementary Figure 8: Mechanistic studies on SKF action a,b, Expression of 2 adrenergic receptor subunits (A, B and C) in undifferentiated FD-iPSC (a) and FD-iPSC derived neural cells (b). c, camp levels after treatment of inhibitor and stimulators in 2 adrenergic receptor pathway and other 8 hit compounds. d, Quantification of phosphorylated CREB level in treated FD-NC. n = 3-5; * P < 0.05; ** P < 0.01; *** P < All values are mean and s.d. F.C., Fold Change based on DMSO. N.S., Not Significant.

9 Supplementary Table 1 Component Volume for One Reaction Primer Sequence Vendor Sigma WT IKBKAP-F GCAGCAATCATGTGTCCCA Aldrich Sigma WT IKBKAP-R ACCAGGGCTCGATGATGAA Aldrich Sigma MU IKBKAP-F CACAAAGCTTGTATTACAGACT Aldrich MU IKBKAP- Sigma R GAAGGTTTCCACATTTCCAAG Aldrich Sigma 18S-F GGCCCTGTAATTGGAATGAG Aldrich Sigma 18S-R GCTATTGGAGCTGGAATTAC Aldrich Final Concentration 200 nm 200 nm 200 nm 200 nm 200 nm 200 nm Stage Temperature Time

10 Supplementary Table 2 Structure SKI-ID Compound Name Vendor Function/Therapeutic Category FDA Approved Selection Method Altretamine Sigma-Aldrich Alkylating antineoplastic agent Yes CT Lycorine MicroSource Toxic crystalline alkaloid No Rank Gitoxingenin MicroSource Steroid aglycone No CT Glucosaminic acid MicroSource Unknown No CT Betamethasone MicroSource Glucocorticoid Yes CT Emetine MicroSource Anti-protozoal/Emetic Yes Rank Hydrocortisone MicroSource Glucocorticoid Yes CT Phenindione MicroSource Anticoagulant Yes CT Althiazide MicroSource Diuretic No CT Betulin MicroSource Ttriterpenoid No CT Emodin MicroSource Anti-neoplastic No CT Ranitidine MicroSource Anti-Ulcer Agents Yes CT Quinolinic Acid Tocris A metabolite of tryptophan Experimental CT Cyclosporine MicroSource Immunospressant Yes Rank Aklomide MicroSource Anthelmintic Withdrawn (veterinary use only) CT hexyloxybenzamide MicroSource Anti-fungal No CT Dihydrojasmonic acid MicroSource Uknown No CT Leucodin Prestwick Uknown No Rank Thiamylal MicroSource Anesthetics, Intravenous Yes CT

11 Supplementary Table Diltiazem Sigma-Aldrich Antihypertensive agent Yes CT Terbutaline MicroSource 2 adrenergic agonist, bronchodilator Yes CT Norharman Prestwick DNA Intercalator No Rank Azacytidine MicroSource Chemotherapeutic agents Yes Rank aminocyclobutanecarboxylic acid Tocris NMDA R agonist No CT Domoic Acid Tocris Neuromuscular Depolarizing Agent Experimental CT Alpha-methyl-4- carboxyphenylglycine Tocris Anti-neoplastic No CT palmitoyl-dl-carnitine chloride Tocris a specific protein kinase C inhibitor No Rank CGP Tocris 1 adrenoceptor antagonist No Rank GR Sequoia 5-HT4 receptor antagonist No CT Cefodizime Sigma Aldrich Broad spectrum antibiotic Yes Rank Atropine Sigma Aldrich Adjuvants, Anesthesia, Muscarinic Antagonists Yes Rank Gabaculine Sigma-Aldrich Tdp 1 Enzyme Inhibitor Experimental Rank Carboxymethoxylamine Sigma-Aldrich Unknown No CT SKF Hydrochloride Prestwick 2 adrenoceptor antagonist No CT Cyproterone Sigma Aldrich Androgen Antagonist Yes Rank Theaflavin 3,3'-digallate MicroSource Anti-oxidant No CT hydroxy-7-methoxy-1,3- benzodioxole-5-carboxylic acid MicroSource Unknown No CT (3-phenyl-4,5-dihydro-1,2- oxazol-5-yl)acetic Acid Sigma-Aldrich Anti-neoplastic No CT Caffeyl alcohol MicroSource Catechol No CT

12 Supplementary Table Aminocaproic Acid LOPAC Antifibrinolytic Agent Yes CT Gitoxigenin MicroSource Cardenolide No Rank methyl 2-[4-(thiophen-2- ylcarbonyl)phenyl]propanoate MicroSource NSAID/Anti-miotic Yes Rank N,N-Dipropyl-5- carboxamidotryptamine maleate salt Sigma Aldrich 5-HT1A serotonin receptor agonist No Rank