Platform Approach to Cancer Discovery and Diagnostics Development

Size: px
Start display at page:

Download "Platform Approach to Cancer Discovery and Diagnostics Development"

Transcription

1 Platform Approach to Cancer Discovery and Diagnostics Development Joanne Yeakley Staff Manager, Scientific Research Diagnostic Assay Development 2009 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iselect, CSPro, and GenomeStudio are registered trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iselect, CSPro, GenomeStudio, Genetic Energy, and HiSeq are registered trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners.

2 Sales ($ millions) Oncology is a Key Growth Segment Molecular Diagnostics $5, % Growth 16% Pharmacogenomics $200; 32% Oncology $600; 27% $2,375 Histo./Cytology $700; 23% Source: The World Wide Market for In Vitro Diagnostics Tests 5th Edition

3 The US Population Male United States: 2000 Female Population (millions) 3

4 is Aging Male United States: Female Population (millions) 4

5 Resulting in New Chronic Diseases Life Expectancy Top 10 Incurable diseases 1. Common Cold Sporadic 2. Cancer 3. Asthma 4. HIV 5. Diabetes 6. CJD - Lethal 7. Influenza Vaccines/Lethal 8. Lupus 9. Polio - Vaccines 10. Ebola - Lethal Cancer Asthma HIV Diabetes Lupus World Resources Institute

6 In Spite of Improvements Annual Age-adjusted Cancer Death Rates* Among Males for Selected Cancers, United States, 1930 to 2004 From Jemal, A. et al. CA Cancer J Clin 2008;58: Copyright 2008 American Cancer Society 6

7 Cancer Remains Lethal Heart disease 97.4% Cancer Stroke Chronic Respiratory Diabetes Few Established NATs Future technology fit Compelling unmet needs Causes of Death (USA, 2003) All other Diabetes Resp. Stroke Cancer Heart Accident Source: TIME, December 4, 2006, citing CDC and National Transportation Safety Board 7

8 Cancer Therapies Dominate the Biotech Pharma Pipeline Solid Tumors Lead Cancer Therapies Cancer 210 Solid Tumors 145 Infectious Disease AutoImmune Unspecified Cancers Lung Leukemia CVD 22 Prostate 79 HIV Other Breast ColoRectal Lymphoma Neurological Disease Diabetes Other Cancers Skin Pancreatic Digestive Disorders 14 Cancer-Related Conditions 39 Respiratory Disease Blood Disorders Kidney Brain Ovarian Genetic Disorders 9 Myeloma 31 Skin Disorders Eye Conditions 7 6 Head/Neck Liver Stomach Growth Disorders Transplantation 4 4 Cervical Bladder Sarcoma Source: PhRMA: 2006 Medicines in Development Biotechnology

9 Probability of Cure (%) Oncology Discovery Initial Targets Testis Thyroid 70 Melanoma Breast 60 Bladder Prostate 50 Kidney Oral Cervix/ Uteri Colon/ rectum 40 Ovary NHL Nasopharynx CNS Brain Myeloma Leukemia Esophagus Gastric Source: WHO 10 0 Lung Pancreas Liver Percentage of All Cancers 9

10 Oncology Discovery Ovarian Cancer Deadly 204,449 New cases annually; 124,860 deaths Incurable 110% 90% 92% Cum % of Cases 5 Yr Survival 85% 82% 100% Less than 40% are cured 70% 69% 72% Difficult Dx Patients present with a suspicious/palpable mass Early Dx is Key Five year survival is good if diagnosed early, but most patients are diagnosed late stage 50% 30% 10% 19% 22% 30% 56% 33% 37% 51% 40% 47% 39% 54% 26% 17% 12% Illumina Solution Develop a diagnostic assay which will diagnose ovarian cancer at an early stage -10% Ia Ib Ic Iia Iib Iic IIIa IIIb IIIc IV 10

11 Two Factors Make Ovarian Cancer Lethal Resistance to Therapy Due to Interference with the Apoptotic Pathway Mitochondria Cytochrome c Bcl-x(L) RESPONSE TO SALVAGE TREATMENT Step 1. Cytochrome c release Bad 60% Cytochrome c Apaf-1 Step 2. Apoptosome Formation Procaspase-9 AKT 33% 25% Procaspase-9 XIAP Step 3. Caspase Activation HtrA1 <6 6 to to 24 >24 Overexpression Down Regulation Functional apoptosome with active caspase-9 Time between last chemotherapy and relapse Source: Ovarian Cancer Coukos, G, et al. 11

12 12 A Disruptive Sequencing Technology

13 Cost per Human Genome The Tipping Point in Human Genome Sequencing $100M Costs Venter Genomes 1M $10M Watson 100k $1M African, Asian, Cancer pair 10k $100k $10k 169 in Genbank 1,000 Individual Genome Sequencing Time 13

14 SBS Sequencing Technology 3 5 DNA (<1 ug) Sample preparation Single Cluster molecule growtharray A C T C T G C T G A A G 5 T G C T A C G A T A C C C G A T C G A T Sequencing T G C T A C G A T Image acquisition Base calling 14

15 Platform Features Feature GAIIx HiSeq2000 Flowcells x Surface Imaging 1 x 1 2 x 2 Read length 2 x x 100 Yield per run (PF data) 50 Gb Gb Data Rate 5 Gb / day Gb / day Human Genomes (30x) per run 0.5 >2 15

16 Empirical Q score Average Q score Data Quality Q scores are accurate >90% bases are>99.9% accurate (2 x 100) Predicted Q score Cycle Average accuracy (aligned PF data) 99.95% 99.93% 99.90% 99.79% % PF bases > Q30 (99.9% accuracy) 96.5% 95.9% 94.6% 92.3% 16

17 Applications Whole genome re-sequencing Targeted sequencing (regions, genes, exomes) de novo sequencing Whole transcriptome sequencing mirna discovery and profiling DNA Methylation Histone Modification DNA-protein interaction Others 17

18 Whole Genome Sequencing: In House Projects Instrument Readlength (bp) Gb (PF) per run Flowcells per genome Project GA Yoruba genomes GA II genomes pilot GA II Melanoma, PGS pilot GA IIx Cancer, PGS GA IIx Cancer, PGS HiSeq <1 Human, Cancer 100 genomes completed to >30x to date in house using the GA 18

19 First African Individual Genome Sequence defines personal genetic profile Sequence data covers the 3 billion base genome to a depth of 40x 99.9% coverage at >99.999% consensus accuracy SNPs: 3.8 million (26% novel) Structural variants: 0.4 million Variation reflects ethnic origin and natural selection Near-complete individual profile of genetic variants Bentley et al. Nature 456: pp (2008) 19

20 Impact of Human Whole Genome Sequencing A Whole Genome Approach: Comprehensive catalogues of variation Discovery, characterisation and screening Address all types of sequence variant Germline and somatic mutation discovery Understand disease mechanisms Future applications in healthcare, personalised medicine 20

21 21 Cancer Whole Genome Sequencing Pilot

22 Whole Genome Sequencing: In House Projects Instrument Readlength (bp) Gb (PF) per run Flowcells per genome Project GA Yoruba genomes GA II genomes pilot GA II Melanoma, PGS pilot GA IIx Cancer, PGS GA IIx Cancer, PGS HiSeq <1 Human, Cancer 100 genomes completed to >30x to date in house using the GA 22

23 Melanoma: COLO-829 Collaboration with Mike Stratton, et Sanger Melanoma cell line COLO-829 and its matched normal (>30x depth) Male; metastatic tumour; prior to treatment BRAF, CDKN2A and PTEN mutations previously confirmed by exon sequencing SKY karyotype indicates pseudotriploidy Karyotype courtesy of Paul Edwards, University of Cambridge 23

24 Variant Detection Run specifications 2 x 75 base runs, 15 Gb / run. 0.2, 1, 2 & 4 kb libraries Single base substitutions Paired reads aligned with ELAND (non-gapped) Requires Q100 per allele, e.g. 3 x Q33 bases or equivalent Small indels Split reads aligned individually or grouped (Pindel, BWA, Grouper) Minimum 3x depth Larger structural variants Anomalous read pairs from short and long insert libraries >3 S.D. (deletions) or >5 S.D. (insertions) Minimum 10 reads Copy number changes Read depth (BWA+) in 10 kb windows 24

25 Somatic Substitutions in COLO-829 Subtraction process High stringency calibrated tumour calls (germline + somatic) Subtract if evidence of variant in normal; & dbsnp 33,345 somatic substitutions (gain of an allele) in total 1 per 100 kb 32,325 single base 510 double base (adjacent) 96.6% specificity 454/470 novel somatic calls confirmed by new PCR-capillary sequencing 16 may be artefacts of either method 88% (98%) sensitivity 42/48 previous somatic variants called automatically (98%) or 47/48 automatic + manual (five seen only manually as the evidence was below automatic threshold) 1/48 disputed call 25

26 Somatic Mutational Signature of UV Exposure 69.9% of all somatic substitutions are C T or G A 92% of somatic C T are in a YC pyrimidine dimer (vs. 53% by chance) T G C A 26

27 Complex CNV in tumour on chromosome 3 Tumor Tumour (40X) Normal (30X) Normal 4 genes in this region: RARB, TOP2B, NGL1,KS 27

28 Catalogue of COLO-829 Somatic Variants 33,345 Single base substitutions 286 coding 1018 small indels 14 coding 37 Structural rearrangements 34 intrachromosomal: 25 deletions 6 insertions 2 duplications 1 complex 3 interchromosomal 19 breakpoints in genes 198 changes in copy number Ideograms / val indels / sn 10M / cdsn / cn /loh / sv 28

29 29 Cancer Discovery 2010 Update

30 Whole Genome Sequencing: In House Projects Instrument Readlength (bp) Gb (PF) per run Flowcells per genome Project GA Yoruba genomes GA II genomes pilot GA II Melanoma, PGS pilot GA IIx Cancer, PGS GA IIx Cancer, PGS HiSeq <1 Human, Cancer 100 genomes completed to >30x to date in house using the GA 30

31 Ovarian Cancer Discovery Establish end-to-end workflow for sequencing, analysis, interpretation Refine analysis tools Sequence 25 tumour normal genome pairs (>30x depth) Identify genome wide catalogues of somatic mutation Search for mutational signatures, novel biomarkers, etc. Incorporate RNA and methylation data Gain experience in line with ICGC and similar projects 31

32 Illumina s Oncology Discovery Initiative Samples Discovery Validation Dx Service Dx Product Clinical Partnership Obtain consent Obtain samples Prep samples Build libraries 25 Tumor/ Normals W GS Methylome Transcriptome samples BeadChip analysis LDT in CLIA lab Prospective trials CE- IVD US IVD Ovarian is here 32

33 Cancer Sequencing Workflow Receive samples Genotype for tracking and QC Sequence & QC data Build genome (CASAVA) Check tracking and QC Call somatic variants: - substitutions - indels <100 bp - SVs >100 bp - CNVs Annotate variants Cross-sample comparison Visualize in IGV 33

34 Variant Detection Run specifications 300 bp lib, 2x100s, PF Gb/fc, revised (v4) chemistry Revised (PL 1.6) image analysis, basecall calibration (>90% Q30 bases) Single base substitutions Paired reads aligned with ELAND2 (multi-seed, gapped alignment) Threshold 10, i.e. requires 3 x Q33 bases or equivalent Small indels Local assembly, gapped alignment of consensus (Grouper) Minimum 5x depth. Now seeing up to 100-base events Larger structural variants Anomalous read pairs from short and long insert libraries >3 S.D. (deletions) or >5 S.D. (insertions) Minimum 5 reads then additional evidence-based ranking Copy number changes Multiple approaches incl. recursive partitioning of read depth 35

35 Cancer Genome Summary Statistics Tumour Tumour depth Normal depth Somatic gains Melanoma x 32.5x 33,345 Breast x 29.0x 4,838 Ovarian A 40.5x 37.3x 7,147 Ovarian B 32.5x 35.1x 1,099,481 Ovarian C 38.0x 39.1x 4,284 Ovarian D 32.7x 37.2x 1,244 Ovarian E 36.2x 35.4x 3,727 Ovarian F 37.2x 29.7x 11,984 Ovarian G 30.4x 32.0x 3,091 Ovarian H 39.9x 35.0x 5,623 Ovarian I 34.8x 34.2x 8,824 Ovarian J 35.8x 39.9x 4,815 Tumour Tumour depth Normal depth Somatic gains Ovarian K 32.3x 33.0x 3,255 Ovarian L 32.8x 39.6x 3,093 Ovarian M 37.6x 42.9x 4,480 Ovarian N 38.3x 37.8x 6,698 Ovarian O 36.7x 30.1x 5,485 Ovarian P 35.9x 39.2x 3,489 Ovarian Q 34.7x 35.5x 5,584 Ovarian R 35.7x 33.9x 5,973 Ovarian S 34.5x 33.6x 2,154 Ovarian T 35.2x 33.3x 2,203 Ovarian U 38.1x 35.6x 2,881 36

36 IGV visualisation of two variants in TP53 Tumour L Normal L Tumour R Normal R 37

37 Summary of TP53 somatic substitutions (SNVs) 14/17 high grade serous samples have TP53 somatic substitution variants (SNVs) further analysis of remaining samples ongoing Review vs. COSMIC: All are in known TP53 hotspots All are novel observations in ovarian cancer Two seen previously in other cancers TP53 mutations reported in 97% of high grade pelvic serous carcinoma samples in a recent study (Ahmed et al 2010) 38

38 Copy Number: Chr6 C6orf170, FABP7, GJA1, HSF2, NKAIN2,PKIB, RLBP1L2, SERINC1, SLC25A5P7, SMPDL3A, TRDN sample100 sample102 Tumor Normal AIM,1 ASC3C, ATG5, BEND3, BVES, C6orf112, C6orf203, CCNC, GRIK2, HACE1, LIN28B, MCHR2, MIRN587, POPDC3, PRDM1, PRDM13, PREP, QRSL1, RPL35P3, RTN4IP1, SIM1, USP45 sample104 sample101 sample103 sample111 39

39 Circos 5 Tumor/Normal Pairs Genomes are extensively rearranged, even at early stages Tumors are heterogeneous Lots of fertile ground for biomarker discovery 40

40 Summary and Future Prospects A Genome-Wide Opportunity: Comprehensive variant catalogues >95% specificity and ~90% sensitivity of somatic substitutions System developments enable large-scale studies: v5 chemistry, software improvements (>99.9% raw data accuracy) HiSeq2000 platform (>300 Gb per run: two 30x genomes per instrument per week) Implications for individual genome sequencing: Understanding disease mechanism, biomarker discovery Sequencing individual cancer genomes for personalised treatment 41

41 Many Thanks to all our Collaborators and the Illumina teams... 42

Somatic cancer applications of NGS in in vitro Diagnostics.

Somatic cancer applications of NGS in in vitro Diagnostics. Somatic cancer applications of NGS in in vitro Diagnostics. Nitin Udar PhD In Vitro Diagnsotics Division Illumina, Inc. 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray,

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Molecular Characterization of Tumors Using Next-Generation Sequencing

Molecular Characterization of Tumors Using Next-Generation Sequencing Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation

More information

Bigomics : Challenges and promises in large scale sequencing projects

Bigomics : Challenges and promises in large scale sequencing projects Bigomics : Challenges and promises in large scale sequencing projects Theodore M. Wong Ken Yocum MSST 2014 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28

More information

Breast Cancer TAUG Overview and Implementation

Breast Cancer TAUG Overview and Implementation Breast Cancer TAUG Overview and Implementation Anita Umesh, Ph.D. Senior Scientist, Enterprise Informatics Illumina, Inc. Bay Area CDISC User Group 9 December 2015 2014 Illumina, Inc. All rights reserved.

More information

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four

More information

The Cancer Genome Atlas & International Cancer Genome Consortium

The Cancer Genome Atlas & International Cancer Genome Consortium The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

The Cancer Genome Atlas

The Cancer Genome Atlas The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

New Drug development and Personalized Therapy in The Era of Molecular Medicine

New Drug development and Personalized Therapy in The Era of Molecular Medicine New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

Supplementary Note. Nature Genetics: doi: /ng.2928

Supplementary Note. Nature Genetics: doi: /ng.2928 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Multiple samples from five patients (P4, P8, P14, P15 and P17) with Barrett s esophagus and adjacent EAC show that the poor overlap is not a result of sampling bias. Bar graphs showing

More information

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

Epidemiology in Texas 2006 Annual Report. Cancer

Epidemiology in Texas 2006 Annual Report. Cancer Epidemiology in Texas 2006 Annual Report Cancer Epidemiology in Texas 2006 Annual Report Page 94 Cancer Incidence and Mortality in Texas, 2000-2004 The Texas Department of State Health Services Texas Cancer

More information

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies

More information

Information Services Division NHS National Services Scotland

Information Services Division NHS National Services Scotland Cancer in Scotland October 2012 First published in June 2004, revised with each National Statistics publication Next due for revision April 2013 Information Services Division NHS National Services Scotland

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

National Cancer Statistics in Korea, 2014

National Cancer Statistics in Korea, 2014 National Cancer Statistics in Korea, 2014 2016. 12. 20. Korea Central Cancer Registry Cancer Incidence in Korea, 2014 National Cancer Incidence, 2014 Trends in Cancer Incidence by Sex and Year * Dark colored

More information

ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology

ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

An integrated map of genetic variation from 1092 human genomes

An integrated map of genetic variation from 1092 human genomes SUPPLEMENTAL METHODS AND MATERIALS Whole genome sequencing Alignment: Short insert paired-end reads were aligned to the GRCh37 reference human genome with 1000 genomes decoy contigs using BWA-mem(1). Somatic

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Information Services Division NHS National Services Scotland

Information Services Division NHS National Services Scotland Cancer in Scotland April 2013 First published in June 2004, revised with each National Statistics publication Next due for revision October 2013 Information Services Division NHS National Services Scotland

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Identification of genomic alterations in cervical cancer biopsies by exome sequencing

Identification of genomic alterations in cervical cancer biopsies by exome sequencing Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read

More information

Evaluation of Ancestry Information Markers (AIMs) from Previous ACOSOG/CALGB/NCCTG Trials

Evaluation of Ancestry Information Markers (AIMs) from Previous ACOSOG/CALGB/NCCTG Trials Evaluation of Ancestry Information Markers (AIMs) from Previous ACOSOG/CALGB/NCCTG Trials Mary Beth Terry, PhD Department of Epidemiology Mailman School of Public Health Racial and Ethnic Disparities in

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff 5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs

More information

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi 2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

Myeloma Genetics what do we know and where are we going?

Myeloma Genetics what do we know and where are we going? in partnership with Myeloma Genetics what do we know and where are we going? Dr Brian Walker Thames Valley Cancer Network 14 th September 2015 Making the discoveries that defeat cancer Myeloma Genome:

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

Oncology 101. Cancer Basics

Oncology 101. Cancer Basics Oncology 101 Cancer Basics What Will You Learn? What is Cancer and How Does It Develop? Cancer Diagnosis and Staging Cancer Treatment What is Cancer? Cancer is a group of more than 100 different diseases

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Information Services Division NHS National Services Scotland

Information Services Division NHS National Services Scotland Cancer in Scotland April 2017 First published in June 2004, revised with each National Statistics publication Next due for revision October 2017 Information Services Division NHS National Services Scotland

More information

The Next Generation of Hereditary Cancer Testing

The Next Generation of Hereditary Cancer Testing The Next Generation of Hereditary Cancer Testing Why Genetic Testing? Cancers can appear to run in families. Often this is due to shared environmental or lifestyle patterns, such as tobacco use. However,

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Henson KE, Brock R, Charnock J, Wickramasinghe B, Will O, Pitman A. Risk of suicide after cancer diagnosis in England. JAMA Psychiatry. Published online November 21, 2018.

More information

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

The 100,000 Genomes Project

The 100,000 Genomes Project The 100,000 Genomes Project Dr Matina Prapa, Scientific co ordinator Genomics England Clinical Interpretation Partnership William Harvey Research Institute Queen Mary University of London Genomics England

More information

COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION

COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION Pierre Martinez, Nicholas McGranahan, Nicolai Juul Birkbak, Marco Gerlinger, Charles Swanton* SUPPLEMENTARY INFORMATION SUPPLEMENTARY

More information

The Cancer Genome Atlas Pan-cancer analysis Katherine A. Hoadley

The Cancer Genome Atlas Pan-cancer analysis Katherine A. Hoadley The Cancer Genome Atlas Pan-cancer analysis Katherine A. Hoadley Department of Genetics Lineberger Comprehensive Cancer Center The University of North Carolina at Chapel Hill What is TCGA? The Cancer Genome

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Molecular Panel Testing of Cancers to Identify Targeted Therapies File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_panel_testing_of_cancers_to_identify_targeted_therapies

More information

Cancer in Ontario. 1 in 2. Ontarians will develop cancer in their lifetime. 1 in 4. Ontarians will die from cancer

Cancer in Ontario. 1 in 2. Ontarians will develop cancer in their lifetime. 1 in 4. Ontarians will die from cancer Cancer in Ontario 1 in 2 Ontarians will develop cancer in their lifetime 1 in 4 Ontarians will die from cancer 14 ONTARIO CANCER STATISTICS 2016 1 Cancer in Ontario An overview Cancer is a group of more

More information

Annual Report to the Nation on the Status of Cancer, , Featuring Survival Questions and Answers

Annual Report to the Nation on the Status of Cancer, , Featuring Survival Questions and Answers EMBARGOED FOR RELEASE CONTACT: Friday, March 31, 2017 NCI Media Relations Branch: (301) 496-6641 or 10:00 am EDT ncipressofficers@mail.nih.gov NAACCR: (217) 698-0800 or bkohler@naaccr.org ACS Press Office:

More information

Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing

Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical

More information

information in the genome organism: phenotype from its genotype, given a specific environment

information in the genome organism: phenotype from its genotype, given a specific environment Life is the translation of the information in the genome into the phenotype of the organism: The organism computes this phenotype from its genotype, given a specific environment Genome?! (PentiumV) (neuronal

More information

Liquid biopsy: the experience of real life case studies

Liquid biopsy: the experience of real life case studies Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal

More information

THE BURDEN OF CANCER IN NEBRASKA: RECENT INCIDENCE AND MORTALITY DATA

THE BURDEN OF CANCER IN NEBRASKA: RECENT INCIDENCE AND MORTALITY DATA THE BURDEN OF CANCER IN NEBRASKA: RECENT INCIDENCE AND MORTALITY DATA Presented by: Bryan Rettig, MS Nebraska Dept. of Health & Human Services Division of Public Health May 31, 2017 Nebraska Cancer Registry

More information

CUP: Treatment by molecular profiling

CUP: Treatment by molecular profiling CUP: Treatment by molecular profiling George Pentheroudakis Professor of Oncology Medical School, University of Ioannina Greece Chair, ESMO Guidelines September 2018 Enterprise Interest No disclosures.

More information

Disruptive innovation in molecular diagnostics. Hilde Windels CEO Biocartis 25 March 2017

Disruptive innovation in molecular diagnostics. Hilde Windels CEO Biocartis 25 March 2017 Disruptive innovation in molecular diagnostics Hilde Windels CEO Biocartis 25 March 2017 1 One of the key innovations in healthcare in the last decade PERSONALISED MEDICINE or HIGH PRECISION MEDICINE From

More information

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically

More information

Bioengineering and World Health. Lecture Twelve

Bioengineering and World Health. Lecture Twelve Bioengineering and World Health Lecture Twelve Four Questions What are the major health problems worldwide? Who pays to solve problems in health care? How can technology solve health care problems? How

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

Patient Leader Education Summit. Precision Medicine: Today and Tomorrow March 31, 2017

Patient Leader Education Summit. Precision Medicine: Today and Tomorrow March 31, 2017 Patient Leader Education Summit Precision Medicine: Today and Tomorrow March 31, 2017 Precision Medicine: Presentation Outline Agenda What is a Precision Medicine What is its clinical value Overview of

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

Outcomes Report: Accountability Measures and Quality Improvements

Outcomes Report: Accountability Measures and Quality Improvements Outcomes Report: Accountability Measures and Quality Improvements The FH Memorial Medical Center s Cancer Committee ensures that patients with cancer are treated according to the nationally accepted measures.

More information

CANCER 1.7 M 609,000 26% 15.5 M 73% JUST THE FACTS. More Than 1,100 Cancer Treatments in Clinical Testing Offer Hope to Patients

CANCER 1.7 M 609,000 26% 15.5 M 73% JUST THE FACTS. More Than 1,100 Cancer Treatments in Clinical Testing Offer Hope to Patients CANCER MEDICINES IN DEVELOPMENT 2018 REPORT JUST THE FACTS MORE THAN 1.7 M ESTIMATED NEW CASES OF CANCER IN 2018 IN THE UNITED STATES MORE THAN 609,000 U.S. CANCER DEATHS ARE EXPECTED IN 2018 SINCE PEAKING

More information

Big data vs. the individual liver from a regulatory perspective

Big data vs. the individual liver from a regulatory perspective Big data vs. the individual liver from a regulatory perspective Robert Schuck, Pharm.D., Ph.D. Genomics and Targeted Therapy Office of Clinical Pharmacology Center for Drug Evaluation and Research Food

More information

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy

More information