REGULATION OF DRUG RESISTANCE BY IKAROS

Transcription

1 The Pennsylvania State University The Graduate School College of Medicine REGULATION OF DRUG RESISTANCE BY IKAROS A Dissertation in Cell and Molecular Biology by Marie Sioussat Shaner Bulathsinghala 2015 Marie Sioussat Shaner Bulathsinghala Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2015

2 The dissertation of Marie Sioussat Shaner Bulathsinghala was reviewed and approved* by the following: Sinisa Dovat Physician, Associate Professor of Pediatrics, Pharmacology, & Biochemistry Director, Translational Research Four Diamonds Pediatric Cancer Research Center Dissertation Advisor Chair of Committee Barbara Miller Physician, Professor of Pediatrics Chief, Division of Pediatric Hematology/Oncology John W. Wills Professor and Distinguished Educator of Microbiology & Immunology Gregory S. Yochum Assistant Professor of Biochemistry & Molecular Biology Sarah K. Bronson Associate Professor of Cellular & Molecular Physiology Director, Cellular & Molecular Biology Graduate Program *Signatures are on file in the Graduate School ii

3 ABSTRACT Acute leukemia is the most common form of cancer in the pediatric population, accounting for nearly one third of all pediatric malignancies. Survival rates for pediatric leukemia have improved dramatically over the last 40 years and the combined 5-year survival rate has risen from less than 20% in the late 1960s to an estimated overall survival rate of greater than 85% today. However, despite the remarkable advancements in treatment therapies, the prognosis for high-risk patients those who relapse, or fail to achieve post induction remission remains poor. Treatment failure is the number one cause of relapse, making drug resistance a hallmark of high-risk leukemia. Sadly, the survival rate for the 25% of children who relapse is less than 30%, underscoring the need for a better understanding of the mechanisms mediating drug resistance and treatment failure, such that more efficacious treatment regimens can be developed. Recently, large scale genome-wide analyses of genetic alterations in leukemia have established IKZF1 (also known as ZNFN1A1), the gene encoding IKAROS, as one of the most clinically relevant prognostic markers in high-risk precursor-b cell Acute Lymphoblastic Leukemia (ALL). IKAROS is a sequence-specific DNA binding protein essential for normal hematopoiesis and participates in a complex network of interactions to recruit chromatin-modifying machines to gene regulatory regions promoting their transcriptional activation or repression via chromatin remodeling. Studies in mice have established IKAROS as a master regulator of lymphoid specification and a potent tumor suppressor in leukemia. Ongoing research has demonstrated that IKAROS binds and regulates thousands of genes involved in many different cellular processes. Mutations or deletions in IKZF1 have been consistently associated with high-risk leukemia, and iii

4 interestingly, IKZF1 was the only gene for which mutations and deletions were found to be useful in predicting a poor response to therapy. What is not well understood, however, is the precise mechanism through which the loss of Ikaros function contributes to drug resistance and treatment failure. The absence and/or inactivation of IKAROS is highly associated with leukemia that is resistant to current chemotherapy agents and has a poor prognosis. Evidence suggests that even modest changes in IKAROS function, resulting from defects in a single IKAROS allele (haploinsufficiency), aids in the progression of leukemic transformation and results in increased risk of relapse. Our main goal was to understand the role of IKAROS in high-risk, drug-resistant leukemia. To accomplish this objective, we studied IKAROS-mediated regulation of genes involved in the folate pathway as well as genes essential to the inhibitory effects and metabolism of standard chemotherapeutics used in the treatment of ALL. We hypothesized that IKAROS regulates the sensitivity of leukemia cells to chemotherapy and that restoration of IKAROS function would inhibit leukemic growth and increase sensitivity to chemotherapy. To identify IKAROS target genes in leukemia, we used anti-ikaros chromatin immunoprecipitation (ChIP) followed by deep sequencing in the human pre-b cell ALL cell line, Nalm6. Four IKAROS target genes involved in drug resistance were identified, and IKAROS binding was confirmed using independent anti-ikaros ChIP assays in multiple cell lines and primary patient leukemia samples. Furthermore, we used both gain of function and loss of function assays to determine how IKAROS affected the transcription of genes involved in drug resistance. Our results suggest that IKAROS iv

5 binds to the Ikaros regulatory elements (IRE) and decrease the expression of several genes important in drug resistance in human leukemia. The targets identified are intricately involved in folate metabolism, and thus, dysregulation of genes within this pathway could potentially affect the efficacy of treatment with methotrexate and the metabolism or inactivation of 6-mercaptopurine and 6-thioguanine into their inactive metabolites. To expand these studies, we sought to understand the signal transduction pathway(s) that control IKAROS-mediated regulation of drug resistance in leukemia by using both molecular inactivation and pharmacological inactivation of the pro-oncogenic protein casein kinase 2 (CK2). CK2 is overexpressed in human leukemia, and phosphorylation of Ikaros by CK2 results in decreased Ikaros DNA-binding affinity and loss of pericentromeric localization, resulting in a more diffuse nuclear pattern. We found that inhibition of CK2 resulted in increased binding of IKAROS at the upstream regulatory elements of target genes and a reduction in target gene transcription. Importantly, a regimen consisting of daily 6-mercaptopurine and weekly methotrexate, in addition to periodic intrathecal therapy, is considered the gold standard for maintenance therapy in ALL. Our findings suggested inhibition of CK2 increases Ikaros DNA-binding affinity at IKAROS regulatory elements (IREs); therefore, we hypothesized that CK2 inhibition would restore IKAROS-mediated repression of genes involved in drug resistance. Using cell cytotoxicity assays, we demonstrate that combination therapy with 6-TG or MTX and CK2 inhibitors results in increased cell death and thus heightened leukemia cell sensitivity to chemotherapy. Our results further suggest that inhibition of CK2 restores IKAROS function, enabling it to repress genes v

6 important in overcoming the inhibitory effects of chemotherapy agents used in high-risk leukemia ALL maintenance therapy, and provides support for combination therapy with CK2 inhibitors as a promising, novel treatment for ALL. In summary, we have identified the mechanism by which a loss or deletion in IKAROS contributes to the development of drug resistance in leukemia. We identified IKAROS as a critical regulator of several genes important in drug resistance. Loss of IKAROS function due to mutations, deletions, and CK2 over-activity is characteristic of high-risk leukemia. A decrease in IKAROS function results in deregulated transcription of genes that metabolize 6-mercaptopurine and 6-thioguanine or modify the effective treatment dose of methotrexate. After identifying the signal transduction pathway that controls IKAROS-mediated repression of drug resistance genes, we devised a rational targeted chemotherapy involving combination treatment with CK2 inhibitors and standard chemotherapy agents for high-risk leukemia. vi

7 Table of Contents List of Figures List of Tables Abbreviation List Chapter 1: Literature Review 1.1 Introduction 1.2 Ikaros Structure 1.3 Ikaros Expression and Its Role in Development 1.4 Regulation of Ikaros Function 1.5 Ikaros in Chromatin Remodeling 1.6 Ikaros in Cancer 1.7 Chemotherapy Drug Resistance 1.8 References 1.9 Figures Chapter 2: Ikaros Binds to the Upstream Regulatory Element of a Large Set of Genes that are Responsible for Drug Resistance in Leukemia 2.1 Introduction 2.2 Results 2.3 Discussion 2.4 Experimental Procedures 2.5 References 2.6 Figure Legends 2.7 Figures Chapter 3: Overall Discussion 3.1 Introduction 3.2 Proposed Mechanism 3.3 Implications For Drug Resistance 3.4 Implications For High Risk Leukemia 3.5 Implications For Treatment 3.6 Conclusion 3.7 References viii xi xii vii

8 List of Figures Chapter 1 Figure 1.1 Improved Survival in Childhood ALL by Study Era. Figure 1.2 Features of Risk Stratification. Figure 1.3 Ikaros isoforms. Figure 1.4 Schematic representing the functional regions of Ikaros. Figure 1.5 Location of casein kinase 2 phosphorylation sites on Ikaros. Figure 1.6 Model of CK2 and PP1 regulation of Ikaros activity. Figure 1.7 Structure of Nucleosome. Figure 1.8 Models of gene-specific and global targeting of chromatin remodeling by Ikaros. Figure 1.9 Principles of drug resistance. 67 Chapter 2 Figure 2.1. Ikaros ChIP-Seq Binding Profiles for Drug Resistance Genes. Figure 2.2 Pharmacodynamic Profile of Thiopurines and Thiopurine S-Methyltransferase Figure 2.3 Pharmacodynamic Profile of Methotrexate and Thymidylate Synthase. Figure 2.4 Pharmacodynamic Profile of Methotrexate and Methylenetetrahydrofolate dehydrogenase Figure 2.5 Pharmacodynamic Profile of Methotrexate and Methionine Synthase. Figure 2.6 Ikaros Binds to the upstream regulatory element of Drug Resistance Genes in multiple cell lines. viii

9 Figure 2.7 Ikaros Binds to the upstream regulatory element of Drug Resistance Genes in 135 primary human leukemia samples. Figure 2.8 Ikaros Represses Transcription of MTHFD1, TYMS, MTR, and TPMT Figure 2.9 Ikaros Knockdown Increases Transcription of MTHFD1, TYMS, MTR, and TPMT. Figure 2.10 HDAC1 Binds to the upstream regulatory element of Drug Resistance Genes 138 in multiple cell lines. Figure 2.11 HDAC1 Binds to the upstream regulatory element of Drug Resistance Genes 139 in primary human leukemia samples. Figure 2.12 Ikaros represses transcription via HDAC-Dependent and Independent 140 Mechanisms. Figure 2.13 CK2 Activity is upregulated in pre-b ALL. Figure 2.14 CK2 Inhibits Ikaros-mediated transcriptional regulation of TPMT, TYMS, MTHFD1, and MTR. Figure 2.15 CK2 Inhibits Ikaros-mediated transcriptional regulation of MTHFD1, TYMS, 143 MTR, CBS, and TPMT. Figure 2.16 CK2 Inhibits Ikaros-mediated transcriptional regulation of MTHFD1, TYMS, 144 MTR, CBS, and TPMT. Figure 2.17 CK2 inhibition and Ikaros-dependence. Figure 2.18 Inhibition of CK2 has no effect on cells that do not express Ikaros. Figure 2.19 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the TPMT upstream regulatory element. ix

10 Figure 2.20 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the 148 TYMS upstream regulatory element. Figure 2.21 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the 149 MTHFD1 upstream regulatory element. Figure 2.22 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the 150 MTR upstream regulatory element. Figure 2.23 Inhibition of CK2 Results in Epigenetic Marks that Correlate with 151 Repressive Chromatin. Figure 2.24 Inhibition of CK2 Results in Epigenetic Marks that Correlate with 152 Repressive Chromatin. Figure 2.25 Inhibition of CK2 Results in Epigenetic Marks that Correlate with 153 Repressive Chromatin. Figure 2.26 Inhibition of CK2 Results in Epigenetic Marks that Correlate with 154 Repressive Chromatin. Figure 2.27 CK2 Inhibition restores Ikaros recruitment and transcriptional regulation of 155 TPMT, TYMS, MTHFD1, and MTR in high-risk Ikaros haploinsufficient primary cells. Figure 2.28 Treatment with CK2 inhibitor and 6-TG is Synergistic. Figure 2.29 Treatment with CK2 inhibitor and 6-TG is Synergistic. Figure 2.30 Treatment with CK2 inhibitor and MTX is Synergistic x

11 List of Tables Table 1.1 Table 2.1 Ikaros Effects in Hematopoiesis and Lymphocyte Development Comprehensive List of Primers xi

12 List of Abbreviations 6-TG 6-Thioguanine ALL Acute Lymphoblastic Leukemia B-ALL PreB cell Acute Lymphoblastic Leukemia BL Burkitt s lymphoma CK2 Casein Kinase 2 ChIP Chromatin Immunoprecipitation NK Natural Killer cells Pre B-cell Precursor B-cell qchip Quantitative Chromatin Immunoprecipitation T-ALL T-cell acute lymphoblastic leukemia HSC Hematopoietic Stem Cells CLL Chronic Lymphocytic Leukemia AML Acute Myelogenous Leukemia WBC White Blood Cell CML Chronic Myelogenous MTX Methotrexate 6-MP 6-Mercaptopurine IRE Ikaros Regulatory Element H3K9Ac Histone 3 Lysine 9 Acetylation H3K9me 3 Histone 3 Lysine 9 Trimethylation TS Thymidylate Synthase AZA Azathiopurine HSCT Hematopoietic Stem Cell Transplant allo-hsct Allogenic Hematopoietic Stem Cell Transplant MTR Methionine Synthase Gene MS Methionine Synthase Protein TYMS Thymidylate Synthase Gene TS Thymidylate Synthase Protein MTHFD1 Methylenetetrahydrofolate Dehydrogenase1 TPMT Thiopurine Methyltransferase URE Upstream Regulatory Element ZF Zinc Finger CtIP CtBP Interacting Protein (CtIP) CHD chromodomain-helicase DNA-binding protein CAT Chloramphenicol acetyltransferase NuRD Nucleosome Remodeling and Deacetylase Complex PTM Post Translational Modification SWI/SNF Switching defective/sucrose nonfermenting PcG Polycomb Group Mi-2/CHD3 Chromodomain Helicase DNA Binding Protein 3 TCR T-cell Receptor HDAC1/2 Histone deacetylase Complex 1 NK Natural Killer cells MBD Methyl CpG Binding Domain Proteins xii

13 CtBP ChIP-seq MTA DN SNP C-terminal Binding Protein Chromatin Immuniprecepitation + Deep Sequencing Metastasis associated Proteins Dominant Negative Single Nuceotide Polymorphism xiii

14 CHAPTER 1 GENERAL INTRODUCTION AND LITERATURE REVIEW 1

15 1.1 Introduction Over forty percent of men and women will be diagnosed with some form of cancer in their lifetime making it the second leading cause of death by disease in the United States [1]. All cancers originate from the smallest structural and functional unit in the body, the cell. In a healthy individual, cells naturally grow and divide in a tightly regulated fashion, replacing cells as they age or become damaged. It is well known that throughout the lifetime of a cell the integrity of its genetic material can become damaged acquiring mutations that can affect the cell s ability to regulate its own growth. Cancer develops when abnormal cells overcome this tightly controlled process and uncontrolled cellular growth ensues. Despite the ubiquitous nature of cancer in human disease, the causes of cancer are diverse, and we are still working to understand the basic mechanisms underlying malignant transformation and oncogenesis. Cancer can develop from any cell in the body, giving rise to a diversity of distinct types, some of the more common being: leukemia, colon, and breast cancer. The three main types cancers affecting blood cells are leukemia, lymphoma, and myeloma [2]. Most leukemia originates within the bone marrow, and if untreated, the marrow gets over-crowded with the rapid accumulation of immature white blood cells and fails to produce other vital components of the hematological system, such as platelets and functioning white and red blood cells [2]. There are four main types of leukemia: acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myloid leukemia (AML), and chronic myloid leukemia (CML) [2]. In the last 40 years, great advancements have been made with regard to treatment of leukemia, 2

16 particularly leukemia affecting the pediatric population (Figure 1.1) [3]. Survival rates for pediatric leukemia are exceeding 85% according to some reports (Figure 1.1); however, there remains a subset of patients whose disease is resistant to current treatments options [4, 5]. These patients are classified as having high-risk leukemia, the hallmark of which is resistance to current treatment strategies. Patients with certain prognostic markers such as gene and/or chromosomal aberrations, age and white blood cell (WBC) count at diagnosis, as well as early response to therapy all contribute to the classification of high-risk leukemia (Figure 1.2) [6]. Failure of response to therapy is the number one cause of relapse, underscoring the importance of identifying mechanisms of resistance and pursuing new treatment modalities. Recently, both childhood and adult high-risk ALL have been associated with a loss or decrease in the function of the krupple-like zinc finger protein Ikaros [7, 8]. Further evidence has linked mutations or deletions in IKZF1, the gene encoding Ikaros, to an increased likelihood of relapse, and thus, these mutations or deletions have become a clinically relevant prognostic marker [9-11]. Ikaros is a sequence specific DNA-binding protein essential to normal hematopoiesis and tumor suppression [12]. Shortly after its discovery, multiple isoforms were identified (Figure 1.4), and the deregulation of Ikaros function was linked to leukemogenesis, which led to its establishment as a potent tumor suppressor [12]. Ikaros regulates both the activation and repression of gene transcription by recruiting chromatin-remodeling and chromatin-modifying complexes to specific genetic loci [13-15]. Studies in mice have demonstrated Ikaros is critically important during multiples stages of lymphoid development and differentiation [16, 17]. Ikaros 3

17 has been shown to interact with several different chromatin modifying protein complexes in a context-dependent fashion [12, 13]. It is believed that directing changes in chromatin is the mechanism by which Ikaros is able to function as a master regulator of the hemolymphoid pathway [15]. Recently, it has become increasingly apparent that epigenetics inheritance of a property such as gene expression that occurs without changes to the DNA sequence plays a considerable role in tumorigenesis. Epigenetic marks such as DNA methylation and histone acetylation create a complex roadmap that is contextdependent and therefore interpreted differently by the various cell types. These modifications have the ability alter the accessibility of DNA to transcription factors and polymerases and thus act as molecular switches that facilitate or inhibit gene transcription. Since epigenetic marks influence which genes are on or off, any perturbation to this system or the enzymes that write, edit, and read the epigenetic code is likely to have detrimental effects on the cell [106]. The work described within this dissertation was focused on elucidating the role of Ikaros in high risk, drug-resistant leukemia. We identified four Ikaros target genes, TYMS, TPMT, MTR, and MTHFD1, important in either the metabolism of thiopurine drugs or the maintenance of cellular folate levels and metabolism. For example, we found that Ikaros binds the promoter region of TYMS, a gene encoding thymidylate synthase (TS), a key enzyme in the folate pathway [18, 19]. Methotrexate (MTX) is a staple chemotherapy agent used in the maintenance phase of leukemia treatment and serves to inhibit the folate pathway and thus DNA synthesis in rapidly dividing tumor cells [6]. Identifying TYMS as an Ikaros target gene suggests that 4

18 changes in Ikaros function can influence TYMS transcription and expression, thus affecting tumor cell sensitivity to treatment with MTX. Additionally, we demonstrate using multiple complimentary techniques that Ikaros represses several other genes in addition to TYMS that have been linked to drug resistance. Our analysis revealed that Ikaros mediates repression through chromatin modification, primarily by decreasing H3K9Ac and H3K4me 3 two markers of active chromatin. In addition, we found that inhibition of the pro-oncogenic protein casein kinase 2 (CK2) increases Ikaros DNA affinity, resulting in an increase of Ikaros binding at the IKAROS regulatory elements (IREs) of target genes and a reduction in target gene expression. We demonstrate combination therapy using CK2 inhibitors with methotrexate or 6-thioguanine produce synergistic effects in a cell cytotoxicity assay. These results suggest the inhibition of CK2 restores Ikaros function enabling it to repress genes important in metabolizing common chemotherapy agents used in high-risk acute lymphoblastic leukemia (ALL) maintenance therapy. As a result, this work identifies the mechanism by which a loss or deletion in Ikaros promotes the development of drug resistance in leukemia. In this dissertation, I discuss the implications of these findings to the treatment of high-risk leukemia and discuss future experiments that should help resolve lingering questions. 1.2 Ikaros Structure IKZF1, the gene encoding Ikaros, was the first of a family of five genes to be discovered. All genes of the Ikaros family encode two sets of C2H2 Krupple-like zinc finger DNA binding domains, which share a high degree of homology [20, 21]. 5

19 Proteins within the zinc-finger super family (Figure 1.4) are characterized by the presence of a conserved zinc finger motif a zinc atom that is in specific coordination with four other amino acids [22]. A zinc finger protein commonly contains multiple zinc finger motifs arranged in tandem and can mediate protein- DNA or protein-protein interactions [22-24]. Ikaros and its family members have two sets of zinc finger domains one at its amino (N)-terminus and another at its carboxy (C)-terminus, and each set has a distinct functional activity (Figure 1.1). The set of zinc-fingers at the N-terminus of the protein contain four C2H2 Krupple like motifs (ZF1-4), which are responsible for binding the specific DNA consensus sequence GGAAA [25]. In contrast, the two zinc fingers located at the C-terminus (ZF5-6) are responsible for protein-protein interactions, and these allow Ikaros to form dimers, or potentially multimeric complexes with itself, other family members, or other transcriptional regulators that share a similar protein-interaction domain [20, 26]. Adding complexity, alternative splicing creates multiple protein isoforms, which are expressed differentially in developing lymphocytes (Figure 1.2). The IKAROS gene consists of seven coding exons, the first four of which can be alternatively spliced to make several unique isoforms [25, 26]. Originally, six different mrna transcripts (Ik1-Ik6) were identified in both mice and humans [25-28]. Later, researchers identified additional isoforms containing a 30 base deletion between exons 6 and 7 and/or a 60 base insertion located after exon 2 [29, 30]. Over time, reports of even more splice variants, particularly shorter isoforms that were not able to bind DNA, began to emerge from studies done in human leukemia cells, and these were linked to tumorigenesis [31, 32]. Further research demonstrated that 6

20 although present at low levels, both the mrna and proteins generated from these smaller transcripts were present in normal peripheral blood, thymus, cord blood and bone marrow cells [33-35]. In addition, Payne and colleagues analyzed the IKAROS mrna transcripts and resulting Ikaros protein expression in early mouse and human hematopoietic precursors and found yet another isoform, which they named Ikaros-X (IK-x) [35]. IK-x is similar to IK-3; however, IK-x includes exon 6, making it a slightly larger protein [35]. Interestingly, Payne and colleagues also reported that the 60 base insertion, which was later named exon 3B, was common to isoforms IK-1, IK-2, IK-4, IK-7, and IK-8 in human cells (named IK-1+, IK-2+, etc.)[35]. They reported IK-x and IK-1+ (later re-named Ik-H) to be the predominant isoforms of protein expressed in human myeloid and lymphoid lineages, respectively. Furthermore, their work demonstrated that the larger mrna transcript, including exon 3B, was detected at the RNA level in mice; however, protein expression was primarily limited to human cells, suggesting a possible divergence in Ikaros function between human and mice [35]. The multiple protein isoforms are believed to confer the ability of the Ikaros gene to generate functionally diverse protein complexes and regulate DNA binding and specificity, thereby controlling activities such as subcellular localization and Ikaros-mediated activation or repression of gene transcription (Figure 1.3) [28, 36, 37]. Interestingly, all described Ikaros isoforms share the C-terminal proteininteraction domain but can differ in the number and combination of N-terminal DNAbinding zinc fingers [29]. Typically, proteins containing C2H2 zinc finger motifs require two or three zinc fingers arranged sequentially for high affinity, stable DNA 7

21 binding in vivo [38, 39]. However, Ikaros mutants containing only two zinc fingers (ZF2 and ZF3) are able to recognize and sufficiently bind the core consensus binding site, GGGAA [25]. Earlier studies suggested that the number and combination of zinc fingers influences Ikaros DNA affinity and sequence specificity [25]. Later studies demonstrated zinc fingers 1 and 4 were not essential for DNA binding, and it was suggested that the additional zinc fingers actually modulated binding to specific sites [25, 40, 41]. Expanding on this finding, recent evidence demonstrates that different combinations of zinc fingers participate in the regulation of distinct sets of genes [42]. Schjerven and colleagues characterized transgenic mice lacking ZF1 or ZF4 and they found the mice displayed different hematological deficiencies, providing support that different combinations of zinc fingers were an important factor in how Ikaros was able to regulate a myriad of roles throughout development and differentiation [42]. For example, mice lacking the ZF4 domain (Ikaros ΔF4/ΔF4 ) had substantially decreased levels of cells from the B and T lineages, while mice lacking the ZF1 domain (Ikaros ΔF1/ΔF1 ) had only a minor reduction in these lineages [42]. Furthermore, RNAseq data from Ikaros ΔF4/ΔF4 thymocytes revealed that enrichment in genes important in cell adhesion, cell communication, and signal transduction was consistent with the observation that Ikaros ΔF4/ΔF4 mice had particularly aggressive and invasive thymic lymphomas [42]. This work by Schjerven and colleagues provided the first direct evidence that the expression of different isoforms allows Ikaros the ability to carefully control gene expression programs that influence a diverse array of biological functions. 8

22 The inclusion of both C-terminal zinc fingers in every Ikaros isoform suggests this region is integral to Ikaros function. A chimeric protein containing a large portion of Ikaros was used to identify protein-protein interactions in a large-scale screen. To confirm the results of the yeast 2 hybrid screen, immunoprecipitation reactions were performed and Sun and colleagues demonstrated that the last 154 C terminal amino acids of exon 7 are responsible for Ikaros homo- or heterodimerization [29]. Chimeric proteins consisting of various Ikaros protein domains and the LexA DNA binding protein were used to identify protein-protein interactions [29]. A positive interaction was identified by the expression of the B-galactosidase and Leu2 genes in EGY48 yeast [29]. This region contains ZF5 and ZF6, which are not directly involved in high affinity DNA binding. Interestingly, sequence analyses revealed that although the zinc fingers in this region comply with the C2H2 Krupple-like motif consensus (a sequence of six amino acids similar to those found in Krupple an important transcriptional regulator in Drosophila), mutation of several amino acids required for C2H2 Krupple-like α-helical structure and DNA-contacts did not abolish its ability to form protein-protein interactions [29]. Furthermore, ZF5 deviates from the consensus amino acid composition of C2H2 zinc finger family members. It contains five amino acids between histidine residues, which is unusual, but it is this arrangement that offers structural similarity to Hunchback [27]. These data suggest that perhaps the C- terminal zinc fingers of Ikaros represent a functionally and structurally distinct zinc finger motif. Furthermore, Sun et al. demonstrated that mutations disrupting the structure of the C-terminal zinc fingers (protein-interaction domain) effectively eliminate, dimerization resulting in an eight-fold reduction in Ikaros DNA-binding 9

23 affinity and transcriptional activation [29]. Taken together, these studies are consistent with the idea that Ikaros dimerization or higher order complex formation is essential to its ability to bind DNA and activate transcription. Much of the interest in understanding the different biological roles of Ikaros isoforms stems from the observation that the shorter non-dna binding isoforms are frequently upregulated in leukemia [31, 32]. The N-terminal zinc fingers (ZF1-ZF4) are directly responsible for DNA-binding. Although ZF2 and ZF3 are sufficient for DNA binding in DNA gel shift experiments, only isoforms with three or more N- terminal zinc fingers localize to the nucleus, making the shorter isoforms transcriptionally inert [29]. Sun and colleagues were the first to show that these smaller isoforms acted in a dominant negative (DN) fashion [29]. They demonstrated that when bound to full-length Ikaros, the short DN isoforms localized to the nucleus and interfered with the ability of full length Ikaros to form complexes with DNA and activate transcription [29]. Furthermore, transgenic mice with a homozygous deletion of IKZF1 exons 3 and 4, which encode three of the four N-terminal zinc fingers, lack all B-cells, T-cells and Natural Killer cells resulting in a complete arrest in lymphoid development. The fact that mice lacking a portion of the N-terminal region of Ikaros have more profound deficiencies in lymphoid development suggests that the shorter non-dna-binding isoforms are able to interfere with several aspects of lymphocyte development. This evidence also alluded to the idea that Ikaros likely interacts with other, potentially lymphoid-specific factors to carry out its various functions. Ikaros isoforms and related family members are expressed differentially in different hematopoetic lineages and during different times during differentiation. Ik-H 10

24 is the longest and most predominantly expressed isoform in early hematopoietic progenitors and mature lymphocytes in humans [25, 28, 43]. The expression of Ik-4 is limited to early thymocytes, whereas Ik-3, Ik-5, and Ik6 are all produced at low levels throughout lymphocyte development, and their precise functions remain elusive [25]. Understanding the functional significance of the various Ikaros isoforms has proven to be a difficult task. The various Ikaros isoforms are able to interact with one another, other family members, and other proteins with a similar binding domain in a seemingly indiscriminant fashion. This characteristic enables the formation of a large number of dimeric or multimeric complexes, which potentially have distinct functions and maybe lineage specific. Finally, because hematopoietic cells express abundant levels of endogenous Ikaros isoforms, efforts to create Ikaros knockdown models have been largely unsuccessful, greatly hindering the ability to study the individual functions of Ikaros isoforms in vivo. 1.3 Ikaros Expression and Its Role in Development Hematopoietic stell cells (HSCs) are responsible for the continual production of all blood and immune cells as well as the maintenance of the HSC compartment by self-renewal. Understanding how HSC cells and their earliest progenitors differentiate into the various cells of the hematopoietic system is an area of intense research as well as substantial controversy. Models of lineage restriction have been based on the isolation of rare, early progenitors with conventional cell surface markers that predispose their differentiation potential to a particular lineage. Prevailing models propose that HSC make a series of binary decisions that progressively commit 11

25 precursors to various cell fates [107, 108, 109]. The immediate progeny of the HSC retains a high degree of plasticity; however, as the precursors progress through the different stages of differentiation, their ability to reverse lineage choice decreases, and ultimately the cells become one of approximately ten terminally-differentiated blood lineages [44]. IKAROS is a master regulator of the hemolymphoid system, and its precise role in hematopoiesis is the focus of active investigations. IKAROS proteins are highly conserved between species, and much of our current knowledge regarding the protein s function in hematopoeisis has been from studies in different transgenic mouse models. Each Ikaros-targeted mouse mutant exhibits specific defects in different hematopoietic cell lineages, which result in various phenotypes, suggesting the protein has a myriad of roles in both HSC and committed progenitors [16, 17, 45-47]. The pattern of Ikaros expression, followed by a detailed summary of the 6 transgenic mouse models, will be discussed, all of which have provided the foundation for our current understanding of Ikaros Expression During embryogenesis, IKAROS expression proceeds and overlaps with lymphocyte development [27]. Hematopoiesis begins in the yolk sac, which is formed by day 7 of gestation and is densely populated with primitive erythroblasts [48-52]. In the mouse, IKAROS expression is first seen in the splanchnopleura in a small number of mesodermal precursors, which most likely continue to develop into pluripotent hematopoetic stem cells. Ikaros mrna is subsequently detected in the liver rudiment 12

26 between day 9.5 and 10.5, which is about the same time the liver first begins to function as a hematopoietic center [48-52]. Although the fetal liver is the major site of erythropoeisis, myelopoeisis, and B-cell development through mid gestation and even after birth, the expression of Ikaros mrna in the fetal liver begins to decline at day 14, suggesting Ikaros plays a very early role in the fetal development of these lineages [27]. As pluripotent stem cells commit to the erythroid lineage and Ikaros expression is decreasing in the fetal liver, a drastic increase in Ikaros expression is seen in the primitive thymus [27]. Lymphopoetic stem cells begin to migrate to the rudimentary thymus at day 12, at which time Ikaros expression is clearly evident [27]. By day 16 prominent expression of Ikaros mrna is observed in the thymus and by day 19 this has become the primary site of IKZF1 (Ikaros) gene expression. Ikaros transcript is seen throughout the developing thymus, with lymphoid precursors in the medulla of the thymus expressing larger quantities than those in the cortex [16]. Low levels of Ikaros proteins is observed in the spleen by day 19 and interestingly, Ikaros expression is also observed in a small set of cells in the brain that give rise to the corpus striatum [16]. In adult mice, Ikaros expression is limited to lymphopoietic tissues as well as the spleen and peripheral blood leukocytes. Ikaros is expressed in a very small subset of Lin - ckit + Sca1 + HSC present in the marrow of adult mice [28]. Lymphocytes rely on Ikaros at distinct phases of their development; therefore, Ikaros expression and localization varies depending on the differentiation state of the cell. Double positive (CD4 + CD8 + ) T-cells located in the thymus have the highest levels of Ikaros expression. In resting, non-proliferating lymphocytes, Ikaros protein is typically 13

27 found in a diffuse, dot-like pattern in the nucleus [53]. However, upon activation, Ikaros forms ring-like structures (Torids) around pericentromeric heterochromatin suggesting a signaling mechanism exists that regulates Ikaros protein localization during T-cell differentiation in the thymus [53]. Unlike the high level of expression seen during lymphoid differentiation [36], Ikaros is down-regulated when cells differentiate along the monocyte/macrophage and erythroid pathways. In summery, the Ikzf1 gene is originally expressed within the fetal-pluripotent HSC population and continues throughout several multipotent precursors to direct commitment to the lymphoid lineage by regulating the transcription of several critical genes. In the adult mouse, only a small subset of HSCs expresses Ikaros however expression is evident in diverse hematopoetic lineages and largely depends on the cellular differentiation state. Ikaros is a master regulator of lymphoid lineage specification in the fetal and adult hematopoietic system and its function is critical for both early lineage commitment and later stages of T- and B-cell differentiation [54-58] Ikaros in development The fate of a cell is determined by the selective expression of lineage specific genes. Transcription factors present in early hematopoietic progenitor cells are thought to regulate gene expression either in a stochastic fashion or in response to specific environmental cues. Selective changes in gene expression, drive a pluripotent HSC towards differentiating into progressively more restricted progenitors, which ultimately results in commitment towards a particular lineage. However the precise 14

28 molecular mechanisms that regulate cellular identity and differentiation are still unclear. Ikaros function is complex and not fully understood; however, studies of Ikaros-directed transgenic mouse models have set the foundation for our current understanding. Six mouse models have been generated that provide great insight into the many roles of Ikaros in hematopoiesis (Table 1.1). Georgopoulos and colleagues developed two strains of transgenic mice with different mutations in Ikaros [16, 46]. The mutations were introduced into embryonic stem (ES) cells by homologous recombination, and ES cells that incorporated the mutation were subsequently used to generate IKAROS mutant mice. One mouse described has a deletion in the N-terminus of IKZF1, which removed all the zinc-finger DNA binding motifs, creating a dominant negative form of the protein (Ikaros DN ) [16]. The other mouse model has a deletion in the C-terminus, which removed the last translated codon of Ikaros. The C- terminal deletion destabilizes the protein structure resulting in its quick degradation, effectively creating an Ikaros null mutant (Ikaros null ) [46]. In addition to the studies of homozygous mice, Georgopoulos and colleagues analyzed the deficiencies in heterozygous mice (Ikaros +/-DN and Ikaros +/-null ), providing additional insight into Ikaros function. A third transgenic mouse strain was generated that incorporated LacZ into the Ikzf1 locus, which unexpectedly allowed the expression of low levels of Ikaros protein that has both the DNA- and protein interaction domains intact (Ikaros low ) [59]. Lastly, a transgenic mouse strain, plastic, with a point mutation in Ikzf1 that disrupts the tertiary structure of zinc finger 3 (ZF3), a component of the DNA-binding domain, was developed [47]. In the remainder of this section I will describe the 15

29 mutant phenotypes that resulted from these transgenic mice and discuss how they contributed to our understanding of Ikaros function. Ikaros was known to bind many lymphocyte-specific genes that hold important roles in B and T cell differentiation pathways; however, analysis of these transgenic mice provided the first strong evidence that Ikaros functioned as a master regulator of hematopoiesis. The Ikaros DN-/- transgenic mouse which lacks all the DNA-binding zinc fingers [16], was inhibited for lymphocyte development at its earliest fetal stage [16]. Mice homozygous for the mutation had severe deficiencies in the lymphoid compartment, which lacked all B-, T-lymphocytes, and natural killer (NK) cells and their earliest precursors [16]. However, the N-terminal Ikaros mutation did not preclude the development of totipotent hematopoietic stems cells, erythrocytes, myelocytes, monocytes, dendritic cells, megakaryocytes, and platelets, suggesting these lineages did not require the expression of full length Ikaros [16]. Although the erythroid and myeloid lineages were present, the mice had dysregulated erythropoeisis and myelopoesis [16]. This was evidenced by an enlarged spleen with increased numbers of myeloid and erythroid progenitors and hypocellular bone marrow which containing increased levels of erythroid progenitors [16]. From these studies Georgopolous and colleagues concluded that Ikaros provides both positive and negative signals that regulate early stages of hematopoiesis. The authors proposed that Ikaros likely provides positive signals that support lymphocyte differentiation, and in the absence of functioning Ikaros, a complete block in lymphocyte production results [16]. They further suggested the increased numbers of myeloid and erythroid populations could be a consequence of a lack of negative signals imposed by full 16

30 length Ikaros or the erythroid and myeloid differentiation pathways could simply be the default developmental pathway [16]. Interestingly, mice heterozygous for the same N-terminal mutation (Ikaros +/- DN ) showed a drastically different phenotype compared to their homozygous (Ikaros -/- DN ) littermates [17]. They appeared to have normal surface marker phenotypes in the thymus and spleen and consistent numbers of thymic and splenic B- and T-cells compared to their wild-type siblings [17]. These results suggest that one wild-type allele is sufficient for the development of T- and B-cell lineages. However, although the Ikaros +/-DN mice appeared normal at first, within the first 4 weeks of life a dramatic lymphoproliferation occured in the thymus and periphery of heterozygous mice, which later resulted in an aggressive T-cell leukemia or lymphoma with 100% penetrance [17]. In addition, heterozygous mice exhibited an exaggerated TCRmediated proliferative response, which is believed to be disregulated downstream of the TCR complexes. Leukemic transformation occurs secondary to the initial general lymphoproliferation after the invariable loss of the single, wild-type allele [17]. These results suggest that Ikaros has a critical role in T-cell proliferation and homeostatis [17]. IKAROS is abundantly expressed throughout all stages of T-cell development and differentiation in the fetal and adult mouse, suggesting it is important in multiple stages of T-cell ontogeny [27]. These data, in conjunction with the phenotype observed in homozygous mice, suggest Ikaros regulates both and early and late steps in lymphocyte differentiation [17]. Loss of Ikaros early in development prevents the differentiation and specification of the lymphoid lineage [16, 17]. Alternatively, loss 17

31 of Ikaros in the adult mouse, and thus during later stages of development and differentiation, is associated with cellular transformation [17]. Multiple IKAROS isoforms were tested using gel retardation and CAT reporter assays to determine their ability to bind DNA and activate transcription [29]. Proteins encoded by the Ikzf1 locus that lack the DNA-binding zinc finger domains are able to sequester full length Ikaros isoforms into higher order complexes, which are unable to activate transcription [29]. This characteristic significantly decreases the biological activity of wild-type Ikaros by acting as a dominant negative (DN) [29]. Therefore, the severe deficiencies observed in homozygous and heterozygous Ikaros DN mice are likely due to a combinatorial effect of the loss of IKAROS as well as interference from the DN isoform with other Ikaros binding proteins[36]. An Ikaros null mouse was generated to elucidate the functional role of Ikaros protein interactions during the lymphoid development and differentiation [46]. Fetal and adult derived B-cells are completely absent from homozygous Ikaros null mice; however, pre- and postnatally derived T-cells are affected differently [46]. Interestingly, T-cells are absent throughout fetal development yet definitive thymocytes are detected in the thymus shortly after birth suggesting Ikaros is partially redundant in adult T-cell development [46]. These data demonstrate that Ikaros is essential for the development and differentiation of HSC into several lymphoid cell fates, particularly B lymphocytes. Ikaros -/-DN and Ikaros -/-null mice lacked all B cells and their earliest progenitors; however, the function of Ikaros in B-cell development was largely unknown. Mice with LacZ inserted into exon 2 of Ikzf1 (Ikaros Low ) expressed low levels of Ikaros 18

32 proteins and provided direct evidence that Ikaros supports B-cell development [59]. Unlike Ikaros -/-DN and Ikaros -/-null mice, Ikaros Low/Low mice developed some postnatal B- cells, although significantly less than their wild-type littermates [59]. Peripheral B- cells in Ikaros Low/Low mice proliferate easily in response to antigen, indicating these cells have a lower threshold for B-cell activation. However, Ikaros Low/Low mice have fewer germinal centers following antigenic stimulation [59]. Interestingly however, these mice succumb to T-cell lymphomas similar to Ikaros +/-DN mice suggesting lymphoid development and differentiation is extremely sensitive to changes in Ikaros expression levels [59]. The defects observed in this model are different to those seen in previous Ikaros-directed knockout mice and suggest IKAROS plays a role in probcell differentiation, B-cell activation, and germinal center formation [59]. IKAROS expression is observed in the earliest blood centers of the mouse embryo suggesting a primitive role for Ikaros in hematopoietic ontogeny [27]. Gorgopolous and colleagues originally reported that full-length Ikaros was not required for the generation or maintenance of totipotent hematopoietic stem cells [16]. However, later Ikaros expression was observed in long-term HSC, the stem cells responsible for the continuous regeneration of blood cells, and mutations in Ikaros led to changes in multiple blood compartments, suggestive of a fundamental role in early development [45]. Likewise, a high level of Ikaros mrna is detected in long- and short-term HSCs within the fetal liver and bone marrow. Mice homozygous for the Ikaros null or Ikaros DN mutation display bone marrow hypocellularity, which is consistent with the hypothesis that Ikaros regulates some degree of HSC activity [28, 45]. Furthermore, mice homozygous for the Ikaros DN-/- mutation developed a 19

33 progressive decrease in hematocrit, a likely consequence of the HSC compartment being unable to supply normal levels of mature erythrocytes [45]. Bone marrow cells from the Ikaros null and DN mice were unable to repopulate cells from any hemopoietic lineage in irradiated mice indicating a decrease in HSC self-renewing activity [45]. Molecular analysis of HSC surface markers and mrna expression of genes known to be important in the maintenance of hematopoietic cells revealed that HSC from Ikaros null and DN mice had no detectable fetal liver kinase 2 (Flk-2) expression and c-kit levels were decreased up to 10-fold [45]. The DN or null mutations of Ikaros generally resulted in mild deficiencies within the HSC compartment; however, severe effects on the production and differentiation of B- and T-cell populations in the adult were observed. Papathanasiou and colleagues provided additional evidence that Ikaros serves a broad range of roles the hemolymphoid system [47]. In their study they described an additional transgenic mouse model, which contained a point mutation in the third zinc finger of Ikaros (Ikaros plastic ), ablating DNA binding but preserving the protein s ability to form higher order complexes [47]. The homozygous ZF3 mutation resulted in embryonic demise, and lymphopoesis was completely blocked, while heterozygotes had only a partial block in lymphoid differentiation [47]. Further evidence suggestive of Ikaros s early role in the development came from studies that demonstrated Ikaros expression is observed at day 8 in the splachnopleaura and within the blood islands of the yolk sac during embrogenesis [27]. Analysis of fetal livers from Ikaros -/-plastic mice demonstrated that while the earliest erythroid-committed progenitors existed, the later erythroblast stages of development were severely 20

34 impaired compared to those of their wild-type littermates [47]. Opposite to the hypoplasia observed in the erythroid compartment, a large expansion of myeloid cells in the fetal livers of Ikaros -/-plastic mice was noted [47]. The effects of the point mutation in ZF3 on erythroid, myeloid, and granulocyte differentiation suggest Ikaros is also likely integral to their differentiation pathway as well [47]. Genetic analysis in mice has been a vital tool for understanding the role of Ikaros in the regulation of cell differentiation in the blood and immune system. The protein ablation studies, such as the Ikaros null and Ikaros DN mouse models, resulted in severe hematopoietic defects primarily in B- and T-cell lineages, which led researchers to conclude Ikaros was key regulator of lymphopoesis [16, 27]. However, this specific role for Ikaros cannot explain the protein s widespread expression pattern, which is seen across several blood lineages [27]. The complex phenotypes observed in the transgenic mice lead to the hypothesis that Ikaros holds a much more diverse role in development than previously anticipated [45, 47]. This, taken together with emerging evidence that Ikaros associated with components of the nucleosome remodeling and deacetylation (NuRD) complex and was able to both activate and repress gene transcription lead researchers to believe that Ikaros was more than just the traditional transcription factor [13, 27, 29, 45, 53]. 1.4 Regulation of Ikaros Function IKZF1 encodes a zinc finger protein that is an essential regulator of normal hematopoiesis and established tumor suppressor [16]. Ikaros is involved in the establishment and maintenance of epigenetic marks that govern the activation and 21

35 repression of gene transcription [12]. Ikaros binds within the promoter region of target genes and repetitive DNA sequences (ϒ satellite repeats) in pericentromeric regions of chromosomes in a sequence-specific fashion to regulate gene activity via chromatin remodeling [41]. DNA-binding is critical to Ikaros s ability to function as a transcriptional activator or repressor as well as its ability to localize to developmentally regulated genes and PC-HC [13,16,29]. The current model of Ikaros repressive function is that the protein binds and recruits target genes to PC-HC to activate or repress gene transcription via chromatin remodeling [12]. Ikaros function is modified and regulated through a variety of different mechanisms. One mechanism involves the numerous differentially spliced isoforms, which vary in the number and sequence of N-terminal C 2 H 2 Krupple-like zinc fingers responsible for DNA binding [25, 26]. The isoforms are able to influence Ikaros function by modifying DNA binding and subcellular localization. Isoforms IK1 and IK2 (Figure 1.3) are the most prominently expressed isoforms in normal hematopoietic cells and are capable of binding DNA [25, 36]. In humans, these two isoforms interact with each other and regulate Ikaros function [43]. Furthermore, isoforms that lack the N-terminal zinc fingers are unable to translocate to the nucleus and bind DNA; however, when the shorter non-dna binding isoforms complex with active isoforms they are distributed to the nucleus and function as dominant negative inhibitors and thus impair Ikaros activity [25, 29]. Ikaros expression is evident at the earliest stages of fetal blood development and is required for the balanced production of all cells of the immune system [12, 60]. Ikaros is abundantly expressed in most hematopoietic cells and numerous studies 22

36 have demonstrated even slight alterations in Ikaros expression, such as haploinsufficiency, is sufficient to severely affect its function [7, 59, 61, 62]. For example, heterozygous Ikaros DN+/- mice have approximately 50% fewer lymphocyte precursors and although all mature B- and T-lymphocytes exist and appear to have normal cell surface markers, these cells have a significantly lower threshold of activation [17]. After T-cell receptor (TCR) engagement Ikaros DN+/- cells produce an exaggerated proliferative response [63] and invariably lose the wild-type allele resulting in an aggressive T-cell leukemia or lymphoma. Currently, it is believed that full-length Ikaros functions as a potent tumor suppressor, whereas the overexpression of small DN isoforms promotes malignant transformation. Previous studies have established that Ikaros is expressed in a large number of blood and immune cells and plays a critical role in hematopoiesis as well as the immune response. Its diverse expression pattern in addition to its numerous roles in development, differentiation, and T-cell activation raised questions as to how the precise and seemingly diverse functions of Ikaros are regulated in normal cells. Furthermore, it is possible that dysfunction of the regulatory mechanisms that control Ikaros function contribute to leukemogenesis. Ikaros s ability to form higher order complexes with itself, various isoforms, or other Ikaros family members is one mechanism by which Ikaros function is modified; however, several lines of evidence suggest Ikaros is also regulated post transcriptionally. For example, its nuclear distribution varies through the different stages of the cell cycle [53]. A large portion of Ikaros is targeted to ϒ satellite repeats of PC-HC in the nuclei of cells in interphase. Additionally, Ikaros immunostaining experiments reveal a punctate 23

37 staining pattern is observed in activated B lymphocytes; however, in resting B-cells, Ikaros has a diffuse staining pattern [53]. The observation that Ikaros is abundantly expressed in most hematopoetic cells and its levels are consistent throughout the cell cycle suggested a reversible post-translational mechanism, such as phosphorylation, is likely responsible for the dynamic changes in Ikaros localization. The first evidence that phosphorylation played a critical role in Ikaros regulation came from in vivo phosphopeptide mapping experiments aimed at understanding the biological significance of the highly conserved linker region located between the N-terminal C2H2 Krupple-like zinc fingers (Figure1.4) [64]. Investigators found that the ability of Ikaros to bind DNA was severely impaired after the treatment of cells with vinblastine, which prevented the G2/M transition [64]. Interestingly, phosphatase treatment of the nuclear extracts from G2/M arrested cells followed by electromobility gel shift experiments demonstrated a dramatic increase in Ikaros DNA binding [64]. Phosphopeptide mapping demonstrated that phosphorylation within the evolutionarily conserved linker regions located between the C 2 H 2 Krupple-like zinc fingers was responsible for the loss of pericentrometic localization during the G2/M transition. The results suggest phosphorylation of Ikaros within its evolutionarily conserved linker sequences during mitosis inactivates the protein in a cell cycle-specific manner. Gomez-del Arco and colleagues further described two additional regions subject to phosphorylation; serine 63 encoded within exon 4 and several amino acids upstream of the C-terminal zinc-fingers encoded within exon 8 [65]. After searching the sequence for putative consensus sites for various known serine/threonine kinases, 24

38 the researchers treated cells with kinase-specific inhibitors and determined Casein kinase II (CKII) is predominantly responsible for Ikaros phosphorylation at these sites [65]. It was also noted that GSK3 and cdk may also play a role in the phosphorylation of the segment encoded within exon 8 [65]. Interestingly, treating cells with different cell cycle inhibitors revealed that Ikaros existed in an unphosphorylated state in late G1-arrested cells and de-novo phosphorylation of Ikaros occured as the cell exits G1 to enter S phase of the cell cycle [65]. These data demonstrate that the phosphorylation state of Ikaros is dynamic during the cell cycle. Ikaros protein serves to negatively regulate the G2-S transition, and phosphorylation of Ikaros within the segment encoded by exon 8 relieves this inhibitory pressure by decreasing Ikaros DNA affinity [65]. In this study, Gomez-del Arco and colleagues suggested that Ikaros exists in two states: a dephosphorylated active form and a phosphorylated inactive form [65]. The dephosphorylated form serves to inhibit the G1-S transition impeding cell cycle entry whereas the phosphorylated form of Ikaros is more permissive to cell cycle progression and may facilitate entry into the S-phase [65]. Additional studies by Gurel and colleagues used in vivo phophopeptide mapping and mass spectrometry to identify additional biologically relevant Ikaros phosphorylation sites [66]. Four novel phosphorylation sites at highly conserved amino acids were identified at positions 13, 23, 101, and 294 [66]. Gel shift and confocal microscopy experiments using wild-type Ikaros and Ikaros phosphomutants were performed to test whether phosphorylation at these sites alters the proteins ability to bind DNA or its subcellular localization [66]. These experiments demonstrated that phosphorylation at amino acids 13 and 294 decreased binding 25

39 within developmentally regulated gene promoter regions and γ satellite sequences and that de-phosphorylation at particular amino acids was important in Ikaros localization to PC-HC [66]. In line with previous studies, experiments using specific kinase inhibitors and in vitro kinase reactions demonstrated these sites were directly phosphorylated by CKII [66]. This study provided additional support that phosphorylation by CK2 regulated Ikaros s ability to bind DNA and that this mechanism of regulation was important for normal thymocyte differentiation [66]. Phosphorylation is a reversible and dynamic process used by many proteins to regulate function. The process is governed by complex signaling cascades that include various kinases and phosphatases that add and remove phosphate groups to specific amino acids. In vitro reactions with radiolabelled and immunoprecipitated Ikaros identified Protein Phosphatase 1 (PP1) as the phosphatase responsible for the dephosphorylation of Ikaros [67]. These results were confirmed using coimmunoprecipitation reactions with endogenous Ikaros and an Ikaros construct with the conserved PP1 recognition motif mutated (mik-465/7). The mik-465/7a construct has valine and phenylaine at positions 465 and 467, respectfully changed to alanine. These two amino acids have previously been shown to be important for Ikaros interaction with PP1 [67]. Electromobility gel shift assays and confocal microscopy with endogenous Ikaros as well as mik-465/7 were used to assess the significance of the interaction between PP1 and Ikaros [67]. The experiments determined whether the interaction affected Ikaros DNA binding affinity and subcellular localization [67]. The mik-465/7 construct had a significantly decreased affinity for DNA and a diffuse nuclear staining pattern compared to the punctate 26

40 staining and higher binding affinity observed with wild-type Ikaros [67]. These results suggest that the interaction between Ikaros and PP1 is a critical regulatory mechanism for Ikaros function [67]. Dephosphorylation of Ikaros by PP1 is essential for high affinity DNA binding and subcellular localization at PC-HC, and these suggest that the sites phosphorylated by CK2 are targets for desphosphorylation by PP1 [67]. Furthermore, Popescu and colleagues demonstrated using immunofluorescence microscopy that dephosphorylation of Ikaros could restore Ikaros DNA-binding activity and proper localization to PC-HC [67]. These experiments provided evidence that the phosphorylation state of Ikaros is regulated directly by CK2 and PP1 and that phosphorylation is a critical mechanism by which Ikaros function is regulated [67]. CK2-mediated phosphorylation of Ikaros has been shown to not only affect Ikaros DNA binding and localization but also its stability and propensity for degradation via the ubiquitin/proteosome pathway [67]. Ikaros sequence analysis identified two PEST motifs that, when phosphorylated, targets the protein for phosphorylation-mediated protein degradation [67] (Figure 1.4). Protein levels of the hyperphosphorylated 465/7 Ikaros construct (mutated PP1 binding site) were 8-fold lower than wild-type levels and the observed decrease in protein expression was not due to differences in mrna levels [67]. Pulse-chase degradation experiments demonstrated that the interaction between Ikaros and PP1 is critical to the stability of the protein, and loss of this interaction resulted in a significantly decreased half-life of the protein [67]. Differences in protein levels in 293T cells transfected with mik-vi or miv 465/7A led Popescu et al to evaluate mrna levels using rtpcr. The results 27

41 of the experiment suggested the difference in protein levels observed after transfection into 193T cells could either be due to degradation or lower translational efficiency [67]. High molecular weight Ikaros/ubiquitin conjugates were identified using anti-ikaros antibody in human Molt4 and murine VL3-3M2 leukemia cell lines [67]. These Immunoprecipitation reactions provided evidence that Ikaros is targeted by ubiquitin for proteosomal degradation [67]. These data suggest that phosphorylation of Ikaros s PEST motifs by CK2 induces its degradation whereas dephosphorylation by PP1 interferes with this process by stabilizing the protein and extending its half-life [67]. Taken together, these results demonstrate that CK2- mediated phosphorylation of Ikaros not only alters its DNA-binding affinity and subcellular localization but also affects Ikaros stability and propensity for degradation [67]. Yeast two-hybrid studies demonstrated potential interactions between Ikaros and SUMO1, Uba2, and Ubc9 three critical enzymes in the multienzymatic pathway responsible for the SUMOylation of proteins [68]. Analysis of the Ikaros protein sequence revealed 4 potential SUMOlytation sites, which were tested by immunoprecipitation for in vivo activity using constructs with the lysine in the putative SUMOylation site changed to arginine [68]. Wild-type Ikaros or the SUMOylation mutant constructs and GFP-SUMO1 were co transfected into 293T cells. Ikaros protein was then immunoprecipitated from cellular extract with anti- Ikaros antibody and immunoblotted using both an anti-ikaros and anti-gfp antibodies. The results suggest that two of the four sites (positions K58 and K240) are indeed used in vivo and Ikaros interaction with SUMO1, -2, and -3 was confirmed by 28

42 immunoprecipitation [68]. SUMOylation of Ikaros was reported to interfere with binding to both HDAC-dependent and HDAC-independent transcriptional corepressors, which resulted in a decreased ability to repress gene transcription [68]. However, SUMOylation did not appear to affect Ikaros s ability to localize to PC-HC [68]. These data suggest that SUMO conjugation is another reversible and dynamic posttranslational mechanism by which Ikaros function, specifically its repressive ability, is regulated [68]. Taken together, these aforementioned reports demonstrate that Ikaros activity is regulated posttranslationally by a number of mechanisms. First, the formation of higher order complexes with various Ikaros isoforms and other Ikaros family members, especially the association of full length Ikaros with its shorter non-dna binding DN isoforms can modify Ikaros function. Second, Ikaros is a biologically relevant substrate for CK2 kinase and PP1 [64-67]. CK2 is responsible for phosphorylating Ikaros at several residues regulating its DNA affinity, subcellular localization, and propensity for degradation [64-67]. Lastly, SUMOylation of Ikaros was shown to prevent Ikaros interaction with co-repressors, which inhibited its ability to repress gene transcription [68]. 1.5 Ikaros in Chromatin Remodeling All the cells of an organism originate from the same precursors and share the same genomic material yet differentiate into a variety of specialized cells with disparate functions. The pattern of gene expression unique to each cell type develops early as lineage specific transcription factors guide the activation and repression of 29

43 genes that ultimately dictate cellular identity. There are many ways in which gene expression can be regulated, but epigenetic regulation of chromatin modifications made to the protein scaffold of DNA that influences its packaging and accessibility to transcriptional machinery imparts marked changes, both locally and globally, on gene expression and is believed to contribute to the establishment and heritability of cellular identity [106]. In the nucleus of eukaryotes, DNA is organized into a higher-order chromatin structure by a dynamic protein scaffold. Its most rudimentary unit, the nucleosome, consists of a 146 base pair section of DNA wrapped around a histone octamer [69-72] (Figure 1.7). The amino-terminal tail of each histone protrudes from the core nucleosome and can be studded with a number of different post-translational modifications (PTMs) including (but not limited to): acetylation, methylation, phosphorylation, and monoubiquitylation [110]. By altering the interaction between histones and DNA, PTMs are able to dictate higher order-chromatin structure, influence the accessibility of DNA to transcriptional machinery, and orchestrate binding of protein complexes that specifically recognize defined histone modifications. Ikaros was originally identified as an factor that bound to and activated the enhancer of the CD38δ gene, an early marker of T-cell differentiation [26, 27]. Early biological studies on Ikaros aimed at elucidating its function demonstrated Ikaros is a sequence-specific DNA binding protein, which can modestly activate gene transcription from transient chloramphenicol acetyltransferase (CAT) reporter assays [16, 29]. The complicated phenotypes of mutant Ikaros-targeted mouse models 30

44 suggest that Ikaros plays several important and multifaceted roles in various hematopoietic cell lineages. The characterization of these mouse models quickly illustrated the essential role Ikaros and its multiple isoforms play in the regulation and successful development of the hemolymphoid system [16] Striking parallels were noted between both the structure and intricate functions of Ikaros and Hunchback a major organizer of early embryonic gene expression in Drosophila, which had recently been implicated in chromatin organization [73]. Armed with biochemical data, results from studies in mice, and the emerging data regarding the role of Hunchback in chromatin remodeling during Drosophila development, researchers speculated that isolated reporter assays may not be providing a complete picture of Ikaros function [53]. Taking these multifaceted roles of Ikaros and parallels to Hunchback structure and function into consideration, Brown and colleagues used a complimentary approach to visualize the distribution of Ikaros in situ. They isolated B-cells in different stages of the cell cycle by counterflow elutriation and visualized Ikaros distribution using immunofluorescence microscopy with anti-ikaros antibody. They found that punctate staining of Ikaros was only evident at particular times of the cell cycle. Furthermore, they used an immuno-fish approach to elegantly show Ikaros, despite being associated with the activation of gene expression, localized to distinct heterochromatin foci in B-cells and linked it to several transcriptionally silent genes [53]. To do this, they used probes to specific genes (CD2, CD4, CD8, CD19, and CD45) in combination with Ikaros antibody in in B-lymphocytes and found a correlation between the transcriptional activity of the genes and their proximity to Ikaros complexes in the nucleus [53]. 31

45 These results initially appeared to be incongruent with previous reports demonstrating Ikaros acted as a transcriptional activator [16, 29]; however, exciting advancements in genetics and epigenetics elucidating the important role of chromatin in transcriptional regulation suggested Ikaros may be more than an ordinary transcriptional activator. In addition, reports of several proteins (Drosophilia GAGA, the centromere and promoter factor, 1 (CPF1)) known for their major roles in transcriptional activation were also being linked to centromeric localization and speculated to be involved in the epigenetic regulation of chromatin remodeling [74-76]. The work done by Brown and colleagues provided the first evidence that suggested Ikaros may regulate gene expression via epigenetic mechanisms modification of chromatin that results in heritable changes in gene expression [53]. In the early 90 s, significant advancements were being made in understanding the role of chromatin structure in transcriptional regulation and epigenetics was emerging as a fascinating, novel frontier in science. Seminal studies had identified large multimeric ATP-dependent chromatin modifying machines that were evolutionarily conserved from yeast to mammals, implicating the importance of chromatin structure on the activation or repression of transcription [77]. The yeast SWI/SNF complex (switching defective/sucrose non-fermenting) was the first ATPdependent chromatin modifying machine identified [78]. Its role in chromatin remodeling was suggested based on the observations that the complex was essential for the transcription of certain gene products and that mutations in histone proteins restored or minimized the phenotypes observed in swi and snf mutants [79]. Furthermore, ATP-dependent protein motifs similar to those seen in DNA-binding 32

46 helicases were identified and found to be essential for SWI/SNF, function suggesting the complex had the ability to bind and unravel DNA in a similar fashion as helicases [80]. Cote and colleagues is credited with providing the first evidence that the long sought after chromatin remodeling activity by a protein complex existed [78]. Their work demonstrated the SWI/SNF complex significantly enhanced Gal4 binding to a nucleosomal probe in an ATP-dependent fashion. Their experiments suggest the SWI/SNF complex interacts with transcriptional activators and DNA to disrupt histone-dna interactions, which destabilizes the histone octamer and thus allow the binding and subsequent activation of transcription by transcription factors [78]. Shortly after the SWI/SNF complex was identified as a chromatin-remodeling complex, several other ATP-dependent chromatin remodelers and chromatin modifying complexes were identified such as the nucleosome remodeling and deacetylase (NuRD) complex, Polycomb group (PcG) proteins, which make up the Polycomb Repressive Complex 1 (PRC1) and PRC2, and Triothorax (Trx) group protein complexes [78, 79]. Results from these pioneering studies dedicated to understanding chromatin remodeling machines led researchers to speculate that lineage specific, DNA-binding transcriptional regulators were responsible for recruiting chromatin remodeling complexes to impart the activation or repression of transcription on cell type specific genes [81, 82]. Ikaros at the time had been linked to two seemingly contradictory processes: the activation of gene transcription and colocalization with transcriptionally silent genes at pericentromeric heterochromatin [16, 53], making it appear as an attractive chromatin remodeling subunit. This paired with the identification of Ikaros at 33

47 heterochromatin encouraged a paradigm shift and researchers began to investigate a potential role for Ikaros in chromatin remodeling. In 1999, Kim and colleagues purified Ikaros in complex with two independent chromatin remodeling complexes: Mi-2/NuRD and the SWI/SNF complexes [13]. The SWI/SNF and Mi-2/NuRD complexes are both considered ATP-dependent chromatin remodelers and contain both chromatin opening and chromatin closing capabilities but are generally associated with activation or repression, respectively. Chromatin remodeling enzymes are classified into two groups: those that are dependent on ATP hydrolysis to modify DNA-histone interactions and those that covalently add PTMs to histone tails via methylation, acetylation, sumoylation, phosphorylation, ribosylation, and ubiquitination [111, 112, 113]. Large multiunit remodeling complexes are made up of at least one protein with enzymatic remodeling capabilities and several essential non-enzymatic subunits. The ATP-dependent remodeling enzymes are classified based on their helicase-like ATPase domain and belong to the SNF2 superfamily. They are further subdivided into four groups: SWI/SNF, ISWI, chromodomain-helicase DNA-binding protein (CHD) and INO80 complexes, based on the presence of additional functional domains [83]. These molecular motors are effectively able to remodel chromatin by reading, mobilizing, sliding or evicting nucleosomes along DNA. Researchers have demonstrated the critical importance of chromatin remodeling complexes in a diverse array of cellular and developmental processes. And it is becoming increasingly clear that, the nonenzymatic subunits, which are essential to the biologic activity of the complex, are frequently assembled in a cell type specific and context dependent fashion. This 34

48 characteristic provides chromatin modifying and remodeling complexes the flexibility to exist as unique machines that function in a cell-type specific fashion. The SWI/SNF complex was the first remodeling complex discovered and is now the best characterized [114]. Although slight differences in the composition of the complex exist between yeast and mammals, the complex is generally made up of different subunits and has an approximate molecular mass of 2MDa [84]. The human SWI/SNF complex was identified for its role in β-globin gene activation. In vitro studies have shown the SWI/SNF complex is able to interfere with DNA-histone interactions, move the histone core along DNA, and eject histone core octamers from DNA (7-9). The complex has been implicated in regulating cell fate decisions, controlling proliferation, lineage specification, and more recently with oncogenesis [84]. The Mi-2/NuRD complex is particularly well known for its role in hematopoietic development, differentiation, and cancer. The complex centers around Mi-2α or Mi-2β, two enzymes of the chromodomain helicase DNA-binding (CHD) subfamily with ATP-dependent activity. The complex contains six core subunits, two of which have enzymatic activity, which was unique at the time of its discovery [115]. The chromodomain-helicase-dna-binding protein 3 (CHD3, also known as Mi-2α) and CHD4 (also known as Mi-2β) subunits have ATP-dependent chromatin remodeling activity and the histone deacetylase 1 (HDAC1) and HDAC2 subunits both have histone deacetylase activity [85]. Other components of the complex consist of metastasis-associated (MTA) proteins, Methyl CpG binding domain proteins (MBD), histone binding retinoblastoma binding proteins (RBBP4; also known as 35

49 RBAP48) and RBBP7 (also known as RBAP46), and the zinc finger proteins GATAD2A and GATAD2B. RBBP4/7 and GATAD2A/B are both believed to be structural components of the complex that guide DNA binding directly through their interactions with histone tails [86-89]. In summary, the multifunctional Mi-2/NuRD complex is able to recognize and bind methylated DNA and histones, deacetylate histones and DNA to promote transcriptional repression, and mobilize or evicte nucleosomes to remodel chromatin [115]. Using a yeast two-hybrid screen, Kim and colleagues identified Mi-2α/β as a factor that interacted with the Ikaros family of proteins [13]. To asses whether a productive interaction between Ikaros, Alios, Mi-2, and HDAC exists in vivo, confocal immunofluorescence microscopy and anti-ikaros immunoprecipitations were used in resting and activated T cells [13]. Interestingly, the confocal microscopy demonstrated that Ikaros co-localized with Mi-2, HDAC, and Brg-1 (of SWI/SNF complex) diffusely throughout the nuclear volume in resting T-cells [13]. However, upon T-cell activation Ikaros, Mi-2, and HDAC proteins were redistributed in an Ikaros-dependent fashion into toroidal structures surrounding heterochromatin [13]. Furthermore, the chromatin remodeling activity of Ikaros-Mi-2/HDAC and Ikaros- SWI/SNF complexes were demonstrated using two complementary nucleosome disruption assays. The results provided the first evidence that Ikaros proteins exist in complex with multiprotein complexes, which are active in both chromatin remodeling and histone deacetylation (Figure 1.8). These data provide a direct link between lineage determining transcription factors and the epigenetic regulation of cell-type specific gene expression. Furthermore, the results offered significant insight into the 36

50 mechanism through which Ikaros is able to fulfill its multiple roles in lymphocyte development and differentiation. In a recently published article, Zhang and colleagues provided insight into how Ikaros mediates cell fate decisions by carefully orchestrating and targeting the NuRD complex to lineage specific gene targets [90]. Using chromatin immunoprecipitation (ChIP) followed by deep sequencing (ChIP-seq) they demonstrated Ikaros and Mi-2β localized to transcriptionally active gene targets in double positive (DP) thymocytes [90]. To support and confirm these findings RNAexpression analysis and individual ChIP assays of histone modifications surrounding the transcriptional start site of identified target genes were completed [90]. Then to more precisely evaluate the role of Ikaros in Mi-2/NuRD localization another ChIPseq analysis was completed using Ikaros null DP thymocytes [90]. The changes in Mi-2β distribution in Ikaros null thymocytes compared to that in wild-type thymocytes, which express endogenous Ikaros, suggest that Ikaros functions to limit Mi-2β access to permissive chromatin surrounding lymphoid cell-specific target genes [90]. Their findings show in the absence of Ikaros, Mi-2β was allowed more access to lymphoid cell-specific genes as well as transcriptionally poised genes that are involved in growth and metabolism resulting in an overall gain in chromatin accessibility, which seemed to result in gene activation in those areas. Examining the chromatin environment surrounding Ikaros and Mi-2B binding sites as well as in vitro nucleosomal remodeling studies confirmed that in the absence of Ikaros, Mi-2B was largely targeted to genes without the Ikaros consensus sequence. These findings suggest Ikaros serves to inhibit the accessibility of the NuRD complex to chromatin 37

51 and limit its nucleosome remodeling ability [90]. They suggested that Ikaros- Mi2β/NuRD binding hinders the remodeling and repressive ability of the complex by limiting access to nucleosomes and their acetylated histone tails [90]. In addition to the SWI/SNF and NuRD complexes, Ikaros was also found to interact with msin3 family of co-repressors in a yeast two-hybrid screen [15]. Sin3 proteins are approximately 175 kda and contain four similar repeats of a paired amphipathic helix motif, which are involved binding histone deacetylace complexes [91-94]. Sin3 proteins have been reported to form large multi-protein complexes to repress transcription via HDAC dependent and independent mechanisms [91, 95]. In their studies of msin3 proteins, Koipally and colleagues provided the first direct evidence that Ikaros could repress transcription by recruiting distinct deacetylase complexes to promoter regions. Immunoprecipitation reactions were done to examine the Ikaros-mSin3β interaction in vivo and truncation mutants were used to determine the protein region(s) involved in the interaction [15]. The results demonstrate that Ikaros exists in complex with Sin3-HDAC suggesting Ikaros has the ability to form several distinct repressive complexes. The authors suggest that perhaps the remodeling properties of the Mi-2/NuRD complex are required to access tightly bound heterochromatin while Ikaros-Sin3-HDAC complexes may be targeted to silencing more accessible, actively transcribed genes and thus participate in different molecular processes [15]. Interestingly, Gal4-Ikaros chimeric proteins were able to interact with Sin3-HDAC complexes to repress transcription in CAT-reporter assays and the degree of repression correlated with the proteins ability to interact with corepressors. These data suggest that Ikaros-mediated repression through Sin3 does 38

52 not require Ikaros DNA binding or dimerization properties. The authors propose that the ability to repress gene transcription in the absence of DNA binding may provide insight to the mechanism of tumor development in Ikaros dominant negative mutant mice. They further suggest that the over expression of dominant negative Ikaros isoforms in leukemia may dysregulate HDAC recruitment by titrating HDAC into non-productive complexes. In another study, Koipally and colleagues demonstrate Ikaros interacts with CtBP to repress transcription in a HDAC independent fashion. A conserved PEDLS CtBP consensus recognition motif was identified in the N-terminus of Ikaros. Interestingly, mutations within Ikaros that disrupted the PEDLS consensus sequence inhibited CtBP binding but did not prevent Ikaros from interacting with Sin3, Mi-2, or HDAC2 [14]. These findings demonstrate that CtBP is not essential for the interaction between Ikaros and the aforementioned histone deacetylase complexes and suggest that Ikaros represses transcription through CtBP using another distinct repressive mechanism. Furthermore, none of the other Ikaros family members (Helios, Alios, or Daesalus) contained a PEDLS motif nor could they interact with CtBP when overexpressed in 293T cells. Importantly, this is the first protein that distinguished between Ikaros and its family members suggesting the Ikaros-CtBP interactions may be a mechanism that provides Ikaros additional repressive specificity. These studies also demonstrated that although CtBP is capable of binding histone deacetylases, it is still able to repress transcription inspite of treatment with the non-specific histone deacetylase inhibitor, Trichostatin A. These findings suggest 39

53 Ikaros proteins are able to mediate gene repression via a histone deacetylaseindependent mechanism [14]. Further investigation of HDAC-independent transcriptional repression by Ikaros led to the identification of interactions with other importnat co-repressors, specifically CtBP Interacting Protein (CtIP) and the tumor suppressor Rb/130 [96]. This report demonstrates that Ikaros can interact with CtIP and Rb independently of CtBP to repress gene transcription in an HDAC-independent fashion [96]. Interestingly, Ikaros mutations that prevent CtBP interactions only moderately decrease repression but mutations that prevent both CtBP and CtIP interaction have a synergistic effect and more severely prevent repression [96]. Using immunoprecipitation reactions with Ikaros-GST fusions, CtIP, and different members of the basal transcriptional machinery, Koipally and colleagues demonstrate that the HDAC-independent mechanism of gene repression likely involves interactions with TBP and TFIIB, which are both components of the basal transcriptional machinery [96]. Despite significant effort, the precise mechanism Ikaros uses to regulate changes in gene expression has remained elusive in large part because loss of Ikaros leads to widespread changes in gene regulation. Furthermore, data that has emerged in an effort to understand how Ikaros regulates gene expression, lineage specification, and tumor suppression has been complex and often confounding. For example, studies of the SWI/SNF related PYR complex suggest Ikaros targets both the NuRD and SWI/SNF complex to the β-globin locus in a single complex [97]. It appears that although Ikaros has been found to associate with certain complexes without a 40

54 functional assay to study each interaction in specific cell types at different points during development and differentiation, their true biological relevance will be difficult to interpret. 1.6 Ikaros in Cancer Shorty after its discovery IKAROS was given the title master regulator of lymphocyte differentiation; however, the role of IKAROS in the pathogenesis of acute lymphoblastic leukemia (ALL) is not clearly understood. IKAROS was the first of its family of zinc finger transcription factors to be discovered, and it is the best characterized of the group. The protein has several critical roles in lymphoid development and differentiation, and is an established tumor suppressor [98]. The IKZF1 gene (also called ZNFN1A1) encodes the Ikaros protein, and can be alternatively spliced to form multiple isoforms. The gene is located at 7p12 and is made up of 8 exons, of which only 7 are coding. The N-terminal region (exons 3-5) encode four zinc fingers motifs, which are responsible for DNA binding. The C- terminal region, made up of exon 7, encodes two zinc fingers responsible for proteinprotein interactions. IKAROS proteins can vary in the number and sequence of the N- terminal zinc fingers. Isoforms unable to bind DNA are still able to homo- or heterodimerize with other IKAROS family members and function as dominant negative inhibitors of the protein. The function of these dominant negative isoforms in normal hematopoiesis remains elusive. Early studies using transgenic mice established that Ikaros has essential roles in both normal hematopoiesis and tumor suppression [16]. Most notably, mice heterozygous for a dominant negative form of the protein develop an aggressive T- 41

55 cell leukemia with 100% penetrance, underscoring the important role IKAROS plays in tumor suppression [17]. Since then, numerous studies using human samples have been focused on elucidating whether IKAROS has a tumor suppressor role in human cells and whether the loss of IKAROS function plays a part in leukemogenesis. Initial studies focused on the short, non-dna binding isoforms of IKAROS that act as dominant negative inhibitors of IKAROS function. Studies have revealed the presence of the short non-dna binding isoforms in adult B cell ALL[95], myelodysplastic syndrome [99], AML [97], and adult and juvenile CML [33]. However, due to insufficient functional and genetic data a causal association has not been identified for those malignancies. Moreover, the expression of Ik6, a dominant negative form of the protein that lacks exons 3-6, was consistently found in certain types of leukemia, particularly BCR-ABL1 positive lymphoid leukemia [9]. In an attempt to understand if and how these smaller non-dna binding isoforms contribute to the development of leukemia, Kano and colleagues expressed the dominant negative Ik6 protein in cells dependent on Interleukin-3 for growth and survival [98]. From these studies, they concluded that Ik6 expression in this system provides increased cell survival and a decrease in apoptotic cell death [98]. However, human placental CD34+ cells retrovirally transduced with IK6 have an impaired ability to differentiate into the B-lymphoid lineage [99]. Forced expression of IK6 in this system resulted in a decreased number of differentiated B cells with a subsequent rise in CD33 + myeloid cells, but an increase in survival was neither observed or tested in this system [6][95]. Given IKAROS has been shown to have several functions, which 42

56 are likely to be cell type and stage specific, a more thorough evaluation of Ik6 is required. Leukemia is the most common childhood malignancy accounting for approximately one third of all pediatric cancers and is the result of a block early in lymphoid differentiation. Acute lymphoblastic leukemia (ALL) is characterized by an accumulation of immature lymphocytes, called blasts, primarily in the bone marrow and peripheral blood and constitutes about 75% of pediatric acute leukemias. The treatment of pediatric leukemia is actually considered one of the great success stories of modern medicine due to the drastic improvements in survival rates (Figure 1.1). The progress in survival rates is largely attributable to improvements in treatment, effective combination therapy, intrathecal prophylaxis, integration of perceived risk of relapse to guide treatment intensity, and the high proportion of patients participating in clinical trials. However, Its estimated that 20% of patients will relapse and of those, only approximately 30% survive. The identification and successful treatment of high- risk patients is critical to improving survival in the future. Risk stratification is one method employed by physicians to identify patients who are at high risk of relapse. Features of clinical presentation as well as biologic characteristics of cancer cells are used to asses the potential aggressiveness of the disease, which is termed risk stratification. Accurate risk stratification is critical for ensuring that patients with high-risk ALL receive treatment of appropriate intensity and that low-risk patients are spared unnecessary toxic effects. Much effort has gone into characterizing the features of both patients and leukemic cells that are resistant to treatment in order to predict risk of relapse. Some features that are characteristic of 43

57 high-risk leukemia are: high white blood count at diagnosis, gene amplifications or deletions, chromosomal abnormalities such as BCR-ABL, and elevated minimal residual disease after treatment induction (Figure 1.2). Stratifying patients based on perceived risk of treatment failure, allows clinicians to individualize treatment options and modulate the intensity of combination chemotherapy for high-risk patients in order to improve outcome. Unfortunately, 36% of patients who died due to treatment failure in studies completed between did not meet the NIH metrics to be identified as highrisk, underscoring the importance of identifying additional prognostic markers to successfully identify therapeutic targets and aggressively treat high-risk patients. Recent genomewide analyses of DNA copy number abnormalities have identified numerous recurring genetic alterations in ALL. There are several genetic subtypes of pediatric acute lymphoblastic leukemia classified based on the type of genetic lesion. Interestingly, however, the specific lesion alone by which the types are classified (such as BCR-ABL1, TCF3-PBX1) are not sufficient to induce leukemia suggesting additional cooperating lesions are necessary for leukemogenesis to occur. To identify cooperating lesions Mullighan and colleagues undertook a comprehensive analysis of the genetic lesions in pediatric ALL [7]. The most noteworthy finding of the study was the observation that more than 40% of progenitor B-lymphocyte ALL had genetic aberrations in genes that regulate late stages of B-cell differentiation [7]. Interestingly, deletions or mutations in IKZF1 were identified in 15% of all cases of pediatric B-lymphocyte ALL [7]. Furthermore, this was the first report that identified 44

58 mutations and deletions in IKZF1 in pre-b ALL and suggested it may act as a cooperating lesion in high-risk ALL [7]. The BCR-ABL1 subtype of ALL is considered high-risk and is characterized by the presence of the BCR-ABL1 translocation t(9:22)(q34;q11.1), which encodes a constitutively active tyrosine kinase, termed the Philadelphia chromosome [100]. BCR-ABL1 positive ALL is associated with a particularly poor outcome and makes up over 5% of pediatric B-progenitor ALL and approximately 40% of adult ALL [100, 101]. Mullighan and colleagues used a genome wide analysis in pediatric ALL to identify cooperating genetic lesions that contribute to leukemic transformation [9]. The most common deletion or mutation was in IKZF1, which was altered in 83.7% of total BCR-ABL1 positive ALL cases, approximately 76.2% pediatric and 90.0% of adult BCR-ABL1 positive cases [9]. It should be noted that the IKZF1 mutations or deletions resulted in haploinsufficiency, expression of the non-dna binding dominant negative isoforms, or complete loss of IKAROS expression [9]. Furthermore, another study by Martinelli and colleagues demonstrated patients with IKZF1 deletions had a higher likely hood of relapse and stated that mutations or deletions in IKZF1 are the most clinically relevant prognostic factor in BCR-ABL1 positive ALL [10]. Interestingly, the most common IKZF1 deletion that occurred removed exons 2-7 which correlated with expression of the short non-dna binding Ikaros isoform which has been shown to act as a dominant negative inhibitor of wildtype Ikaros and other Ikaros family member function[11]. Moreover, a deletion in IKZF1 was also identified in 66% of chronic myeloid leukemia (CML) patients as they progressed to lymphoid blast crisis [11]. 45

59 An additional high-risk subtype of pediatric ALL is characterized by overexpression of CRLF2 [ ]. Harvey and colleagues also did gene expression profiling in over 200 children with high-risk B-progenitor ALL seeking to identify aberrantly expressed genes with novel genetic alterations [104]. Previous studies in the lab reveled that CRLF2 mutations in high-risk leukemia resulted in CRLF2 overexpression, and they suggest that CRFL2-mediated signaling may increase B-cell proliferation and survival, thus contributing to leukemogenesis [61]. The analysis of gene profiling studies demonstrated 14% of high-risk ALL had marked elevation of CRLF2 gene expression [102]. Furthermore, patients with rearrangements of the CRLF2 gene had a marked increase in relapse rate, an extremely poor response to therapy, and that alterations in CRLF2 was significantly associated with activating mutations in JAK1 or JAK2 kinases as well as genetic aberrations in IKZF1. Surprisingly, one third of BCR-ABL1 negative pediatric B-cell progenitor ALL was identified as having a deletion or mutation in at least one alle of IKZF1 [61]. Gene set enrichment analysis of Ikaros haploinsufficiency in BCR-ABL1 negative ALL demonstrated this ALL sub-type had a similar expression profile as BCR-ABL1 positive ALL. Interestingly, IKZF1 haploinsufficiency was also associated with an increased frequency of relapse and increased resistance to therapy [61]. Mullighan and colleagues suggest the IKZF1 mutation that results in haploinsufficiency behaves as a novel sub-type of BCR-ABL1-like high risk ALL and propose that alterations in IKZF1 are central to both BCR-ABL1 positive and negative ALL [60, 103]. 46

60 To identify the extent by which germline single nucleotide polymorphisms (SNPs) contribute to the susceptibility of acquiring pediatric ALL, two independent studies used a genome-wide approach to identify genetic aberrations that may be associated with development of ALL. Both studies identified inherited SNPs within the IKZF1 locus that resulted in a strong predisposition for the development of ALL [104, 105]. Furthermore, Papaemmanuil and colleagues demonstrated an association between the IKZF1 SNP and Ikaros expression levels, suggesting differential expression as a potential factor contributing to the development of ALL [105]. During the past several years, large scale genome-wide analyses of genetic alterations in leukemia have established IKZF1 (Ikaros) is an extremely important and clinically relevant tumor suppressor, particularly in high-risk pre-b ALL. Patients with alterations in the IKZF1 gene have a higher likelihood of relapse, while mutations or deletions are highly correlated with a poor prognosis [9, 61, 62]. Studies demonstrate that even a modest decrease in Ikaros function, such as haploinsufficiency, aids in the progression of leukemic transformation and increased risk of relapse and treatment failure [105]. Many studies have identified IKZF1 as a contributing oncogenic lesion in high-risk leukemia; however, the precise mechanism through which the loss of IKAROS function contributes to drug resistance and treatment failure is unclear. Given that a loss or decrease in IKAROS function plays a major role in high-risk leukemia, determining IKAROS status at the time of diagnosis may aid in more accurate risk stratification for ALL patients. This information could be used to guide clinical treatment plans and allow doctors to treat patients with a defect in IKAROS more aggressively. Aggressive treatment regimens during 47

61 induction therapy may aid in overcoming the cancer cells decreased sensitivity to chemotherapy, lower the levels of post-induction minimal residual disease and hopefully increase survival. 1.7 Chemotherapy Drug Resistance Drug resistance limits the effectiveness of chemotherapy in successfully treating cancer. Resistance is commonly attributed to 1) changes in the drug target such as point mutations or increased expression of the drug target that allow the target to escape cytotoxic inhibition, 2) upregulation of pro-survival signaling or activation of alternative pathways to escape inhibitory effects of the drug, or 3) attenuated cell death signals. Several mechanisms have been implicated in the development of drug resistance, which are divided into two broad categories; intrinsic and acquired. Intrinsic resistance refers to characteristics of the tumor that confer resistance prior to the initiation of drug therapy such as decreased influx of the drug into the cancer cell. Whereas acquired resistance develops as an adaptive response during the course of drug therapy due to reasons such as the acquisition of genetic mutations during treatment that allow the target to escape the toxic effects of the drug or genetic heterogeneity within the tumor in combination with selective pressures of therapy that allows the outgrowth of specific tumor cell population. Once cancer cells that were originally responsive to chemotherapy are able to overcome the effects of the drug due to an acquired mechanism of drug resistance results in treatment failure. The general principles governing drug resistance include both pharmacokinetics and pharmacodynamics (Figure 1.9). Pharmacokinetics refers to 48

62 how the body affects the drug the absorption of the drug into the body, the distribution of the drug within the body, the breakdown or metabolism of the drug into inactive metabolites, and finally the elimination of the chemotherapeutic from the body. Pharmacodynamics, on the other hand, refers to effects of the drug on body how it enters and exits the cell, whether it needs to be activated by cellular enzymes, as well as its mechanism of action. Drug resistance develops when the cancer cell has or acquires mechanisms to overcome the cytotoxic effects of chemotherapy and can effect any of the pharmacokinetic or pharmacodynamics principles described above. Changes in the expression level of genes that regulate cell death, cell survival, drug transporters, enzymes that anti-leukemia agents are targeted against, or drugmetabolizing enzymes all have the ability to alter a cancer cells sensitivity to treatment [117, 118, 119]. For example, increased levels of thymidylate synthase (TS) due to a triple repeat polymorphisms in the enhancer region results in drug resistance and a poor outcome in some patients [116]. The use of chemotherapy to treat leukemia is a balance between managing adverse effects and curing the patient, which has been largely successful; however, the development of drug resistance limits the effectiveness of chemotherapy and leads to treatment failure. IKAROS is a major transcriptional regulator that activates and represses gene transcription via chromatin remodeling. Furthermore large genomewide studies have identified an association between poor tumor response to therapy and an increased propensity to relapse with mutations and deletions in IKZF1. Therefore, it is reasonable to speculate that IKAROS may regulate any number of genes that could effect the influx of chemotherapeutics into the cell, the metabolism 49

63 of the drug into its inactive form, genes that prevent activation of the pro-drug into its active form, or even increase the transcription of genes that promote cell survival rather than cell death. A more complete understanding of the molecular mechanisms governing drug resistance will aid in clinical decision making and hopefully lead to rational combination therapy in select high-risk patient populations. 50

64 Works Cited 1. National Cancer Institute, D., Surveillance Research Program, Surveillance Systems Branch, Surveillance, Epidemiology, and End Results (SEER) Program Hoffbrand A.V., M., P.H., Pettit, J.E., Essential Haematology. Fifth ed2007: Blackwell Publishing. 3. Pui, C.H., M.V. Relling, and J.R. Downing, Acute lymphoblastic leukemia. N Engl J Med, (15): p Hunger, S.P., et al., Improved survival for children and adolescents with acute lymphoblastic leukemia between 1990 and 2005: a report from the children's oncology group. J Clin Oncol, (14): p Hunger, S.P., et al., Improving outcomes for high- risk ALL: translating new discoveries into clinical care. Pediatr Blood Cancer, (6): p Terzah Horton, C.P.S., Overview of the Treatment of Acute Lymphoblastic Leukemia in Children and Adolescents, in UpToDate Mullighan, C.G., et al., Genome- wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature, (7137): p Mullighan, C. and J. Downing, Ikaros and acute leukemia. Leuk Lymphoma, (5): p Mullighan, C.G., et al., BCR- ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros. Nature, (7191): p Martinelli, G., et al., IKZF1 (Ikaros) deletions in BCR- ABL1- positive acute lymphoblastic leukemia are associated with short disease- free survival and high rate of cumulative incidence of relapse: a GIMEMA AL WP report. J Clin Oncol, (31): p Iacobucci, I., et al., Identification and molecular characterization of recurrent genomic deletions on 7p12 in the IKZF1 gene in a large cohort of BCR- ABL1- positive acute lymphoblastic leukemia patients: on behalf of Gruppo Italiano Malattie Ematologiche dell'adulto Acute Leukemia Working Party (GIMEMA AL WP). Blood, (10): p Georgopoulos, K., Haematopoietic cell- fate decisions, chromatin regulation and ikaros. Nat Rev Immunol, (3): p Kim, J., et al., Ikaros DNA- binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity, (3): p Koipally, J. and K. Georgopoulos, Ikaros interactions with CtBP reveal a repression mechanism that is independent of histone deacetylase activity. J Biol Chem, (26): p Koipally, J., et al., Ikaros chromatin remodeling complexes in the control of differentiation of the hemo- lymphoid system. Cold Spring Harb Symp Quant Biol, : p Georgopoulos, K., et al., The Ikaros gene is required for the development of all lymphoid lineages. Cell, (1): p Winandy, S., P. Wu, and K. Georgopoulos, A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell, (2): p

65 18. Sommer, H. and D.V. Santi, Purification and amino acid analysis of an active site peptide from thymidylate synthetase containing covalently bound 5- fluoro- 2'- deoxyuridylate and methylenetetrahydrofolate. Biochem Biophys Res Commun, (3): p Santi, D.V., C.S. McHenry, and H. Sommer, Mechanism of interaction of thymidylate synthetase with 5- fluorodeoxyuridylate. Biochemistry, (3): p Hahm, K., et al., Helios, a T cell- restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin. Genes Dev, (6): p Kelley, C.M., et al., Helios, a novel dimerization partner of Ikaros expressed in the earliest hematopoietic progenitors. Curr Biol, (9): p Evans, R.M. and S.M. Hollenberg, Zinc fingers: gilt by association. Cell, (1): p Gamsjaeger, R., et al., Sticky fingers: zinc- fingers as protein- recognition motifs. Trends Biochem Sci, (2): p Leon, O. and M. Roth, Zinc fingers: DNA binding and protein- protein interactions. Biol Res, (1): p Molnar, A. and K. Georgopoulos, The Ikaros gene encodes a family of functionally diverse zinc finger DNA- binding proteins. Mol Cell Biol, (12): p Hahm, K., et al., The lymphoid transcription factor LyF- 1 is encoded by specific, alternatively spliced mrnas derived from the Ikaros gene. Mol Cell Biol, (11): p Georgopoulos, K., D.D. Moore, and B. Derfler, Ikaros, an early lymphoid- specific transcription factor and a putative mediator for T cell commitment. Science, (5083): p Klug, C.A., et al., Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes. Proc Natl Acad Sci U S A, (2): p Sun, L., A. Liu, and K. Georgopoulos, Zinc finger- mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development. EMBO J, (19): p Sun, L., et al., Expression of dominant- negative and mutant isoforms of the antileukemic transcription factor Ikaros in infant acute lymphoblastic leukemia. Proc Natl Acad Sci U S A, (2): p Sun, L., et al., Expression of dominant- negative Ikaros isoforms in T- cell acute lymphoblastic leukemia. Clin Cancer Res, (8): p Sun, L., et al., Expression of aberrantly spliced oncogenic ikaros isoforms in childhood acute lymphoblastic leukemia. J Clin Oncol, (12): p Nakayama, H., et al., Decreases in Ikaros activity correlate with blast crisis in patients with chronic myelogenous leukemia. Cancer Res, (16): p

66 34. Olivero, S., et al., Detection of different Ikaros isoforms in human leukaemias using real- time quantitative polymerase chain reaction. Br J Haematol, (4): p Payne, K.J., et al., Cutting edge: predominant expression of a novel Ikaros isoform in normal human hemopoiesis. J Immunol, (4): p Morgan, B., et al., Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO J, (8): p Li, Z., et al., Ikaros isoforms: The saga continues. World J Biol Chem, (6): p Klug, A., The discovery of zinc fingers and their applications in gene regulation and genome manipulation. Annu Rev Biochem, : p Wolfe, S.A., L. Nekludova, and C.O. Pabo, DNA recognition by Cys2His2 zinc finger proteins. Annu Rev Biophys Biomol Struct, : p Cobb, B.S., et al., Targeting of Ikaros to pericentromeric heterochromatin by direct DNA binding. Genes Dev, (17): p Koipally, J., et al., Unconventional potentiation of gene expression by Ikaros. J Biol Chem, (15): p Schjerven, H., et al., Selective regulation of lymphopoiesis and leukemogenesis by individual zinc fingers of Ikaros. Nat Immunol, (10): p Ronni, T., et al., Human Ikaros function in activated T cells is regulated by coordinated expression of its largest isoforms. J Biol Chem, (4): p Ramirez, J., K. Lukin, and J. Hagman, From hematopoietic progenitors to B cells: mechanisms of lineage restriction and commitment. Curr Opin Immunol, (2): p Nichogiannopoulou, A., et al., Defects in hemopoietic stem cell activity in Ikaros mutant mice. J Exp Med, (9): p Wang, J.H., et al., Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity, (6): p Papathanasiou, P., et al., Widespread failure of hematolymphoid differentiation caused by a recessive niche- filling allele of the Ikaros transcription factor. Immunity, (1): p Metcalf, D., The Wellcome Foundation lecture, The molecular control of normal and leukaemic granulocytes and macrophages. Proc R Soc Lond B Biol Sci, (1261): p Wong, P.M., et al., Properties of the earliest clonogenic hemopoietic precursors to appear in the developing murine yolk sac. Proc Natl Acad Sci U S A, (11): p Russel, E., Hereditary Anemias of the Mouse. Adv Genet, : p

67 51. Barker, J.E., Development of the mouse hematopoietic system. I. Types of hemoglobin produced in embryonic yolk sac and liver. Dev Biol, (1): p Rugh, R., The Mouse: Its Reproduction and Development. Oxford University Press, 1991: p Brown, K.E., et al., Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell, (6): p Lemischka, I.R., Clonal, in vivo behavior of the totipotent hematopoietic stem cell. Semin Immunol, (6): p Kondo, M., I.L. Weissman, and K. Akashi, Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell, (5): p Akashi, K., et al., A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature, (6774): p Morrison, S.J., N. Uchida, and I.L. Weissman, The biology of hematopoietic stem cells. Annu Rev Cell Dev Biol, : p Morrison, S.J. and I.L. Weissman, The long- term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity, (8): p Kirstetter, P., et al., Ikaros is critical for B cell differentiation and function. Eur J Immunol, (3): p Cortes, M., et al., Control of lymphocyte development by the Ikaros gene family. Curr Opin Immunol, (2): p Mullighan, C.G., et al., Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med, (5): p Kuiper, R.P., et al., IKZF1 deletions predict relapse in uniformly treated pediatric precursor B- ALL. Leukemia, (7): p Avitahl, N., et al., Ikaros sets thresholds for T cell activation and regulates chromosome propagation. Immunity, (3): p Dovat, S., et al., A common mechanism for mitotic inactivation of C2H2 zinc finger DNA- binding domains. Genes Dev, (23): p Gomez- del Arco, P., K. Maki, and K. Georgopoulos, Phosphorylation controls Ikaros's ability to negatively regulate the G(1)- S transition. Mol Cell Biol, (7): p Gurel, Z., et al., Recruitment of ikaros to pericentromeric heterochromatin is regulated by phosphorylation. J Biol Chem, (13): p Popescu, M., et al., Ikaros stability and pericentromeric localization are regulated by protein phosphatase 1. J Biol Chem, (20): p Gomez- del Arco, P., J. Koipally, and K. Georgopoulos, Ikaros SUMOylation: switching out of repression. Mol Cell Biol, (7): p Luger, K., et al., Characterization of nucleosome core particles containing histone proteins made in bacteria. J Mol Biol, (3): p Luger, K., et al., Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, (6648): p

68 71. Kornberg, R.D., Chromatin structure: a repeating unit of histones and DNA. Science, (4139): p Kornberg, R.D. and J.O. Thomas, Chromatin structure; oligomers of the histones. Science, (4139): p Pelegri, F. and R. Lehmann, A role of polycomb group genes in the regulation of gap gene expression in Drosophila. Genetics, (4): p Biggin, M.D. and R. Tjian, Transcription factors that activate the Ultrabithorax promoter in developmentally staged extracts. Cell, (5): p Raff, J.W., R. Kellum, and B. Alberts, The Drosophila GAGA transcription factor is associated with specific regions of heterochromatin throughout the cell cycle. EMBO J, (24): p McKenzie, E.A., et al., The centromere and promoter factor, 1, CPF1, of Saccharomyces cerevisiae modulates gene activity through a family of factors including SPT21, RPD1 (SIN3), RPD3 and CCR4. Mol Gen Genet, (3): p Workman, J.L. and R.E. Kingston, Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem, : p Cote, J., et al., Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF complex. Science, (5168): p Winston, F. and M. Carlson, Yeast SNF/SWI transcriptional activators and the SPT/SIN chromatin connection. Trends Genet, (11): p Singleton, M.R. and D.B. Wigley, Modularity and specialization in superfamily 1 and 2 helicases. J Bacteriol, (7): p Kadonaga, J.T., Eukaryotic transcription: an interlaced network of transcription factors and chromatin- modifying machines. Cell, (3): p Struhl, K., Histone acetylation and transcriptional regulatory mechanisms. Genes Dev, (5): p Ho, L. and G.R. Crabtree, Chromatin remodelling during development. Nature, (7280): p Lu, P. and C.W. Roberts, The SWI/SNF tumor suppressor complex: Regulation of promoter nucleosomes and beyond. Nucleus, (5): p Bowen, N.J., et al., Mi- 2/NuRD: multiple complexes for many purposes. Biochim Biophys Acta, (1-3): p Marhold, J., et al., The Drosophila MBD2/3 protein mediates interactions between the MI- 2 chromatin complex and CpT/A- methylated DNA. Development, (24): p Marhold, J., A. Brehm, and K. Kramer, The Drosophila methyl- DNA binding protein MBD2/3 interacts with the NuRD complex via p55 and MI- 2. BMC Mol Biol, (1): p Loyola, A. and G. Almouzni, Histone chaperones, a supporting role in the limelight. Biochim Biophys Acta, (1-3): p

69 89. Brackertz, M., et al., p66alpha and p66beta of the Mi- 2/NuRD complex mediate MBD2 and histone interaction. Nucleic Acids Res, (2): p Zhang, J., et al., Harnessing of the nucleosome- remodeling- deacetylase complex controls lymphocyte development and prevents leukemogenesis. Nat Immunol, (1): p Wolffe, A.P., Histone deacetylase: a regulator of transcription. Science, (5260): p Wang, H. and D.J. Stillman, In vitro regulation of a SIN3- dependent DNA- binding activity by stimulatory and inhibitory factors. Proc Natl Acad Sci U S A, (24): p Wang, H., et al., The Saccharomyces cerevisiae SIN3 gene, a negative regulator of HO, contains four paired amphipathic helix motifs. Mol Cell Biol, (11): p Wang, H., P.R. Nicholson, and D.J. Stillman, Identification of a Saccharomyces cerevisiae DNA- binding protein involved in transcriptional regulation. Mol Cell Biol, (4): p Laherty, C.D., et al., Histone deacetylases associated with the msin3 corepressor mediate mad transcriptional repression. Cell, (3): p Koipally, J. and K. Georgopoulos, Ikaros- CtIP interactions do not require C- terminal binding protein and participate in a deacetylase- independent mode of repression. J Biol Chem, (26): p O'Neill, D.W., et al., An ikaros- containing chromatin- remodeling complex in adult- type erythroid cells. Mol Cell Biol, (20): p Kathrein, K.L., et al., Ikaros induces quiescence and T- cell differentiation in a leukemia cell line. Mol Cell Biol, (5): p Crescenzi, B., et al., Submicroscopic deletions in 5q- associated malignancies. Haematologica, (3): p Ribeiro, R.C., et al., Clinical and biologic hallmarks of the Philadelphia chromosome in childhood acute lymphoblastic leukemia. Blood, (4): p Pandey, A., et al., Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin. Nat Immunol, (1): p Park, L.S., et al., Cloning of the murine thymic stromal lymphopoietin (TSLP) receptor: Formation of a functional heteromeric complex requires interleukin 7 receptor. J Exp Med, (5): p Fujio, K., et al., Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain. Blood, (7): p Harvey, R.C., et al., Rearrangement of CRLF2 is associated with mutation of JAK kinases, alteration of IKZF1, Hispanic/Latino ethnicity, and a poor outcome in pediatric B- progenitor acute lymphoblastic leukemia. Blood, (26): p Virely, C., et al., Haploinsufficiency of the IKZF1 (IKAROS) tumor suppressor gene cooperates with BCR- ABL in a transgenic model of acute lymphoblastic leukemia. Leukemia, (6): p

70 106. Zhou, V., et al., Charting histone modifications and the functional organization of mammailian genomes. Nat Rev Genet, (1): p Kee, k., A s-mlyl route toward lymphoid differentiation. Immunity, (4); p Wagners, A., et al., Cell fate determination from stem cells. Gene Therapy, (10); p Luc, S., et al., Delineating the cellular pathways of hematopoietic lineage commitment. Semin Immuno, (4); p Wang, Z., et al., Combinatorial patterns of histone acetylations an methylations in the human genome. Nat Genet, (7); p Wang, G., et al., Chromatin remodeling and cancer, part I: covalent histone modifications. Trends in Mol Med, (9); p Saha, A., et al., Chromatin remodeling: the industrial revolution of DNA around histones. Nature Reviews Molc Cell Bio, Vol 7; p Glapier, C., et al., The biology of chromatin remodeling complexes. Annu Rev Biochem, ; Tang, L., et al., Structure and Function of SWI/SNF Chromatin Remodeling Complexes and Mechanistic Implications for Transcription. Prog biophys Mol Bio, (2-3); p Lai, A., et al., Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nat Rev Cancer, (8); p Krahinovic, M., et al., Polymorphism of the thymidylate synthase gene and outcome of acute lymphoblastic leukemia. Lancet, ; p Relling, M., et al., Pharmacogenetics and cancer therapy. Nat Rev Cancer, ; p Weinshilboum, R., et al., Inheritance and drug response. N Engl J Med, ; p Evans, W., et al., Pharmacogenomics drug disposition, drug targets and side effects. N Engl J Med, 2003; 348; p Francis, et al., Regulator of myeloid differentiation and function: the secret life of ikaros. World J Biol Chem Jun 26; 2(6): p

71 58

72 59

73 60

74 61

75 62

76 63

77 64

78 65

79 66

80 67

81 CHAPTER 2 REGULATION OF DRUG RESISTANCE IN LEUKEMIA BY CK2-IKAROS AXIS 68

82 Regulation of Drug Resistance in Leukemia by CK2- Ikaros Axis Marie Bulathsinghala 1, Chunhua Song 1, Bihua Tan 1, Mansi Sachdev 1, Sunil Muthusami 1, Haijun Wang 3, Yali Ding 1, Kimberly Payne 2, and Sinisa Dovat 1 RUNNING TITLE: Regulation of Drug Resistance by Ikaros KEYWORDS: Ikaros, Gene regulation, Leukemia, Drug resistance, Combination Chemotherapy, Methotrexate, CK2 Inhibitor, 6-Thioguanine, Chromatin remodeling, Transcriptional regulation, Cell biology, Tumor suppressor, Epigenetics 1 Penn State College of Medicine, Hershey PA Division of Hematology, Oncology and Blood Marrow Transplantation, Children s Hospital Los Angeles, University of Southern California Keck School of Medicine, CA College of Animal Sciences, Jilin University, Changchun , China *For correspondance, sdovat@hmc.psu.edu; Tel. (717) Ext

83 2.2 Introduction Leukemia is the most common childhood malignancy accounting for approximately one third of all pediatric cancers and is the result of a block early in lymphoid differentiation leading to uncontrolled proliferation [1]. Acute lymphoblastic leukemia (ALL) is characterized by an accumulation of immature lymphocytes, called blasts, primarily in the bone marrow and peripheral blood [2]. Survival rates for childhood ALL have improved dramatically over the last 50 years and are now exceeding 80% [3]. Despite the remarkable improvements in survival, leukemia remains the leading cause of cancer-related mortality in children, primarily because there exists a subset of patients that have a high risk of relapse and a significantly worse outcome [3, 4]. Sadly, the survival rate for the 25% of children who relapse is less than 30%, highlighting the need for novel, more aggressive therapies [3, 4]. Failure in response to therapy is the number one cause of relapse, making drug resistance a hallmark of high-risk leukemia [3-5]. Much effort has gone into characterizing the features of both patients and leukemic cells that are resistant to treatment in order to predict the risk of relapse. Specific genetic markers including chromosomal anomalies and gene mutations, deletions, and rearrangements have been shown to be of important prognostic value and are routinely used to differentiate high and low risk leukemia [6]. For example, both t(9;22)(q34;q11) BCR-ABL1 gene fusions and intrachromosomal amplifications of the AML1 gene are associated with a poor prognosis; therefore, leukemia with these abnormalities is considered high risk [7, 8]. In addition, risk is assessed by clinical presentation (age, WBC counts), early 70

84 response to therapy, and various clinical and host pharmacogenetic features, including polymorphisms in genes involved in drug metabolic pathways [8]. Stratifying patients based on the perceived risk of treatment failure allows clinicians to individualize treatment options and modulate the intensity of combination chemotherapy for highrisk patients in order to improve treatment outcomes. One gene that is frequently mutated in high-risk leukemia is IKZF1, the gene encoding Ikaros [9-11]. Ikaros is a sequence-specific zinc finger DNA-binding protein and is considered a tumor suppressor and a master regulator of normal hematopoiesis [12]. Studies in mice have shown that Ikaros is essential for lymphoid specification and differentiation. Mice homozygous for an Ikaros mutant lacking the N-terminal DNA binding domain failed to develop mature B and T lymphocytes as well as Natural Killer (NK) cells [12]. Mice heterozygous for the same N-terminal antimorphic deletion developed aggressive leukemia and lymphomas with 100% penetrance [13]. Furthermore, mice that were homozygous for a C-terminal deletion that abolished all detectable Ikaros expression, had a complete block in B lymphocyte development, and although early T-cell progenitors were generated, a severe impairment in T-cell differentiation was observed [14]. Consistent the role of Ikaros as a tumor suppressor, deletions of all or only part of IKZF1 occur in nearly 30% of all human progenitor B-cell ALL cases [9, 10]. Recently a large-scale genome-wide analysis in ALL revealed that monoallelic deletions or missense mutations of the Ikaros zinc finger-1 (IKZF1) gene are observed in more than 76% of pediatric and 91% of adult high-risk BCR-ABL positive B-cell ALL [15]. Furthermore, IKZF1 was the only gene for which mutations and deletions were found to be useful in predicting 71

85 a poor response to therapy [10, 16, 17]. As such, genetic aberrations in IKZF1 that result in a loss or decrease in Ikaros function are now considered a defining feature of high risk, drug-resistant leukemia. However, the molecular mechanisms through which genetic aberrations in IKZF1 contribute to drug resistance in leukemia are poorly understood. Currently, treatment decisions are based according to risk stratification so that children with the highest risk of relapse can receive the most aggressive therapy early on in an effort to improve outcome. However, even with risk stratification, less than 30% of patients who have been classified as high-risk survive, underscoring the need for novel therapies and aggressive new approaches to treat high risk ALL. In this report we describe the mechanism through which Ikaros regulates drug resistance in leukemia. We show that Ikaros binds to the upstream regulatory element of several genes important in drug resistance, where it recruits chromatin-modifying enzymes to promote a repressed chromatin state. Over-expression of Ikaros in the pre-b ALL cell line, Nalm6, lead to a significant decrease in target gene mrna levels. Furthermore, Ikaros-directed shrna knock-down of Ikaros proteins lead to an increase in drugresistance gene transcripts in pre-b ALL cell lines and Ikaros haploinsufficient preb ALL primary cells (Ikaros haplo -ALL). We found that phosphorylation of Ikaros by caesin kinase (CK2) interferes with Ikaros-mediated repression and that inhibition of CK2 results in increased transcription of drug-resistance genes. Finally, we show in a cell growth inhibition assay that the CK2 Inhibitor, TBB, when used in combination with methotrexate (MTX) or 6-thioguanine (6-TG), results in synergistic effects. 72

86 2.3 Results Identification of Ikaros Target Genes. Mutations and deletions in Ikaros that result in a decrease in its function have been associated with a failure in response to therapy and a high risk of relapse in ALL [11, 17-19]. Changes in the expression of proteins responsible for the metabolism of chemotherapy agents are an established mechanism of drug resistance [20]. Cancer cells also have various adaptive responses that can contribute to the development of resistance; such as activation of compensatory signaling pathways and up-regulation of the therapeutic target [21]. Furthermore, up-regulation of genes involved in the pathway(s) the chemotherapeutics aim to inhibit, may be an additional mechanism by which leukemia cells are able to overcome growth inhibition and develop resistance [20, 22, 23]. Therefore, we investigated whether Ikaros bound to the promoters of genes important in drug resistance in the pre-b ALL cell line, Nalm6, which contains two wild-type IKAROS allels. Analysis of ChIP-Seq data revealed Ikaros bound within the promoter region of four genes that have been identified for their involvement in the metabolism of folate, 6-mercaptopurine (6-MP)/ 6-thioguanine (6- TG) or are the therapeutic target of MTX (Figure 2.1) [24]. Importantly, the four genes identified have also been linked to high-risk, drug resistant leukemia [22, 25-31]. Of the four target genes identified, thiopurine methyltransferase (TPMT) and thymidylate synthase (TYMS) are the most extensively studied in leukemia. TPMT catalyzes the S-methylation (inactivation) of thiopurine drugs such as 6-MP and 6-TG (Figure 2.2) [32]. Studies have demonstrated that patients with polymorphisms that 73

87 result in decreased TPMT activity tend to have a better response to treatment [33]. Interestingly, it is common practice to screen for TPMT gene mutations because patients with these inactivating polymorphisms are more prone to severe myelosupression due to the higher levels of active drug in their system [33]. Likewise, thymidylate synthase (TS), encoded by TYMS, is an essential protein involved in de novo production of thymidine monophosphate a vital precursor for DNA synthesis (Figure 2.3) [28, 34]. 5-flurouracil (5-FU) and polyglutamated forms of MTX directly inhibit TYMS, and increased levels of TYMS expression have been associated with a high risk of relapse in childhood ALL [28]. Analysis of the culled Ikaros ChIP-seq results in Nalm6 cells revealed Ikaros bound two distinct regions in both the TPMT and TYMS promoter regulatory region (Figures 2.1A and B). These data suggest Ikaros plays an important biological role in regulating TPMT and TYMS transcription and may also modulate the therapeutic response of leukemic cells to antifolate chemotherapeutics. Our ChIP-seq analysis also revealed Ikaros occupancy was enriched in the upstream regulatory region of methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 (MTHFD1)(Figure 2.1C) and methionine synthase (MTR)(Figure 2.1D). MTHFD1 and MTR are key players in folate metabolism, an essential pathway for proper DNA synthesis and repair. The trifunctional protein MTHFD1 provides the cofactor, 5,10-methylenetetrahydofoate (5,10-methylene-THF) and its derivatives, such as 10-formyl-tetrahydrofolate (10-formyl-THF), which are essential for methionine, thymidylate, and de novo purine synthesis (Figure 2.4) [22]. Treatment with MTX leads to the depletion of 5,10-methylene-THF, which results in the 74

88 inhibition of critical folate dependent enzymes [22]. It has been speculated that an increase in MTHFD1 activity could lead to alterations in the reduced folate pool, ultimately affecting leukemia cell sensitivity to MTX [22]. In addition, genetic variation in methionine synthase (MTR) has been linked to an increased risk of childhood ALL and AML [35]. MTR is dependent on vitamin B12 and catalyzes the remethylation of homocysteine to methionine; in doing so, releases THF, which is remethylated by MTHFD1 to 5,10-methylene-THF for nucleotide synthesis (Figure 2.5) [27]. MTR is also a component of the S- adenosylmethionine (SAMe) biosynthesis and regeneration pathway, providing the precursor to the universal methyl group donor, SAM [27]. Methylation of DNA, an important epigenetic modification and regulator of transcription, is dependant on the SAMe pathway as its source of methyl groups, and changes in DNA methylation, have been implicated in tumorigenesis [36]. The MTR 2756 polymorphism is believed to enhance the activity of the enzyme and thus increase the number of one-carbon moieties available for DNA methylation providing a possible mechanism for MTR s role in the development of acute leukemia. Our results demonstrate Ikaros is enriched immediately upstream of TSS in the promoter region MTR (Figure 2.1D). The metabolism of folate is critical for the synthesis and repair of DNA and the subsequent methylation of DNA and histones. Taken together, the data suggests a productive interaction exists between Ikaros and the Ikaros regulatory region (IRE) of several genes important in folate and drug metabolism. These data provide insight into the mechanism by which a decrease in Ikaros function may contribute to highrisk, drug resistant leukemia. Specifically, we hypothesize that Ikaros may play an 75

89 important biologic role in regulating the expression of these genes, and that a loss or decrease in Ikaros function, as frequently seen in high-risk ALL, could lead to aberrant expression patterns and affect therapeutic drug sensitivities Ikaros Binds the Upstream Regulatory Element of Several Genes Important in Folate and Drug Metabolism. To validate the results of the Nalm6 Ikaros ChIP-seq screen, we performed quantitative chromatin immunoprecipitation (qchip) reactions in several leukemic cell lines (Figure 2.6A-D) and primary cells (Figure 2.7A-D). We chose to use a panel of established human cell lines and primary leukemia patient samples that would encompass multiple blood lineages: the Nalm6 cell line is a preb cell acute lymphoblastic leukemia (B-ALL), the U937 cell line is an acute myelogenous leukemia (AML), the Molt4 cell line is an early T-cell acute lymphoblastic leukemia (T-ALL), and the Ramos cell line is a mature B-cell Burkitt s lymphoma. In addition, we tested primary patient samples that represented B-ALL, AML and T-ALL. The results indicate that anti-ikaros antibody could effectively and specifically precipitate Ikaros protein bound to the promoters of interest, whereas non-specific IgG antibody failed to precipitate any significant protein-dna complexes (Figure 2.6A-D and 2.7A-D). Importantly, we considered two-fold over IgG background to be evidence of protein binding. Notably, Ikaros binding to the upstream regulatory element of TPMT, TYMS, MTHFD1, and MTR was not detected in primary B-ALL cells with a single copy of Ikaros (haploinsufficient) due to the deletion of one allele (Figure 2.7D). The strong binding of Ikaros to the upstream regulatory element of TPMT, TYMS, 76

90 MTHFD1, and MTR in our panel of hematopoietic cell lines and patient samples is consistent with the idea that there is biological significance of Ikaros binding to the IRE of genes involved in drug resistance Ikaros Represses Transcription of TYMS, MTHFD1, MTR, and TPMT. Ikaros is a master regulator of normal hematopoiesis and has been shown to activate and repress target genes [37]. To investigate the functional significance of Ikaros binding to the upstream regulatory regions of TMYS, MTHFD1, and MTR, we used luciferase reporter assays. The promoter regions of TMYS, MTHFD1, and MTR, which included the Ikaros binding site identified by our initial ChIP-seq results, were amplified from genomic DNA and cloned into a luciferase reporter plasmid (TMYSluc, MTHFD1-luc, and MTR luc). Analysis of luciferase activity in cell extracts prepared from HEK-293T cells that were co-transfected with a luciferase reporter construct and an empty vector control plasmid (pcdna3.1 or prom) revealed that the TYMS-luc, MTHFD1-luc, and MTR-luc promoter constructs functioned as reasonably strong promoters alone (Figure 2.8A-B; pcdna 3.1 empty vector). Subsequently, HEK-293T cells were co-transfected with a luc-promoter construct (either TMYS-luc, MTHFD1-luc, or MTR luc) and either an empty vector control plasmid (pcdna3.1 or prom) or a plasmid encoding full-length human or mouse Ikaros (pcdna3.1-ha-hik-vi or pcdna3.1-ha-mik-vi respectively). A comparison of the luciferase activity in cellular extract prepared from 293T cells cotransfected with the luciferase reporter construct and either empty vector, mouse, or human Ikaros indicated that cells expressing Ikaros had a significant decrease in 77

91 luciferase activity (TYMS-luc 16 fold, p <.0001 (Figure 2.8A), MTHFD1-luc 3 fold, p,.0001 (Figure 2.3A), MTR-luc 4 fold, p <.0002 (Figure 2.8B)). We consistently saw over a 2-fold decrease in luciferase activity in the presence of Ikaros for all constructs tested. These results suggest that Ikaros is able to directly repress TMYS, MTHFD1, and MTR transcription. Next, we tested the effect of increased Ikaros expression on the transcription of genes involved in drug resistance in the human pre-b ALL Nalm6 cells. Cells were transduced with retrovirus containing wild type Ikaros (Ik-MIG) or an empty retroviral control (MIG) as a negative control. Successfully infected cells were sorted based on GFP expression, and the effect of increased Ikaros expression on transcription was analyzed using qrt-pcr. Results demonstrated that cells with increased Ikaros expression have a minimum of 2-fold reduction in transcription of TPMT, TYMS, MTHFD1, and MTR (Figure 2.8C). Analysis of Ikaros RNA and/or protein levels should be determined to demonstrate the transduction efficiency of the Ik-MIG system and provide evidence that Ikaros is overexpressed. To study the effect of reduced Ikaros activity on the transcription of TPMT, TYMS, MTHFD1, and MTR, we used Ikaros-directed shrna and a scrambled shrna (negative control). Changes in transcription levels were studied at the RNA level using qrt-pcr. Nalm6 cells transfected with Ikaros-specific shrna showed increased levels of transcription of TPMT, TYMS, MTHFD1, and MTR compared to the scrambled control (Figure 2.9A). Again, analysis of Ikaros RNA and/or protein levels after shrna knockdown would provide further support that the increase in target gene transcription is a result of decreased levels of Ikaros levels. Taken 78

92 together, these results demonstrate by both gain of function and loss of function experiments that Ikaros has the ability to regulate the transcription of several genes involved in drug resistance Ikaros Represses Transcription of Drug Resistance Genes via HDAC1- dependant and -Independent Mechanisms Ikaros has been shown to associate with histone deacetylase complexes via its interaction with the NuRD complex and msin3 family of co-repressors [38, 39]. Therefore, to investigate whether HDAC1 was involved in the Ikaros-mediated repression of TPMT, TYMS, MTHFD1, and MTR, we performed qchip assays using HDAC1 antibody with extracts from leukemia cell lines and primary patient samples. In all cell lines (Figures 2.10A-D) and primary leukemia (2.11A-B). samples tested, enhanced HDAC1 binding was observed at the same URE site as Ikaros. This is consistent with the observation that Ikaros represses genes via its association with HDAC1 and suggests HDAC1 may play important functional role in Ikaros-meditated repression. Next, to analyze the biological significance of HDAC1 binding, we tested whether histone deacetylase activity is required for Ikaros-mediated repression of drug resistance genes. Previous luciferase reporter assays demonstrated cotransfection of Ikaros with reporter constructs, including the promoter regions of TMYS, MTHFD1, or MTR, resulted in a decreased transcription in 293T cells (Fig 8A-B). To expand on those findings, we performed luciferase assays with and without histone deacetylase inhibitors. Interestingly, treatment of 293T cells with the general 79

93 histone deacetylase inhibitor, trichostatin A (TSA), 4 hours post-transfection abolished Ikaros-mediated repression of TYMS and MTHFD1 but had no effect on MTR repression (Figure 2.12A-C). These results suggest that Ikaros-mediated repression of TYMS and MTHFD1 requires histone deacetylase activity. However, Ikaros-mediated repression of MTR transcription likely occurs via a histone deacetylase independent mechanism. To specifically analyze whether HDAC1 is involved in Ikaros-mediated repression of drug resistance gene transcription, 293T cells were treated with MS-275, a specific HDAC1 inhibitor [40-42]. Consistent with the results observed with TSA, MS-275 treatment abolished Ikaros-mediated repression of TYMS and MTHFD1 but had no effect on MTR repression (Figure 2.12 A-C). These results suggest that HDAC1 activity is required for Ikaros-mediated repression of TYMS and MTHFD1 transcription but not that of MTR CK2-mediated Phosphorylation of Ikaros Interferes with Repression of Target Genes Our next objective was to identify the signal transduction pathway that controls Ikaros-mediated repression of drug resistance in leukemia. Phosphorylation is a reversible and dynamic process used by many proteins to regulate function. The process is governed by complex signaling cascades that include various kinases and phosphatases that add and remove phosphate groups to specific amino acids [43]. Previous studies have established Ikaros is regulated by post-translational modifications, most notably its phosphorylation state [44-47]. Casein kinase 2 (CK2) is responsible for phosphorylating Ikaros at multiple sites, and phosphorylation by 80

94 CK2 has been shown to decrease Ikaros affinity for DNA and regulate its subcellular localization [44-46]. Several reports have demonstrated that CK2 is frequently deregulated in cancer [48-53]. In line with previous reports, we demonstrate that CK2 activity is significantly higher in ALL compared to normal bone marrow, which suggests Ikaros ability to bind DNA and repress transcription may be impaired in leukemia (Figure 2.13A). In contrast to CK2, protein phosphatase 1 (PP1) is responsible for dephosphorylating Ikaros at several sites, which are directly phosphorylated by CK2 [47]. Previous reports have established that dephosphorylation of Ikaros by PP1 is critical for high affinity DNA binding and subcellular localization [47]. To investigate the role of CK2 in Ikaros-mediated repression of TYMS, MTHFD1, and MTR, we performed luciferase reporter assays in 293T cells (Figure 2.14A-C). We used wildtype mouse Ikaros (mik-vi) and a mouse Ikaros phosphomimetic mutant that had the PP1-binding site (critical amino acids 465 and 467) changed to alanine (pcdna3.1- HA-mIK-VI 465/7) [47]. Results showed that co-transfection with mik465/7 was unable to repress transcription of TYMS (Figure 2.14A) or MTHFD1 (Figure 2.14B) as efficiently as wild-type Ikaros in the luciferase reporter assay. Surprisingly, cotransfection with the phosphomimetic mutant, mik-vi 465/7, was still able to repress transcription from the MTR promoter, albeit to a lesser extent than wild-type Ikaros (Figure 2.14C). These results suggest that CK-2 mediated phosphorylation Ikaros interferes with repression of TYMS and MTHFD1 by Ikaros. Our results suggest Ikaros represses genes important in drug resistance and phosphorylation by CK2 impairs Ikaros function; therefore, we hypothesized Ikaros 81

95 mutations that result in decreased function combined with CK2 up-regulation interferes with Ikaros-mediated repression in high-risk leukemia. To determine whether inhibition of CK2 inhibition influenced the transcription of genes important in drug resistance, we used CK2-specific shrna and analyzed RNA transcription using qrt-pcr. Nalm6 cells transfected with CK2-targeted shrna showed significantly decreased levels of TPMT, TYMS, MTHFD1, and MTR transcription compared to the scrambled control (Figure 2.14D). Theses data are in line with our previous findings and further suggest the decrease in gene transcription is a direct result of the inhibition of CK2. Next, we treated a panel of leukemia cell lines representing multiple blood lineages with the CK2 inhibitor TBB. Nalm6, Molt4, Ramos, and U937 cells were treated with 50uM or 100uM TBB for 24h or 48h. Cells were harvested and RNA was extracted and analyzed using qrt-pcr (Figures 2.15A-B and 2.16A-B). Results indicated that in all cell lines tested, inhibition of CK2 strongly enhanced the repressive effect of drug resistance gene transcription. To further address whether the decrease in transcription of TPMT, TYMS, MTHFD1, and MTR after CK2 inhibition was a result of increased Ikaros activity, we tested the effects of CK2 inhibition on our target genes after Ikaros knockdown. Nalm6 cells were transfected with scrambled shrna (negative control) or Ikarosspecific shrna and treated with or without 50uM TBB for 24h. Cells were harvested and RNA was extracted and analyzed using qrt-pcr (Figure 2.17). The effect of CK2 inhibition on the transcription of drug resistance genes was compared in cells after Ikaros knockdown and in control cells. The ability of CK2 inhibition to repress 82

96 the transcription of TYMS and MTR was lost after Ikaros knockdown as compared to cells treated with scrambled shrna. However, a moderate decrease in the transcription of TPMT and MTHFD1 remained in cells after both Ikaros knockdown and CK2 inhibition compared to scrambled shrna control (Figure 2.17). These data suggest that the repression of TYMS and MTR requires Ikaros function for inhibition of CK2 to effectively repress transcription. However, the observation that transcription of TPMT and MTHFD1 are still moderately decreased after Ikaros knockdown and CK2 inhibition suggest that, in addition to the presence of Ikaros, other factors may contribute to the repression of these genes. Lastly, to decrease the likelihood that the results observed were off target effects of TBB, we treated 293T cells, which do not express Ikaros, the lymphoid specific transcription factor, with CK2 inhibitor and analyzed target gene transcription. Transcription of drug resistance genes was measured in 293T cells after treating cells for 24 hours with 50μM or 100μM TBB (Figure 2.18). Although CK2 activity was significantly decreased after CK2 inhibition (unpublished results), no significant decrease in the transcription of TPMT, TYMS, MTHFD1, or MTR was observed (Figure 2.18). These data provide further support that the decrease in transcription of TPMT, TYMS, MTHFD1, and MTR subsequent to CK2 inhibition is mediated via Ikaros. Taken together, these findings provide strong evidence that phosphorylation of Ikaros by CK2 decreases Ikaros activity as a transcriptional repressor. Furthermore these data suggest that inhibition of CK2 would enhance Ikaros repression of drug resistance genes in leukemia. 83

97 2.3.6 Inhibition of CK2 Enhances Ikaros Binding and Recruitment of HDAC1 to the TYMS and MTHFD1 Upstream Regulatory Element Previous reports have shown that phosphorylation of Ikaros by CK2 decreases Ikaros affinity for DNA and alters the protein s subcellular location [44-46]. To investigate whether the repressive effect observed after CK2 inhibition (Figures 2.15, 2.16 and 2.17) was a result of an increase in Ikaros binding and recruitment of HDAC1 at upstream regulatory elements, we performed qchip in untreated and TBB treated Nalm6 cells. The results indicate that CK2 inhibition increased Ikaros DNAbinding over a large portion of the upstream regulatory element for TPMT, TYMS, and MTHFD1 (Figures ). Consistent with our luciferase data, increased HDAC1 binding was observed in the promoter region of TYMS, TPMT, and MTHFD1. However, because we considered two fold over IgG background a positive result, the treatment of Nalm6 cells with TBB did not significantly increase HDAC1 binding within the MTR IRE. suggesting inhibition of CK2 is associated with enhanced HDAC1 recruitment by Ikaros for some but not all drug resistance genes Inhibition of CK2 Induces epigenetic changes leading to transcriptional repression The current hypothesis regarding Ikaros function involves Ikaros binding and recruiting target genes to pericentromeric heterochromatin (PC-HC) to induce 84

98 changes in gene expression via its interaction with chromatin remodeling complexes, such as NuRD and Swi/Snf [54-56]. Since Ikaros regulates gene transcription via chromatin remodeling, we tested whether the repression of drug resistance genes occurs via an epigenetic mechanism. Changes in the epigenetic marks around the transcriptional start site (TSS) of TPMT, TYMS, MTHFD1, and MTR were measured by qchip with and without CK2 inhibition. For each gene, five to six sets of primers that spanned the Ikaros regulatory unit (IRE) approximately -1000bp +300bp relative to TSS and included the Ikaros-peaks identified by ChIP-seq, were used in our qchip analysis (Figures 2.19A, 2.20A, 2.21A, 2.22A). We probed for changes in the following histone modifications: H3K4me 3, H3K9ac, H3K9me 3, and H3K27me 3 in Nalm6 cells. Most notably, the results indicate that the inhibition of CK2 resulted in significant changes in histone H3 trimethylation at Lysine 4 (H3K4me 3 ) and histone H3 acetylation at Lysine 9 (H3K9Ac) (Figures 2.23B-C, 2.24B-C, 2.25B-C, 2.26B-C). H3K4me3 and H3K9Ac are marks associated with active chromatin [57]. Therefore, our data suggest inhibition of CK2 results in a decrease in the marks associated with actively transcribed euchromatin leading to a more repressive chromatin state. In contrast, chromatin at the promoters of the four identified drug resistance genes in untreated Nalm6 cells is consistent with an open configuration, making it permissive to transcription as evidenced by the heavy H3K9 acetylation. These results are in line with the high-level of expression observed with these genes and indicate that inhibition of CK2 changes the epigenetic landscape surrounding the TPMT, TYMS, MTHFD1, and MTR promoter regions. Overall, these data suggest inhibition of CK2 in leukemia leads to in increased Ikaros occupancy at the upstream 85

99 regulatory region as well as decreased H3K9Ac and H3K4me 3 chromatin marks suggestive of a more repressed chromatin state Inhibition of CK2 restores Ikaros-mediated Repression of TPMT, TYMS, MTHFD1, and MTR in high risk Pre-B Cell ALL. Genetic aberrations with a single Ikaros allele that decrease function are characteristic of high-risk pre-b ALL with a poor prognosis and increase risk of relapse [10, 11]. Recent work supports the hypothesis that inhibition of CK2 enhances Ikaros activity as a transcriptional regulator [58, 59]. Therefore, we tested whether inhibition of CK2 in primary high-risk pre-b ALL cells would increase Ikaros binding to target gene upstream regulatory elements. Cells were obtained from a patient with high-risk pre-b ALL containing a deletion in one Ikaros allele and were untreated (negative control) or treated with CK2 inhibitor (TBB) for 24 hours followed by an anti-ikaros qchip. In line with our previous results, the data demonstrate a lack of Ikaros binding at the upstream regulatory element of Ikaros target genes. However, following inhibition of CK2, Ikaros binding to the same regulatory element was drastically increased (Figure 2.27A). Importantly, inhibition of CK2 restored the function of the remaining Ikaros allele and allowed significant binding to the upstream regulatory element as detected by qchip. These findings suggest that phosphorylation of Ikaros by CK2 regulates the ability of Ikaros to bind to the upstream regulatory element in high-risk leukemia and that inhibition of CK2 may reconstitute Ikaros-mediated repression of drug resistance genes in primary highrisk pre-b ALL cells. 86

100 Next, we tested whether the inhibition of CK2 had any effect on target gene transcription in high-risk leukemia. Primary Ikaros haploinsufficient pre-b ALL cells were untreated (negative control) and treated with CK2 inhibitor (TBB) for 24hrs, cells were harvested, and gene transcription was analyzed using qrt-pcr (Figure 2.27B). The results show that CK2 inhibition resulted in transcription repression of TPMT, TYMS, MTHFD1, and MTR compared to untreated control. Taken together, these findings show that inhibition of CK2 kinase in high-risk leukemia pre-b ALL can restore Ikaros binding to the upstream regulatory element of TPMT, TYMS, MTHFD1, and MTR as well as its ability to repress transcription of these genes The CK2 inhibitor, TBB, used in combination with Methotrexate or 6- Thioguanine provides synergistic results. Ikaros haploinsufficiency leads to the development of high-risk pre-b cell acute lymphoblastic leukemia (B-ALL) [11]. High-risk B-ALL is characterized by resistance to treatment, 3-fold higher incidence of relapse, and poor prognosis [11]. Previous reports have established that phosphorylation of Ikaros by CK2 decreases the proteins DNA-binding affinity and alters cellular localization. Due to this finding, it has been speculated that the inhibition of CK2 in high-risk B-ALL may enhance the activity of the remaining wild-type allele allowing it to better function as a transcriptional regulator [59]. Furthermore, methotrexate and 6-mercaptopurine/6- thioguanine are a part of the standard chemotherapy treatment of acute lymphoblastic leukemia (ALL) [6]. We have shown that CK2 inhibition can enhance Ikarosmediated repression of several genes involved in folate metabolism (TYMS, 87

101 MTHFD1, MTR) as well as a gene that inactivates 6-mercaptopurine (TPMT). Therefore, we hypothesized that TBB treatment may enhance leukemia cell sensitivity to MTX and 6-TG when used in combination. To investigate this question, we performed cell proliferation assays in multiple cell lineages to assess the effectiveness of combination treatment with the CK2 inhibitor, TBB, and either MTX or 6-TG. A panel of cell lines representing multiple blood lineages (Nalm6, CEM, Molt4, Ramos, and U937) were treated with multiple concentrations TBB, MTX, or 6-TG alone and compared to cells that were treated with TBB plus MTX or TBB plus 6-TG. Cellular proliferation was measured by spectrophotometry at 450nm four days post drug treatment using the WST1 reagent (Roche) (Figure 2.28A-H, 2.29A-F, and 2.30A-I). Results show that inhibition of CK2 in combination with MTX or 6-TG treatment enhances the cytotoxic effect of either drug alone. The degree of synergy varied depending on cell type. 2.4 Discussion IKAROS is one of the most clinically relevant tumor suppressors in precursor B-lymphocyte ALL [18, 60]. Patients with alterations in IKZF1, which result in even a modest decrease in IKAROS function (e.g. haploinsufficiency), have a much poorer response to therapy and significantly a higher likelihood of relapse. Although IKAROS has been associated with high-risk drug resistant leukemia, the mechanism through which it contributes to treatment failure remains to be seen. Furthermore, recent large scale IKAROS ChIP-seq experiments in mice and human cells have demonstrated that it binds to the promoter region of a large set of genes in vivo; 88

102 however the precise mechanism by which IKAROS regulates their transcription is not fully understood [24, 61, 62]. The data presented here demonstrates that IKAROS directly represses the transcription of four genes important in drug resistance. We provide evidence that IKAROS represses the gene encoding TPMT, an enzyme responsible for the metabolism of thioguanine chemotherapeutics, TYMS which encodes TS a direct protein target of MTX as well as two genes (MTHFD1 and MTR), whose protein products are involved in the folate pathway and de novo nucleotide synthesis. We also demonstrate that IKAROS-mediated repression is regulated by phosphorylation and that inhibition of CK2 can increase leukemic cell sensitivity to chemotherapy when used in combination with 6-TG or MTX. These data provide a rational for the use of combination therapy with CK2 inhibitors for the treatment of IKAROS deficient high-risk ALL. TPMT is an enzyme that plays an important role in the metabolism of thiopurine based chemotherapeutic agents, such as azathioprine, 6-mercaptopurine and 6-thioguanine, into their inactive metabolites (Figure 2.2) [25]. TPMT has no identified endogenous substrate, therefore its normal biologic function remains unknown [63]. The enzyme is evolutionarily conserved from bacteria to humans and catalyzes the S-methylation of aromatic and heterocyclic sulfhydryl compounds [25]. TPMT is most well known for the detoxification of 6-MP and 6-TG, which are converted into inactive methylated compounds. The level of TPMT enzymatic activity is of clinical relevance as high levels reduce the effective thiopurine dose resulting in treatment failure, and low activity levels can result in life threatening side effects due to drug-related toxicity [25]. 89

103 TYMS, MTHFD1, and MTR are all genes involved in folate metabolism a pathway essential for de novo purine and prymidine production, thus critical for DNA synthesis and rapidly dividing cells. Enzymes of the folate pathway are important targets for MTX, therefore a change in the expression or activity of these enzymes has the potential to modulate the therapeutic response to antifolate chemotherapeutics. Thymidylate Synthase (TYMS; also known as TS) is an enzyme that catalyses the methylation of dump to dtmp and is the sole de novo source of thymidylate. Polyglutamated forms of MTX directly inhibit TS enzymatic activity and high levels of TYMS transcription has been associated with resistance to MTX both in vitro and in vivo [64, 65]. Furthermore, over-expression of TS has been correlated with treatment failure and a poor prognosis in gastric cancer, breast cancer, and colorectal cancer [66-70]. Methylenetetrahydrofolate dehydrogenase (MTHFD1) produces essential cofactors for thymidylate and de novo purine synthesis [71, 72]. In a study of pediatric ALL patients treated with MTX, children with a polymorphism in MTHFD1 (A1985 variant) had a significantly decreased likelihood of five year event free survival in an univariate analysis [22]. Even more interesting is that polymorphisms in MTHFD1 in conjunction with another adverse event-predisposing variant within the same drug pathway, such as TYMS or MTHFR resulted in a greater likelihood of relapse and treatment failure [22]. For example, children with ALL who were treated with MTX and had polymorphisms in TYMS that resulted in increased protein expression as well as the MTHFD1 A1958 allele had a higher likelihood of relapse and a significant reduction of event free survival [22]. Importantly, these studies 90

104 demonstrate that the effects of multiple gene variants within the folate pathway are additive and significantly correlate with an increased relapse rate and treatment failure in ALL [22]. Methionine Sythase (MS), another gene within the folate pathway, catalyzes the transfer of methyl groups from N-methyltetrahydrofolate (methylene-thf) to homocysteine, generating tetrahydrofolate for purine and prymidine synthesis and methionine, which provides one-carbon units for the S-adenosylmethionine (SAMe) biosynthesis and regeneration cycle. Inhibition or decreased levels of MS results in redistribution of cellular folate derivatives, as well as a decrease in the overall intracellular folate level [27]. Furthermore, MS activity is essential to convert methylenetetrahydrofolate, the major circulating form of folate, into forms that can be used in nucleotide synthesis [73]. Although data targeted at identifying an association between polymorphisms in MTR and treatment outcomes in ALL patients treated with MTX is largely inconclusive, deregulation of MTR transcription remains an attractive candidate mechanism for drug resistance due to its ability to alter intracellular folate pools [27]. These four genes, TPMT, TYMS, MTHFD1, and MTR were among the 5,000 genes identified in an IKAROS ChIP-seq in Nalm6 cells. Our first objective was to validate the ChIP-seq data and establish whether IKAROS gene targets had any functional significance. We found that IKAROS did bind to the IRE in several leukemia cell lines and primary patient sampler; however, there was a great degree of variation in the relative binding observed within different primary patient samples (Figure 2.7). We attribute this to the observation that IKAROS is expressed at a 91

105 higher level in early T-cells compared to early B-cells, which may explain the high IKAROS binding observed in the primary early T-cell leukemia sample. In addition, early B-cells spontaneously die very quickly in vitro, which could have contributed to the low binding signal observed in the primary B-cell leukemia sample. To assess functional significance to IKAROS binding, we first determined IKAROS represses the transcription of TYMS, MTHFD1, and MTR using luciferase reporter assays. The promoter region of TPMT was unable to be amplified from genomic DNA due to its extremely high guanine and cytosine content; therefore, it was excluded from our luciferase gene reporter assay. Basic luciferase assays may not provide the complete picture regarding IKAROS function, particularly since IKAROS is believed to regulate gene transcription via chromatin remodeling. Gene reporter assays are evaluating the activation or repression of transcription from a plasmid that may not accurately reflect the native chromatin microenvironment in normal or leukemic cells. Therefore, we used both gain of function and loss of function experiments to determine how IKAROS regulated transcription of drug resistance genes in leukemia. In support of the luciferase data, transcription of TPMT, TYMS, MTHFD1 and MTR decreased after IKAROS over-expression and increased when protein expression was knocked-down. Previous reports have demonstrated that the level of Ikaros expression is important for function therefore, evaluating the protein and/or RNA levels after over expression and IKAROS knockdown would have added further insight to the interpretation of our results. CK2 is a ubiquitous serine/threonine protein kinase that is frequently deregulated in cancer and recent evidence gives credence to its role in tumorigenesis 92

106 [74]. IKAROS is directly phosphorylated by CK2 at multiple amino acids, resulting in decreased IKAROS DNA-binding affinity and a more diffuse subcellular localization [46, 47]. It has been suggested that CK2 may influence leukemic transformation by decreasing IKAROS DNA affinity and thus disrupting its tumor suppressor activities [59, 74]. In line with this idea, we demonstrate that CK2 kinase activity is dramatically increased in pre-b ALL cell lines and primary patient samples. Furthermore, we show that the CK2-IKAROS axis regulates IKAROS - mediated repression of drug resistance genes using four approaches: 1) CK2 knockdown results in decreased expression of all four drug resistance genes (Figure 2.13B); 2) An IKAROS phosphomimetic mutant was unable to repress TYMS, and MTHFD1 transcription in transient luciferase reporter assays (Figure 2.14A-C); 3) CK2 inhibition in leukemia cells results in decreased transcription of TPMT, TYMS, MTHFD1, and MTR (Figures 2.15 and 2.16) and finally 4) IKAROS knockdown followed by inhibition of CK2 demonstrates that the enhanced repression after treatment with TBB was completely dependent on IKAROS for some but not all genes. Since IKAROS knock-down followed by CK2 inhibition did not fully rescue transcription, these data indicate that other factors my contribute to the repression of TPMT and MTHFD1 (Figure 2.17). Importantly, increased repression was not observed when cells that did not expression IKAROS were similarly treated with CK2 inhibitor (Figure 2.18). In these experiments, we used both molecular inactivation (shrna) and pharmacological inactivation (TBB) to demonstrate that inhibition of the CK2- IKAROS axis may enhance IKAROS mediated repression of drug resistance genes. These data have important implications since treatment with 93

107 CK2 inhibitors offers a novel way of drugging a traditionally undruggable target to modulate the effectiveness of chemotherapy agents used in the treatment of ALL. These data support our hypothesis that IKAROS activity is regulated by posttranslational phosphorylation and that inhibition of CK2 results in an increase in IKAROS mediated repression of TPMT, TYMS, MTHFD1, and MTR. IKAROS can associate with histone deacetylase (HDAC) complexes such as the NuRD complex, SWI/SNF and msin3 family of co-repressors [38, 39]. Furthermore, IKAROS is able to act through both HDAC-dependent and independent mechanisms to repress target genes transcription [38, 39, 75, 76]. HDAC-independent IKAROS -mediated repression occurs through interactions with the corepressors CtBP, CtIP, and Rb [75, 76]. Therefore, we hypothesized that chromatin remodeling would likely play a role in IKAROS -mediated target gene repression. We demonstrated HDAC1 occupancy at the same IKAROS regulatory element as IKAROS using anti-hdac1 ChIP analysis in multiple leukemia cell lines and primary patient samples. Then we used two HDAC inhibitors to demonstrate that HDAC1 activity is essential for IKAROS -mediated repression of both TYMS and MTHFD1 but not MTR in transient luciferase assays (Figure 2.12). These findings suggest that Ikaros may use two different mechanisms to repress transcription of drug resistance genes. Because transient luciferase assays may not fully recapitulate the native epigenetic landscape and chromatin structure, we evaluated whether inhibition of CK2 resulted in any changes in IKAROS, HDAC1 recruitment or histone modifications to DNA in vivo. ChIP reactions in leukemia cells treated with a CK2 specific inhibitor compared to untreated cells demonstrated that inhibition of CK2 94

108 resulted in increased IKAROS binding at IKAROS regulatory elements. In addition, these studies showed a decrease in chromatin marks associated with active chromatin providing evidence that IKAROS regulates the expression of drug resistance genes through chromatin remodeling (Figures 2.18 through 2.26). In line with our previous findings, inhibition of CK2 led to an increase in HDAC1 occupancy at the promoters of TPMT, TYMS and MTHFD1 but not significantly in MTR. Furthermore, inhibition of CK2 resulted in profound changes in epigenetic marks surrounding TSS, which are consistent with gene repression, most importantly a decrease in H3K9 acetylation and H3K4 methylation (Figures ). These results suggest Ikaros represses the transcription of several genes involved in drug resistance though epigenetic modifications and chromatin remodeling. Interestingly, after TBB treatment we observed the intensity of the IKAROS and HDAC1 peak spreading beyond the IKAROS peak region that was identified by the original ChIP-seq. We attribute this to an increase in IKAROS DNA binding affinity after TBB treatment, the low specificity and high frequency of the IKAROS consensus sequence GGGAA, the ability of IKAROS to form dimers, trimers, and even multimers, as well as its ability to interact with large multiunit remodeling complexes which often include HDAC1. Gene expression analyses in multiple types of human cancers, such as: kidney, lung, breast, head and neck, and prostate have consistently reported that CK2 is overexpressed and highly active in human carcinoma. In this report, we demonstrate that CK2 is also highly active in pre-b ALL (Figure 2.13A). These findings suggest that drug resistance gene transcription may be upregulated in ALL. In addition, highrisk pre-b ALL is associated with mutations or deletions in Ikaros, particularly 95

109 nonsense, frameshift, or mutations that functionally inactivate a single allele resulting in haploinsufficiency [18]. We hypothesized that decreased Ikaros expression or the expression of a dominant negative form of the protein, together with increased CK2 activity results in functional-inhibition of any remaining wild-type Ikaros in high-risk leukemia. To address this we tested whether inhibition of CK2 in high-risk IKZF1 haploinsufficient ALL patient samples could restore repression of drug resistance genes. Our findings suggest that inhibition of CK2 in high-risk ALL resulted in increased Ikaros occupancy at the upstream regulatory element and enhanced repression of TPMT, TYMS, MTHFD1, and MTR. This data provides strong evidence that the function of any remaining wild-type Ikaros expressed in IKZF1 haploinsufficient ALL can be enhanced or restored by the inhibition of CK2 kinase. The elevated CK2 activity in pre-b ALL position the kinase as an important molecular target for the development of specific inhibitors for clinical use [77]. Phase I trials of CK2 inhibitors in solid tumors have already demonstrated the inhibitors can be safely administered to humans with only mild to moderate adverse side affects. Importantly, MTX and 6-MP are standard components of the combination chemotherapy regimine used to treat ALL [6]. Here we report that Ikaros represses the transcription of 1) TPMT an enzyme responsible for the inactivation of 6-MP and 6TG and 2) TYMS, MTHFD1, and MTR which are either directly inhibited by MTX (TS) or are critical regulators of the intracellular folate pool which is the pathway MTX targets to prevent cancer growth. Furthermore, our data shows CK2 inhibition enhances Ikaros-mediated repression of drug resistance genes and provides a rationale for the use of combination treatment with CK2 inhibitors in high-risk ALL. To 96

110 address this, we treated leukemia cells with combinations of CK2 inhibitor (TBB) and MTX or 6-TG. Combination chemotherapy with the CK2 inhibitor resulted in increased cellular toxicity and death when compared to cells treated with either drug alone providing strong support for further investigations pertaining to the use of CK2 inhibitors in the treatment of high-risk ALL. In summary, we have provided evidence that Ikaros represses the expression of four genes important in drug resistance. We demonstrate that CK2 activity is significantly increased in pre-b ALL and that the use of CK2 inhibitors results in increased Ikaros-mediated repression on of genes involved in folate metabolism as well as a gene that directly inactivates thiopurine chemotherapeutics. Importantly, we show that treatment of high-risk ALL patient samples, which have only one functional copy of wild type Ikaros, with CK2 inhibitors resulted in decreased transcription of TPMT, TYMS, MTHFD1, and MTR. We applied these findings to develop a novel approach to treat and hopefully improve treatment outcomes in highrisk leukemia. These studies provide insight into the mechanism through which IKZF1 haploinsufficiency and the functional inactivation of Ikaros contributes to drug resistance in high-risk leukemia. Taken together, this work provides insight into how IKZF1 status may help guide clinical decision making in the near future. Our work provides additional support for the clinical relevance of IKZF1 mutations in identifying patients with high-risk leukemia that may benefit from more aggressive therapies and provide a strong rational for the use of CK2 inhibitors in the treatment of high-risk ALL. 97

111 2.5 Experimental Procedures Cell Culture Condition Nalm6 cells were obtained from DSMZ, Brunswick, Germany. CCRF-CEM (CEM), U937, Ramos, and Molt4 cell lines were obtained from American Type Culture Collection (ATCC), Manassas, VA. All aforementioned lines were cultured in RPMI 1640 growth medium (CellGro) supplemented with 10% fetal bovine serum (FBS) (HyClone). HEK 293T cells were cultured in DMEM (CellGro) supplemented with 10% FBS. Primary leukemic and healthy donor cells were obtained from Loma Linda University (Loma Linda, CA) and Children s Hospital Los Angeles. The institutional review boards at Loma Linda University, Children s Hospital of Los Angeles and at Penn State College of Medicine all approved their use in these studies. Wild type Ikaros or Ikaros deletion in the patients samples were confirmed by western blot and/or DNA sequencing [24]. DNA Constructs and ShRNA For the construction of pgl4.15-promoter of TYMS (pgl4.14-tyms500), the promoter region of TYMS (approximately -500bp through +1,800 bp from TSS) was amplified by PCR from the genomic DNA of Nalm6 cells using primers: F: 500BP TYMS 5 F KpnI 5 ATATGGTACCCACCGCGTCCAGCGCC R: -3KB TYMS XhoI 3 Rv 5 ATATCTCGAGCAGGGAAGAAAACTGCCCTGG, the PCR product was isolated and cloned into pgl4.15 vector by XhoI and KpnI restriction enzymes 98

112 (New England Biolabs). For the construction of pgl4.15-promoter of MTHFD1 (pgl4.14-mthfd1), the promoter region of MTHFD1 (approximately -1850bp through +580bp from TSS) was amplified by PCR from the genomic DNA of Nalm6 cells using primers: F: 2KB MTHFD1 F KpnI 5 ATATGGTACCCCAGGCTGTTGAGATGGCAAAG R: 400 BP MTHFD1 3 R NheI 5 ATATGCTAGCCTGCTGGCGCC ATGG, the PCR product was isolated and cloned into pgl4.15 vector by KpnI and NheI restriction enzymes (New England Biolabs). The LightSwitch transfection-ready luciferase reporter construct for MTR promoter and plightswitch-rom empty vector were purchased from SwitchGear Genomics. The promoter regions in these constructs contain the Ikaros peak, as identified by ChIP-seq. The pmscv bicistronic retroviral vector (MIG vector) and the pmscv bicistronic retroviral vector encoding wild-type human HA-tagged Ikaros (IKZF1) which contains a 5 long-terminal-repeat-driven Ikaros, internal ribosome entry side (IRES), and enhaced green fluorescent protein (EGFP) were described previously [24, 78]. Retro- or Lentiviral Gene Transfer and Cell Sorting Retroviruses were produced and isolated from by transient transfection in amphotropic packaging cell lines as described previously [79]. Nalm6 cells were plated in 24-well plates at 4 x 10^5 cells/well and suspended in retroviral supernantants with 12.5 µg/ml polybrene and centrifuged at 1,400 g at room temperature for one hour. Cells were then suspended in fresh 10FBS-RPMI 1640 and cultured at 37 C, in 5% CO 2 for 3 days. The cells were sorted based on GFP 99

113 expression with a FACSAria high speed cell sorter (Becton Dickinson). Cells were stored a -20 C until further processed. Transfection Transfection of HEK 293T cells was performed using Lipofectamine 2000 (Invitrogen) transfection reagent according to the manufacturer s protocol. Transfection of Nalm6 cells was performed using the Neon transfection system according to manufacture s protocol (Invitrogen). Gene Expression Analysis by qpcr Total RNA was isolated from cells using the RNeasy Mini Kit (QIAGEN) followed by DNAse treatment according to the manufacturer s protocol. Complementary DNA (cdna) was generated from 1 µg total RNA using Superscript TM First-Strand Synthesis System (Invitrogen). qpcr was performed on StepOne Plus real-time PCR system (Applied Biosystems) using PerfeCta TM SYBER Green FastMix (Quanta Biosciences TM ) and primers for the indicated genes (primer pairs listed in Table X). The fluorescence threshold value was calculated and normalized to the values of 18s RNA. The 2-ΔΔCt method was applied to calculate the relative quantification values using the expression from 18S or GAPDH for normalization. Chemicals DMSO, 6-Thioguanine (6-TG), Methotrexate (MTX), and 4,5,6,7- Tetrabromobenzotriazole (TBB) was purchased from Sigma-Aldrich (St Louis, MO). 100

114 6TG was dissolved in RPMI 1640 medium (Cellgro) supplemented with 10% fetal bovine serum (Hyclone). MTX was dissolved in Na 2 CO 3, whereas TBB was dissolved in DMSO. ChIP-Seq Analysis ChIP-seq assays for Ikaros were performed as previously described [24, 80, 81] and as described below. For ChIP-seq library, 3x10 8 cells were cross-linked for 10 min in PBS containing 1% formaldehyde and reaction was stopped by adding glycine. Cell pellets were flash frozen and stored at 80 C. Chromatin was fragmented using the Bioruptor sonicator (Diagenode) for 30 min (30s pulses, 30s pauses in between) to produce fragments ~400bp in size. Affinity purified anti-ikaros antibody [82] was pre-coated onto Goat-antirabbit IgG Dyneabeads (Invitrogen) were used and incubated with chromatin overnight 4 C. Protein/DNA complexes were captured with a Magnetic Particle Concentrator (Invitrogen). Crosslinks were reversed. Samples were treated with proteinase K and RNaseA. DNA was recovered using the QIAquick PCR Purification kit (QIAGEN). ChIP-seq libraries were created using 18 cycles of amplification with ChIP-seq DNA sample prep kit (Illumina), in which libraries were run on a 2% agarose gel, and the bp fraction was extracted and purified. Libraries were validated using the Agilent Technologies 2100 Bioanalyzer. ChIP-seq libraries were sequenced at the High Throughput Genomics Center at University of Washington, Seattle. Sequence fastq files provided by the Center were aligned to the UCSC human genome assembly HG19 using the Eland application (Illumina), allowing no more than two mismatches per sequence. Only sequences aligning 101

115 uniquely to the human genome were used to identify peaks. Peaks were called using Cisgenome2.0 and SISSRS. ChIP-seq data analysis is described below. For information on Bioinformatics methods please refer to [24] Antibodies The antibodies used to immunoprecipitate the C-terminus of Ikaros has been described previously [82]. The antibodies used to detect HDAC1 and histone modifications were as follows: anti-hdac1 (ab7028) and anti-histone modification antibodies: H3K9ac (ab4441); H3K9me 3 (ab8898); H3K4me 3 (ab8580); H3K36me 3 (ab9050), all from Abcam and H3K27me 3 (07-449, from Millipore); anti-rabbit IgG (ab46540, Abcam). ChIP-qPCR qchip assays were performed as reported previously[81]. At least two biological replicates were performed for each experiment. Real-time PCR was performed using the PerfeCta TM Sybr Green FastMix (Quanta Biosciences TM ) dye detection method on the StepOne Plus real-time PCR system (Applied Biosystems) under default conditions. Enrichment of the ChIP material was calculated as recovery over a nonspecific IgG control. The comparative Ct method was used for quantification and fold enrichment was calculated employing the formula: 2 -CTsample /2- CTinput, where CT equals the threshold cycle number. Enrichment in the ChIP samples at specific targets was calculated as a fold of the Input (%). Primer Pairs Listed in Table X 102

116 Luciferase Assays Promega Dual Luciferase Reporter Assay HEK293T cells were seeded into 24-well plates and transiently transfected with 0.15 μg of indicated promoter reporter constructs or pgl4.15 vector and 0.15 μg of pcdna3.1-ikaros, pcdna3.1 mikaros 465/7A or pcdna3.1 vector triplicate for each group using lipofectamine 2000 transfection reagent (invitrogen) as per manufacturers protocol. As an internal control, the pgl4.74 (hrluc/tk) vector was cotransfected which led to the constitutive expression of Rennilla luciferase (Promega). Twenty-four hours after transfection, cells were lysed in 100 μl of 1x passive lysis buffer (Promega) and shake at RT for 15min as per the manufacture s manual. Then 20 μl lysate was transferred into a 1.5 ml tube containing 100 μl LAR (Progmega) and measured by luminometer (Promega GloMax 20/20 Luminometer) then 100 μl Stop n Glow Solution was added and measured again with the luminometer. The activity of firefly luciferase was normalized to the activity of Rennila luciferase. Luciferase activities were calculated as fold change relative to values obtained from pgl4.74 (hrluc/tk) vector only control cells, and expressed as a percentage of pcdna3.1-ikaros transfection-induced luciferase activity versus that of pcdna3.1 vector. All transfection and reporter assays were performed independently, in triplicate, at least three times. If HDAC inhibitors were used 0.5nM TSA was added 4-6 hour post transfection and incubated for 24 hours. 103

117 LightSwitch Reporter Assay HEK293T cells were seeded into 24-well plates and transiently transfected with 0.15 μg of indicated promoter reporter constructs or plightswitch-rom vector and 0.45 μg of pcdna3.1-ikaros, pcdna3.1 mikaros 465/7A or pcdna3.1 vector triplicate for each group using lipofectamine 2000 transfection reagent (invitrogen) as per manufacturers protocol. Twenty-four hours after transfection, cells were lysed in 100 μl of LightSwitch Reagent (Switchgear Genomics) and incubated at room temperature for 30 minutes following the manufacture s manual. The 50 μl lysate was transferred into a 1.5 ml tube and measured by luminometer. Luciferase activities were calculated as fold change relative to values obtained from plightswitch-rom vector only control cells, and expressed as a percentage of pcdna3.1-ikaros transfection-induced luciferase activity versus that of pcdna3.1 vector. All transfection and reporter assays were performed independently, in triplicate, at least three times. If HDAC inhibitors were used 0.5nM TSA was added 4-6 hour post transfection and incubated for 24 hours. Casein Kinase II (CK2) activity assays CK2 kinase activity assays were performed as described previously [24, 83, 84] and as described below. Total lysate from primary leukemia or normal human bone marrow mononuclear cells (MNCs) was prepared by incubation of the cells with lysis buffer (50 mm Tris-Hcl ph 7.2, 1% NP-40, 150 mm NaCl, 50 mm β- glycerophsphate, 5 mm DTT, 1 mm Na3VO4, 0.05 mm NaF, 0.1 μm PMSF, 5 mg/ml Leupeptin) on ice for 20min, passing through a 25 gauge needle 5 times and spinning down at RPM for 10 min. CK2 kinase activity was measured as 104

118 reported [83, 84]. Briefly, cell lysates (12 μg) were tested in a reaction mixture containing 20 mmol/l MOPS (ph 7.2), 25 mmol/l β-glycerol phosphate, 5 mmol/l EGTA, 1 mmol/l sodium orthovanadate,1 mmol/l DTT, 1 μg/μl substrate peptide (RRRDDDSDDD), 2 μmol/l protein kinase A inhibitor peptide [Upstate, PKI-(6 22)-NH2], and 5 μci of [γ-32p][78] GTP. Control kinase reactions without the peptide were also done for each of the samples. The reaction mixtures were incubated and agitated for 10 min at 30 C. Reactions were stopped by adding 20 μl of 40% trichloroacetic acid. Twenty-five microliters of each sample were then transferred onto phosphocellulose filter paper square P81, and the radiolabeled substrate was allowed to bind to the paper for 30s. The paper was immersed in 0.75% phosphoric acid and mixed gently on a rotator, followed by washing 5 times with 0.75% phosphoric acid for 1 min per wash to reduce background. Incorporated radioactivity in substrate peptide was determined by scintillation counting. Samples were assayed in triplicate. Ikaros and CK2 shrna knockdown and cell proliferation assay Four unique 29mer shrna constructs for human Ikaros (ikzf1) and human CK2 (CSNK2A1) in GFP vector (pgfp-v-rs) were purchased from Origene. The 1x105 Nalm6 cells were transiently transfected with 3.0μg of plasmids per well in 24-well plates using the Neon Transfection System (Invitrogen). The set of 4 shrna plasmids for Ikaros and CK2 were tested first, and the optimal gene knockdown shrna plasmid for each gene was selected for further studies. After transfection for 1 day, Nalm6 cells with transfection efficiency ranges from ~80% (green cells) and 105

119 more than 95% cell viability were further treated with 50μM TBB or Nontreatment control (0.01% DMSO) for 2days, then the cells were harvested for total RNA isolation, total lysate extraction; and an aliquot was used for proliferation assay. The 29-mer scrambled shrna cassette in pgfp-v-rs vector was also used as a control. The knockdown of Ikaros and CK2 was confirmed by measurement of Ikaros mrna level with qpcr and protein level with western blot with anti-ikaros-cts antibody as reported previously [82] (Data not shown). Cell Growth Inhibition Biological effects of the MTX, 6TG, and TBB were evaluated by a cell growth inhibition assay as described previously [85]. Briefly, logarithmically growing cells were harvested from the medium and resuspended to a final concentration of 1 x 10 5 cells/ml of fresh medium, MTX, 6TG, TBB, or a combination thereof cells per well were plated as triplicates in 96-well clear bottom plates (Costar 3603) and incubated four days at 37 C in a humidified atmosphere of 5% CO2. On day 4, a colorimetric assay was employed by adding WST-1 reagent (Roche, ) (10μl/well), media only was included as background control, shaking for 5 minutes, incubating an additional 4h at 37 C, and absorbance at 440/690nm was measured using the BioTek Synergy Mx plate reader. Protocol 1: Simultaneous exposure to MTX or 6TG and TBB for 4 days: Nalm6, Molt 4, CEM, Ramos, and U937 leukemia cell lines were used for the experiments. 106

120 Cells in their growth phase were harvest and resuspended at 2 x 10 5 cells/ml in fresh medium. Drug concentrations were prepared at 2 times their final concentration in RPMI % FBS. The harvested cells were then diluted 1:1 with the drug preparations and 10 4 cells were plated per well. All plates had control columns of both medium alone and cells with no treatment. DNA Construct Primers Gene Primer Name Sequence TYMS TYMS 5 F KpnI 5 ATATGGTACCCACCGCGTCCAGCGCC -3KB TYMS XhoI 3 Rv 5 ATATCTCGAGCAGGGAAGAAAACTGCC CTGG MTHFD1 2KB MTHFD1 F KpnI 5 ATATGGTACCCCAGGCTGTTGAGATGG CAAAG 400 BP MTHFD1 5 ATATGCTAGCCTGCTGGCGCCATGG 3 R NheI MTR 5 MTR XhoI 5 ATAT CTCGAG CCTAAAGTGCTGTGTTGTAC ACAG 3 MRT HindIII 5 GTGGGCGGCACCTTTAGAACTTAG AAGCTT ATAT qchip Primers TPMT TPMT P0 F TGCTCTGCGGTGGTTACACA TPMT P0 R TPMT P1 F TPMT P1 R TPMT P2 F TPMT P2 R TPMT P3 F TPMT P3 R TPMT P4 F TPMT P4 R AACTTTCCTAAGGTGCACACATCTT TGGAACTCCTGGGCTCAAGT TGGTGCAGCGAGCCTGTAG ACAAGCGTAGACAGCCTAGCAAT TCCGCTTCTGCCCTGAAC GCTCACCTTTGCGCTGAAG TCTGTACAGCGGTGCCTTTTC CCCTCCTCCAGGTCTCCAA TGAGCATTGCCAGGTTGCT TYMS TYMS P0 F ACAAGACCGCAGGAAAACGT TYMS P0 R TYMS P1 F TCGACCGCGCCTTCTCTA GCGGACCCCGTTTAGTCCTA 107

121 TYMS P1 R TYMS P2 F TYMS P2 R TYMS P3 F TYMS P3 R TYMS P4 F TYMS P4 R TYMS P5 F TYMS P5 R TGTAAGGCGAGGAGGACGAT TTCCCCTGTGGACCATTCC GCCCCGCCCACATCA CACCCCAGGCAAAAAATGTC CCCACTGTCCCCTGAAAGC AATGGAGCGCAGCCTTGA TTCACCACGAATGGGTTTCC GCAGCTGCTGTGGCTGATT GATCCCTCTCCTCAGACAAAACTC TYMS P6 F TYMS P6 R CAAGCGAGTGCGGATGAAC GCCACAGAGAAATGAAAGTGTAAAAA MTHFD1 MTHFD1 P0 F CGTGGGCAGCGGACTAATA MTHFD1 P0 R MTHFD1 P1 F MTHFD1 P1 R MTHFD1 P2 F MTHFD1 P2 R MTHFD1 P3 F MTHFD1 P3 R MTHFD1 P4 F MTHFD1 P4 R MTHFD1 P5 F MTHFD1 P5 R MTR P0 F MTR P0 R MTR P1 F CCTTCCCGTTCAGGATTTCTG TTCATCTTCCCCTCCCTCTTC AAGGACCCGAGTCCCTTAACTAA CCGCCCCGCAACTCTACT TGGAAAGGACTCCGGAATCC TGGCGTAGGTGTGTGACAAAG TCGACAGCAGATGTGGAACTG CAGCTCTGACACTCCTTCCAGAT GCTCAGCCGTAGGTGAAGCTT CCCAGGCAATTGTCCATCTT GATGCTCCCTCCCCTTAAGC CTGCGTGGTTGGGTTGTGT TCGCCCCAGGGATTAGGA CGCGCTCTGAAAGGTTCTAAA 108

122 MTR P1 R MTR P2 F MTR P2 R MTR P3 F MTR P3 R MTR P4 F MTR P4 R MTR P5 F MTR P5 R CGGAAAAGGACCCAAGAGAAA GGTTGATATTGACAGCCAATGC TTCCGGCCTGTGATTGGT TGCCCAGCGCAAGTCAA GTGTGGTGTCGAGCCTGAAA AGGTTGTGAGTTCCTCCTCCAA TGGAATGCAAAATCAGACAAGCT AACCTTACCTGGTACCACTCTTCCT GGCCAGGGAAAGGTTTCAAA qpcr Primers MTR qpcr F CGCGCTCTGAAAGGTTCTAAA MTR qpcr R CGGAAAAGGACCCAAGAGAAA 109

123 2.6 References 1. Pui, C.H., M.V. Relling, and J.R. Downing, Acute lymphoblastic leukemia. N Engl J Med, (15): p Hoffbrand A.V., M., P.H., Pettit, J.E., Essential Haematology. Fifth ed2007: Blackwell Publishing. 3. Hunger, S.P., et al., Improved survival for children and adolescents with acute lymphoblastic leukemia between 1990 and 2005: a report from the children's oncology group. J Clin Oncol, (14): p Hunger, S.P., et al., Improving outcomes for high- risk ALL: translating new discoveries into clinical care. Pediatr Blood Cancer, (6): p Cheok, M.H., S. Lugthart, and W.E. Evans, Pharmacogenomics of acute leukemia. Annu Rev Pharmacol Toxicol, : p Terzah Horton, C.P.S., Overview of the Treatment of Acute Lymphoblastic Leukemia in Children and Adolescents, in UpToDate National Cancer Institute, N.I.o.H. Childhood Acute Lymphoblastic Leukemia Tratment 05/02/ ent/page1]. 8. Terzah M Horton, P.S., Risk Group Stratification and Prognosis for Acute Lymphoblastic Leukemia. UpToDate, Mullighan, C.G., Genomic analysis of acute leukemia. Int J Lab Hematol, (4): p Mullighan, C.G. and J.R. Downing, Genome- wide profiling of genetic alterations in acute lymphoblastic leukemia: recent insights and future directions. Leukemia, (7): p Mullighan, C.G., et al., Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med, (5): p Georgopoulos, K., et al., The Ikaros gene is required for the development of all lymphoid lineages. Cell, (1): p Winandy, S., P. Wu, and K. Georgopoulos, A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell, (2): p Wang, J.H., et al., Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity, (6): p Mullighan, C.G., et al., BCR- ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros. Nature, (7191): p

124 16. Waanders, E., et al., Integrated use of minimal residual disease classification and IKZF1 alteration status accurately predicts 79% of relapses in pediatric acute lymphoblastic leukemia. Leukemia, (2): p Kuiper, R.P., et al., IKZF1 deletions predict relapse in uniformly treated pediatric precursor B- ALL. Leukemia, (7): p Payne, K.J. and S. Dovat, Ikaros and tumor suppression in acute lymphoblastic leukemia. Crit Rev Oncog, (1-2): p Papaemmanuil, E., et al., Loci on 7p12.2, 10q21.2 and 14q11.2 are associated with risk of childhood acute lymphoblastic leukemia. Nat Genet, (9): p Longley, D.B. and P.G. Johnston, Molecular mechanisms of drug resistance. J Pathol, (2): p Holohan, C., et al., Cancer drug resistance: an evolving paradigm. Nat Rev Cancer, (10): p Krajinovic, M., et al., Role of polymorphisms in MTHFR and MTHFD1 genes in the outcome of childhood acute lymphoblastic leukemia. Pharmacogenomics J, (1): p Gottesman, M.M., Mechanisms of cancer drug resistance. Annu Rev Med, : p Song, C., et al., Ikaros and Casein Kinase II (CK2) control the cell cycle and PI3K pathways in high- risk leukemia Manuscript submitted 25. Krynetski, E. and W.E. Evans, Drug methylation in cancer therapy: lessons from the TPMT polymorphism. Oncogene, (47): p Booth, R.A., et al., Assessment of thiopurine S- methyltransferase activity in patients prescribed thiopurines: a systematic review. Ann Intern Med, (12): p , W Banerjee, R.V. and R.G. Matthews, Cobalamin- dependent methionine synthase. FASEB J, (5): p Rocha, J.C., et al., Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood, (12): p Gervasini, G., Polymorphisms in methotrexate pathways: what is clinically relevant, what is not, and what is promising. Curr Drug Metab, (6): p Lautner- Csorba, O., et al., Roles of genetic polymorphisms in the folate pathway in childhood acute lymphoblastic leukemia evaluated by Bayesian relevance and effect size analysis. PLoS One, (8): p. e de Jonge, R., et al., Polymorphisms in folate- related genes and risk of pediatric acute lymphoblastic leukemia. Blood, (10): p

125 32. Karran, P. and N. Attard, Thiopurines in current medical practice: molecular mechanisms and contributions to therapy- related cancer. Nat Rev Cancer, (1): p Pui, C.H. and W.E. Evans, Treatment of acute lymphoblastic leukemia. N Engl J Med, (2): p Longley, D.B., D.P. Harkin, and P.G. Johnston, 5- fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer, (5): p Lightfoot, T.J., et al., Genetic variation in the folate metabolic pathway and risk of childhood leukemia. Blood, (19): p Rhee, I., et al., DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature, (6880): p Davis, K.L., Ikaros: master of hematopoiesis, agent of leukemia. Ther Adv Hematol, (6): p Koipally, J., et al., Ikaros chromatin remodeling complexes in the control of differentiation of the hemo- lymphoid system. Cold Spring Harb Symp Quant Biol, : p Kim, J., et al., Ikaros DNA- binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity, (3): p Mai, A., et al., Novel uracil- based 2- aminoanilide and 2- aminoanilide- like derivatives: histone deacetylase inhibition and in- cell activities. Bioorg Med Chem Lett, (8): p Hu, E., et al., Identification of novel isoform- selective inhibitors within class I histone deacetylases. J Pharmacol Exp Ther, (2): p Khan, N., et al., Determination of the class and isoform selectivity of small- molecule histone deacetylase inhibitors. Biochem J, (2): p Mann, M. and O.N. Jensen, Proteomic analysis of post- translational modifications. Nat Biotechnol, (3): p Gomez- del Arco, P., K. Maki, and K. Georgopoulos, Phosphorylation controls Ikaros's ability to negatively regulate the G(1)- S transition. Mol Cell Biol, (7): p Ronni, T., et al., Human Ikaros function in activated T cells is regulated by coordinated expression of its largest isoforms. J Biol Chem, (4): p Gurel, Z., et al., Recruitment of ikaros to pericentromeric heterochromatin is regulated by phosphorylation. J Biol Chem, (13): p Popescu, M., et al., Ikaros stability and pericentromeric localization are regulated by protein phosphatase 1. J Biol Chem, (20): p Daya- Makin, M., et al., Activation of a tumor- associated protein kinase (p40tak) and casein kinase 2 in human squamous cell carcinomas and adenocarcinomas of the lung. Cancer Res, (8): p

126 49. Faust, R.A., et al., Antisense oligonucleotides against protein kinase CK2- alpha inhibit growth of squamous cell carcinoma of the head and neck in vitro. Head Neck, (4): p Stalter, G., et al., Asymmetric expression of protein kinase CK2 subunits in human kidney tumors. Biochem Biophys Res Commun, (1): p Yenice, S., et al., Nuclear casein kinase 2 (CK- 2) activity in human normal, benign hyperplastic, and cancerous prostate. Prostate, (1): p Landesman- Bollag, E., et al., Protein kinase CK2 in mammary gland tumorigenesis. Oncogene, (25): p Landesman- Bollag, E., et al., Protein kinase CK2: signaling and tumorigenesis in the mammary gland. Mol Cell Biochem, (1-2): p Georgopoulos, K., Haematopoietic cell- fate decisions, chromatin regulation and ikaros. Nat Rev Immunol, (3): p Trinh, L.A., et al., Down- regulation of TDT transcription in CD4(+)CD8(+) thymocytes by Ikaros proteins in direct competition with an Ets activator. Genes Dev, (14): p Cobb, B.S., et al., Targeting of Ikaros to pericentromeric heterochromatin by direct DNA binding. Genes Dev, (17): p Zhou, V.W., A. Goren, and B.E. Bernstein, Charting histone modifications and the functional organization of mammalian genomes. Nat Rev Genet, (1): p Song, C., et al., Regulation of Ikaros function by casein kinase 2 and protein phosphatase 1. World J Biol Chem, (6): p Dovat, S., et al., Ikaros, CK2 kinase, and the road to leukemia. Mol Cell Biochem, (1-2): p Martinelli, G., et al., IKZF1 (Ikaros) deletions in BCR- ABL1- positive acute lymphoblastic leukemia are associated with short disease- free survival and high rate of cumulative incidence of relapse: a GIMEMA AL WP report. J Clin Oncol, (31): p Zhang, J., et al., Harnessing of the nucleosome- remodeling- deacetylase complex controls lymphocyte development and prevents leukemogenesis. Nat Immunol, (1): p Schjerven, H., et al., Selective regulation of lymphopoiesis and leukemogenesis by individual zinc fingers of Ikaros. Nat Immunol, (10): p Fessing, M.Y., et al., Functional characterization of the human thiopurine S- methyltransferase (TPMT) gene promoter. Eur J Biochem, (3): p Johnston, P.G., et al., Immunological quantitation of thymidylate synthase using the monoclonal antibody TS 106 in 5- fluorouracil- sensitive and - resistant human cancer cell lines. Cancer Res, (16): p

127 65. Leichman, C.G., et al., Quantitation of intratumoral thymidylate synthase expression predicts for disseminated colorectal cancer response and resistance to protracted- infusion fluorouracil and weekly leucovorin. J Clin Oncol, (10): p Aschele, C., et al., Immunohistochemical quantitation of thymidylate synthase expression in colorectal cancer metastases predicts for clinical outcome to fluorouracil- based chemotherapy. J Clin Oncol, (6): p Cascinu, S., et al., Thymidylate synthase protein expression in advanced colon cancer: correlation with the site of metastasis and the clinical response to leucovorin- modulated bolus 5- fluorouracil. Clin Cancer Res, (8): p Johnston, P.G., et al., The role of thymidylate synthase expression in prognosis and outcome of adjuvant chemotherapy in patients with rectal cancer. J Clin Oncol, (12): p Lenz, H.J., et al., Thymidylate synthase mrna level in adenocarcinoma of the stomach: a predictor for primary tumor response and overall survival. J Clin Oncol, (1): p Pestalozzi, B.C., et al., Prognostic importance of thymidylate synthase expression in early breast cancer. J Clin Oncol, (5): p Shane, B., Folylpolyglutamate synthesis and role in the regulation of one- carbon metabolism. Vitam Horm, : p Schwahn, B. and R. Rozen, Polymorphisms in the methylenetetrahydrofolate reductase gene: clinical consequences. Am J Pharmacogenomics, (3): p Green, J.M., D.P. Ballou, and R.G. Matthews, Examination of the role of methylenetetrahydrofolate reductase in incorporation of methyltetrahydrofolate into cellular metabolism. FASEB J, (1): p Ruzzene, M. and L.A. Pinna, Addiction to protein kinase CK2: a common denominator of diverse cancer cells? Biochim Biophys Acta, (3): p Koipally, J. and K. Georgopoulos, Ikaros interactions with CtBP reveal a repression mechanism that is independent of histone deacetylase activity. J Biol Chem, (26): p Koipally, J. and K. Georgopoulos, Ikaros- CtIP interactions do not require C- terminal binding protein and participate in a deacetylase- independent mode of repression. J Biol Chem, (26): p Martins, L.R., et al., Activity of the clinical- stage CK2- specific inhibitor CX against chronic lymphocytic leukemia. Leukemia, (1): p Hawley, R.G., et al., Versatile retroviral vectors for potential use in gene therapy. Gene Ther, (2): p

128 79. Reynaud, D., et al., Regulation of B cell fate commitment and immunoglobulin heavy- chain gene rearrangements by Ikaros. Nat Immunol, (8): p Wang, Z., et al., Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet, (7): p Fujiwara, T., et al., Discovering hematopoietic mechanisms through genome- wide analysis of GATA factor chromatin occupancy. Mol Cell, (4): p Dovat, S., et al., A common mechanism for mitotic inactivation of C2H2 zinc finger DNA- binding domains. Genes Dev, (23): p Martins, L.R., et al., Targeting CK2 overexpression and hyperactivation as a novel therapeutic tool in chronic lymphocytic leukemia. Blood, (15): p Phan- Dinh- Tuy, F., et al., Protein kinases in human leukemic cells. Am J Hematol, (3): p Sayegh, J., et al., Identification of small molecule inhibitors of Jumonji AT- rich interactive domain 1B (JARID1B) histone demethylase by a sensitive high throughput screen. J Biol Chem, (13): p

129 2.7 Figure Legends Figure 2.1. Ikaros ChIP-Seq Binding Profiles for Drug Resistance Genes. A-D: Signal maps for Ikaros target genes involved in drug resistance. A, TPMT, B, TYMS, C, MTHFD1, D, MTR. Occupancy of Ikaros at gene loci visualized by importing coordinates from UCSC Genome browser HG19 and called using Cis Genome 2.0. Arrows mark Ikaros ChIP-seq peaks relative to TSS for respective genes. Figure 2.2. Pharmacodynamic Profile of Thiopurines and Thiopurine S- Methyltransferase. Azathioprine (AZA), 6-Thioguanine (6-TG), and 6- mercaptopurine (6-MP) are thiopurine chemotherapeutics used in the treatment of leukemia. Thiopurine S-methyltransferase (TPMT) inactivates 6-MP and 6-TG by S- methylation in competing catabolic reactions. Cytotoxic effects of thiopurines are accomplished through incorporation of nucleotide analogues (TdGTP in DNA and TGTP in RNA). Incorporation of TdGTP and TGTP impairs DNA replication and repair, induces DNA damage, DNA-protein cross-linking, and chromatid exchanges. Figure 2.3. Pharmacodynamic Profile of Methotrexate and Thymidylate Synthase. Methotrexate (MTX) is an antifolate chemotherapeutic used in the treatment of leukemia. Inside cells, MTX is converted to active, polyglutamated forms of the drug which strongly inhibit the enzymatic activity of Dihydrofolate Reductase (DHFR) and Thymidylate Synthase (TS). TS, encoded by the gene TYMS, is an essential protein involved in the de novo production of thymidine 116

130 monophosphate a vital precursor for DNA synthesis. Inhibition by MTX and its polyglutamated forms results in impaired DNA formation and repair as well as decreased methylation of proteins and DNA. Figure 2.4. Pharmacodynamic Profile of Methotrexate and Methylenetetrahydrofolate dehydrogenase. Methotrexate (MTX) is an important antifolate chemotherapeutic used in the treatment of leukemia. Inside cells, MTX is converted to active, polyglutamated forms of the drug, which strongly inhibit the enzymatic activity of Dihydrofolate Reductase (DHFR) and Thymidylate Synthase (TS). The effect of MTX inhibition is also influenced by the function and expression of other enzymes within the folate pathway, such as Methylene-tetrahydrofolate dehydrogenase (MTHFD1). The trifunctional protein MTHFD1 provides the cofactor, 5,10-methylene-tetrahydofoate (5,10-methylene-THF) and its derivatives, such as 10- formyl-tetrahydrofolate (10-formyl-THF), which are essential for methionine, thymidylate and de novo purine synthesis. Inhibition by MTX and its active polyglutamated forms results in impaired DNA formation and repair as well as decreased methylation of protein and DNA. Figure 2.5 Pharmacodynamic Profile of Methotrexate and Methionine Synthase. Methotrexate (MTX) is an important antifolate chemotherapeutic used in the treatment of leukemia. The effect of MTX inhibition is also influenced by the function and expression of other enzymes within the folate pathway, such as Methionine Synthase (MS). MS, encoded by the gene MTR, is dependent on vitamin 117

131 B12 and catalyzes the remethylation of homocysteine to methionine; in doing so, releases THF, which is remethylated by MTHFD1 to 5,10-methylene-THF for nucleotide synthesis [12][61, 66-70]. MS is also a component of the S- adenosylmethionine (SAMe) biosynthesis and regeneration pathway providing the precursor to the universal methyl group donor, SAM. Inhibition by MTX and its active polyglutamated forms results in impaired DNA formation and repair as well as decreased methylation of protein and DNA. Figure 2.6 Ikaros Binds to the upstream regulatory element of Drug Resistance Genes in multiple cell lines. Quantitative ChIP analysis of Ikaros enrichment in the upstream regulatory element of TPMT, TYMS, MTHFD1, and MTR genes in a panel of leukemia cell lines: A, Nalm6, B, U937. C, Molt4, and D, Ramos. Figure 2.7 Ikaros Binds to the upstream regulatory element of Drug Resistance Genes in primary human leukemia samples. Quantitative ChIP analysis of Ikaros enrichment in the upstream regulatory element of TPMT, TYMS, MTHFD1, and MTR genes in primary human leukemia samples: A, Pre-B cell Leukemia B, Early T-cell Leukemia, C, Acute Myelogenous Leukemia, and D, High-risk Ikaros haplo Pre-B ALL. Figure 2.8 Ikaros Represses Transcription of MTHFD1, TYMS, MTR, and TPMT. Representative experiments showing repression of the A, MTHFD1-luc and TYMS-luc reporter by human Ikaros-VI (black bar) or empty vector control (grey bar) in HEK 293T cells. The reported luciferase activity was normalized using 118

132 pgl4.15luc and pgl3.75 control vectors. Data is presented as the mean +/- SD. B, Representative experiment showing repression of MTR-luc reporter by human Ikaros- VI (black bar) or empty vector control (grey bar) in HEK 293T cells. The reported luciferase activity was normalized using the prom control vector (SwitchGear Genomics). Data is presented as the mean +/- SD. C. Relative transcription of target genes measured by qpcr after Nalm6 cells were transduced with either empty vector (MIG) or human Ikaros (IK-MIG) and sorted based on expression of GFP. Data are means +/- SD. Figure 2.9 Ikaros Knockdown Increases Transcription of MTHFD1, TYMS, MTR, and TPMT.. Relative transcription of target genes measured A) Nalm6 cells were transfected with either scrambled shrna (negative control) or Ikaros specific shrna (Ikaros-shRNA) gene transcription was analyzed by qrt-pcr. Data are means +/- SD Figure 2.10 HDAC1 Binds to the upstream regulatory element of Drug Resistance Genes in multiple cell lines. Quantitative ChIP analysis of HDAC1 enrichment in the upstream regulatory element of TPMT, TYMS, MTHFD1, and MTR genes in a panel of leukemia cell lines: A, Nalm6, B, U937. C, Molt4, and D, Ramos. Figure 2.11 HDAC1 Binds to the upstream regulatory element of Drug Resistance Genes in primary human leukemia samples. Quantitative ChIP analysis of HDAC1 enrichment in the upstream regulatory element of TPMT, TYMS, 119

133 MTHFD1, and MTR genes in primary human leukemia samples: A, Pre-B cell Leukemia B, Early T-cell Leukemia. Figure 2.12 Ikaros represses transcription via HDAC-Dependent and Independent Mechanisms. Expression from the upstream regulatory element of A) TYMS, B) MTHFD1, and C) MTR was measure by luciferase reporter assay following transfection with human Ikaros (hik) in the absence (no Tx) or presence of the histone deacetylase inhibitors, trichostatin A (TSA) or HDAC1 specific inhibitor MS-275. Experiments were normalized to empty vector control. Figure 2.13 CK2 Activity is upregulated in pre-b ALL. A, CK2 activity in normal bone marrow (BM), primary B-ALL and the pre-b Nalm6 cell line. Statistical comparisons were by two-tailed student s t test. * p<0.05; ** p<0.01. Figure 2.14 CK2 Inhibits Ikaros-mediated transcriptional regulation of TPMT, TYMS, MTHFD1, and MTR. Representative experiments showing expression from the A, MTHFD1-luc reporter following co-transfection with empty vector control (bar 1), mouse Ikaros-VI (bar 2) or the phosphomimetic mutant mikaros-465/7a (which has the PP1 binding site mutated) (bar 3). B, TYMS-luc reporter following cotransfection with empty vector control (bar 1), mouse Ikaros-VI (bar 2) or the phosphomimetic mutant mikaros-465/7a (bar 3). The reported luciferase activities were normalized using pgl4.15luc and pgl3.75 control vectors. Data is presented as the mean +/- SD. C, Representative experiment showing expression from the MTR- 120

134 luc reporter after co-transfection with empty vector (bar 1), mouse Ikaros-VI (bar 2) or the phosphomimetic mutant mikaros-465/7a (bar 3). The reported luciferase activity was normalized using the prom control vector (SwitchGear Genomics). Data is presented as the mean +/- SD. D, Nalm6 cells transfected with either scrambled shrna (negative control) or CK2-specific shrna. Effect of CK2 knockdown on target gene expression analyzed by qrt-pcr. Standardized to 18s RNA and presented as the mean + SEM of triplicates. Figure 2.15 CK2 Inhibits Ikaros-mediated transcriptional regulation of MTHFD1, TYMS, MTR, CBS, and TPMT. D-X: qrt-pcr analysis of in a panel of leukemia cell lines cultured for 24h or 48h with (black bars) and without (grey bars) 50μM or 100μM of the CK2 inhibitor, TBB in A, Early T ALL Molt4 cells, B, Mature B Ramos cells Figure 2.16 CK2 Inhibits Ikaros-mediated transcriptional regulation of MTHFD1, TYMS, MTR, CBS, and TPMT. D-X: qrt-pcr analysis of in a panel of leukemia cell lines cultured for 24h or 48h with (black bars) and without (grey bars) 50μM or 100μM of the CK2 inhibitor, TBB in A, Early T ALL Molt4 cells, B, Mature B Ramos cells Figure 2.17 CK2 inhibition and Ikaros-dependence. A, Effect of Ikaros knockdown on changes in gene expression following CK2 inhibition with TBB. qrt- PCR analysis of drug resistance gene transcription in Nalm6 cells transfected with 121

135 either scrambled shrna (negative control) or Ikaros directed shrna and treated for 24hr with CK2 inhibitor (TBB). Figure 2.18 Inhibition of CK2 has no effect on cells that do not express Ikaros. A, qrt-pcr analysis of TPMT, TYMS, MTHFD1, and MTR transcription in 293T cells cultured with or without 50uM TBB. Results were standardized to 18S RNA and presented as +/- SD Figure 2.19 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the TPMT upstream regulatory element. A, Schematic depicting the upstream regulatory element of TPMT, the Ikaros binding region identified by ChIPseq, and the Primers (URE1-URE4). Representative experiments of B, quantitative ChIP analysis of Ikaros binding at the upstream regulatory element of TPMT (primers URE1-URE4) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of HDAC1 binding at the upstream regulatory element of TPMT (primers URE1-URE4) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.20 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the TYMS upstream regulatory element. A, Schematic depicting the upstream regulatory element of TYMS, the Ikaros binding region identified by ChIPseq, and the Primers (URE1-URE6). Representative experiments of B, quantitative ChIP analysis of Ikaros binding at the upstream regulatory element of TYMS (primers 122

136 URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of HDAC1 binding at the upstream regulatory element of TYMS (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.21 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the MTHFD1 upstream regulatory element. A, Schematic depicting the upstream regulatory element of MTHFD1, the Ikaros binding region identified by ChIP-seq, and the Primers (URE1-URE6). Representative experiments of B, quantitative ChIP analysis of Ikaros binding at the upstream regulatory element of MTHFD1 (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of HDAC1 binding at the upstream regulatory element of MTHFD1 (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.22 Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the MTR upstream regulatory element. A, Schematic depicting the upstream regulatory element of MTR, the Ikaros binding region identified by ChIPseq, and the Primers (URE1-URE6). Representative experiments of B, quantitative ChIP analysis of Ikaros binding at the upstream regulatory element of MTR (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of HDAC1 binding at the upstream regulatory element of 123

137 MTR (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.23 Inhibition of CK2 Results in Epigenetic Marks that Correlate with Repressive Chromatin. A, Schematic depicting the upstream regulatory element of TPMT, the Ikaros binding region identified by ChIP-seq, and the Primers (URE1- URE4). Representative experiments of B, quantitative ChIP analysis of H3K9Ac binding at the upstream regulatory element of TPMT (primers URE1-URE4) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of H3K9me 3 binding at the upstream regulatory element of TPMT (primers URE1-URE4) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. D, quantitative ChIP analysis of H3K4me 3 binding at the upstream regulatory element of TPMT (primers URE1-URE4) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. And E, quantitative ChIP analysis of H3K27me 3 binding at the upstream regulatory element of TPMT (primers URE1-URE4) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.24 Inhibition of CK2 Results in Epigenetic Marks that Correlate with Repressive Chromatin. A, Schematic depicting the upstream regulatory element of TYMS, the Ikaros binding region identified by ChIP-seq, and the Primers (URE1- URE6). Representative experiments of B, quantitative ChIP analysis of H3K9Ac binding at the upstream regulatory element of TYMS (primers URE1-URE6) in 124

138 Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of H3K9me 3 binding at the upstream regulatory element of TYMS (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. D, quantitative ChIP analysis of H3K4me 3 binding at the upstream regulatory element of TYMS (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. TBB for 24hr, and E, quantitative ChIP analysis of H3K27me 3 binding at the upstream regulatory element of TYMS (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.25 Inhibition of CK2 Results in Epigenetic Marks that Correlate with Repressive Chromatin. A, Schematic depicting the upstream regulatory element of MTHFD1, the Ikaros binding region identified by ChIP-seq, and the Primers (URE1- URE6). Representative experiments of B, quantitative ChIP analysis of H3K9Ac binding at the upstream regulatory element of MTHFD1 (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of H3K9me 3 binding at the upstream regulatory element of MTHFD1 (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. D, quantitative ChIP analysis of H3K4me 3 binding at the upstream regulatory element of MTHFD1 (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. TBB for 24hr, and E, quantitative ChIP analysis of H3K27me 3 binding at the upstream regulatory 125

139 element of MTHFD1(primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.26 Inhibition of CK2 Results in Epigenetic Marks that Correlate with Repressive Chromatin. A, Schematic depicting the upstream regulatory element of MTR, the Ikaros binding region identified by ChIP-seq, and the Primers (URE1- URE6). Representative experiments of B, quantitative ChIP analysis of H3K9Ac binding at the upstream regulatory element of MTR (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. C, quantitative ChIP analysis of H3K9me 3 binding at the upstream regulatory element of MTR (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. D, quantitative ChIP analysis of H3K4me 3 binding at the upstream regulatory element of MTR (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. TBB for 24hr. And E, quantitative ChIP analysis of H3K27me 3 binding at the upstream regulatory element of MTR (primers URE1-URE6) in Nalm6 cells cultured without (-) or with (+) 50uM TBB for 24hr. Data presented as the mean +/- SD. Figure 2.27 CK2 Inhibition restores Ikaros recruitment and transcriptional regulation of TPMT, TYMS, MTHFD1, and MTR in high-risk Ikaros haploinsufficient primary cells. A, Quantitative ChIP analysis of Ikaros binding at the upstream regulatory element of drug resistance genes in high-risk Ikaros haplo primary ALL cultured without (-) or with (+) 50uM TBB for 24hr. B, qrt-pcr 126

140 analysis in high-risk Ikaros haplo primary ALL cultured for 24h or 48h with (grey and black bars, respectively) and without (light grey bar) 50μM of the CK2 inhibitor, TBB. Figure 2.28 Treatment with CK2 inhibitor and 6-TG is Synergistic. Combination drug treatment was analyzed using In vitro cellular cytotoxicity assays. Cells were plated with media only (negative control), TBB only, 6-TG only, or a combination of TBB and 6-TG and incubated for 4 days. A colorimetric assay was employed, WST-1 reagent and absorbance was read at 440/690nm. Data is presented as the mean +/- SD. A-B, Nalm6, C-D, Molt 4, E-H, Ramos Figure 2.29 Treatment with CK2 inhibitor and 6-TG is Synergistic. Combination drug treatment was analyzed using In vitro cellular cytotoxicity assays. Cells were plated with media only (negative control), TBB only, 6-TG only, or a combination of TBB and 6-TG and incubated for 4 days. A colorimetric assay was employed, WST-1 reagent and absorbance was read at 440/690nm. Data is presented as the mean +/- SD. A-C, CEM, D-F, U937 Figure 2.30 Treatment with CK2 inhibitor and MTX is Synergistic. Combination drug treatment was analyzed using In vitro cellular cytotoxicity assays. Cells were plated with media only (negative control), TBB only, MTX only, or a combination of TBB and 6-TG and incubated for 4 days. A colorimetric assay was employed, WST-1 127

141 reagent and absorbance was read at 440/690nm. Data is presented as the mean +/- SD. A-B, CEM, C, Molt4, D-F, U937, G-H, Ramos 128

142 129

143 130

144 131

145 132

146 133

147 134

148 135

149 136

150 137

151 138

152 139