Journal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect

Transcription

1 Journal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect RESEARCH ARTICLE Identification of mirnas and target genes regulating catechin biosynthesis in tea (Camellia sinensis) SUN Ping 1, ZHANG Zhen-lu 3, ZHUQiu-fang 1, ZHANG Guo-ying 1, XIANG Ping 1, LIN Yu-ling 1, LAI Zhongxiong 1, LIN Jin-ke 1, 2 1 College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou , P.R.China 2 Anxi College of Tea Science, Fujian Agriculture and Forestry University, Fuzhou , P.R.China 3 College of Protection, Fujian Agriculture and Forestry University, Fuzhou , P.R.China Abstract MicroRNAs (mirnas) are endogenous non-protein-coding small RNAs that play crucial and versatile regulatory roles in plants. Using a computational identification method, we identified 55 conserved mirnas in tea (Camellia sinensis) by aligning mirna sequences of different plant species with the transcriptome library of tea strain We then used quantitative real-time PCR (qrt-pcr) to analyze the expression of 31 identified mirnas in tea leaves of different ages, thereby verifying the existence of these mirnas and confirming the reliability of the computational identification method. We predicted which mirnas were involved in catechin synthesis using psrnatarget software based on conserved mirnas and catechin synthesis pathway-related genes. Then, we used RNA ligase-mediated rapid amplification of cdna ends (RLM-RACE) to obtain 7 mirnas cleaving 8 catechin synthesis pathway-related genes including chalcone synthase (CHS), chalcone isomerase (CHI), dihydroflavonol 4-reductase (DFR), anthocyanidin reductase (ANR), leucoanthocyanidin reductase (LAR), and flavanone 3-hydroxylase (F3H). An expression analysis of mirnas and target genes revealed that mir529d and mir156g-3p were negatively correlated with their targets CHI and F3H, respectively. The expression of other mirnas have not significantly related to their target genes in the catechin synthesis pathway. The RLM-RACE results suggest that catechin synthesis is regulated by mirnas that can cleave genes involved in catechin synthesis. Keywords: tea (Camellia sinensis), mirna, catechin synthesis, gene 1. Introduction MicroRNAs (mirnas) are a class of non-protein-coding Received 19 April, 2017 Accepted 9 May, 2017 Correspondence LAI Zhong-xiong, laizx01@163.com; LIN Jin-ke, Fax: ; ljk213@163.com 2017, CAAS. All rights reserved. Published by Elsevier Ltd. doi: /S (17)61654-X RNAs that are nucleotides (nt) in length, and have multiple biological functions including negative regulatory roles in gene expression (Rhoades et al. 2002; Yao et al. 2007). mirnas are widely distributed in animals, plants, and even viruses, where they play critical roles in complicated biological processes by regulating target mrnas (Lim and Bartel 2003). In plants, ample evidence exists that mirnas are involved in many biological processes, including: morphogenesis of tissues and organs such as roots, stems, leaves, and flowers (Zhang et al. 2006d; Wang and Fan 2007); response to hormones and environmental stresses (Xu and Xie 2010; Ding et al. 2011) and regulation

2 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): of floral development (Puzey and Kramer 2009). To date, mirnas have mainly been predicted and identified using approaches such as high-throughput sequencing, cloning, bioinformatics prediction, and microarray analysis. In this study, we used a bioinformatics approach in conjunction with mature sequences of conserved mirnas from different plant species to predict potential conserved mirnas in tea (Camellia sinensis) strain In addition, we eliminated false positive sequences according to specific characteristics, such as: mirna conservation and length; mirna precursor hairpin structures and secondary-structure minimum free energies; and mismatches between mirnas and base complementary sequences of mirna precursors. Such a bioinformatics-based approach has been widely used to predict and identify multiple mirnas in many plant species, including 188 mirnas in Zea mays (Zhang et al. 2006c) and conserved mirnas in Coffea Arabica (Akter et al. 2014) and Gossypium hirsutum (Cheng et al. 2007). Tea, which is cultivated extensively worldwide, is economically important because it is one of the world s major beverages (Lin et al. 2003; Mondal et al. 2004). Catechin, an important secondary metabolite in tea, is one of the critical functional components affecting tea quality and flavor. Multiple studies (Giménez 2006; Wang et al. 2012) have demonstrated that catechin has many health effects in humans, such as scavenging free radicals and conferring resistance to oxidation and cancer (Pang and Dixon 2007). To date, studies about regulation of catechin biosynthesis have focused on transcription factors and environmental factors. For example, catechin accumulation is characterized by geography and seasonality, which suggests that catechin biosynthesis is regulated by environmental factors such as temperature and light. Shading in summer has been reported to decrease the catechin content of tea (Zhang et al. 2004), and catechin accumulation was higher in tea calluses cultivated under light (Wang et al. 2008). Researchers have demonstrated that dark treatment reduces tea catechin content; in particular, expression levels of anthocyanidin synthase (ANS), which is involved in catechin biosynthesis, are lowered, while those of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H) and dihydroflavonol 4-reductase (DFR), also involved in the catechin synthesis pathway, remain stable (Hong et al. 2014). Some researchers have also reported that short exposure to low-intensity ultraviolet (UV) light can boost the catechin content of tea, whereas prolonged exposure decreases catechin accumulation (Zheng et al. 2010). Catechin content is also affected by water and fertilizer conditions (Yue et al. 2011), carbon supply, and hormones. Despite these findings, elucidation of transcriptional and post-transcriptional regulation of catechin synthesis requires further investigation. Transcriptional factors, such as MYB, BHLH and WRKY, and regulatory proteins, have been shown to affect catechin accumulation by regulating expression of genes involved in catechin synthesis (Taylor and Grotewold 2005; Ravaglia et al. 2013). Given the important roles of mirnas in post-transcriptional regulation of gene expression, elucidation of their involvement in the regulation of catechin synthesis pathway-related gene expression requires further work. In this study, using a bioinformatics prediction method, we aimed to predict and identify mirnas in tea to determine their post-transcriptional regulatory roles in the expression of genes involved in catechin synthesis. 2. Materials and methods 2.1. Plant materials, micrornas and nucleotide sequences All plant materials were obtained from tea strain 1005, a tea germplasm resource with high levels of gallated catechin (Lin et al. 2005). First, the third and oldest leaves of tea strain 1005 were harvested in May 2015 for use in a quantitative real-time PCR (qrt-pcr) analysis to test gene and mirna expression levels. Leaves of tea strain 1005 at different maturities were combined and sent to Novogene (Beijing, China) for construction of a transcriptome library to predict conserved novel mirnas of tea. Sequences of catechin synthesis-related genes of tea were obtained from the Gen- Bank database ( of the National Center for Biotechnology Information (NCBI). Sequences of mirnas were acquired from mirbase for taxa such as Arabidopsis thaliana, Physcomitrella patens, Z. mays, Oryza sativa, Medicago sp., Glycine max, and Vitis vinifera Identification of valid mirna precursors To identify valid mirna precursors, we first aligned the mirna sequences of other plant species with the transcriptome library of tea strain 1005 and selected mirnas with three or fewer mismatches that aligned with known mirnas. We then filtered out protein-coding sequences using NCBI BLASTX. Finally, we analyzed secondary structures via Mfold ( and chose valid mirna precursors according to the following criteria (Zhang et al. 2006a): 1) mirna precursor sequences had three or fewer mismatches with conserved mirna sequences from other plants; 2) precursor sequences could form hairpin structures; 3) mirna sequences were located on one arm of the hairpin structure; 4) mirna sequences had no more than four mismatches with base complementary sequences of mirna precursors, which do not have hairpin structures; 5) the minimal free energy of the precursor s

3 4 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): secondary structure was less than 18 kcal mol 1 ; and 6) the percentage of (A+U) in mirna sequences was 40 70% Analysis of mirna levels Extraction of total mirnas of tea and synthesis of first-strand cdnas Extraction of total RNAs from tea was performed using Trizol reagent (Invitrogen, USA) according to the manufacturer s specifications. Extracted mirna purity was determined by measuring A260 to A280 ratios on a spectrometer, and integrity was tested by 1% agarose gel electrophoresis. First-strand cdnas were synthesized using a Mir-Xä mirna First-Strand Synthesis and SYBR qrt-pcr Kit (Clontech, USA) following the instructions supplied with the kit. qrt-pcr analysis of mirnas Specific primers for mirna qrt-pcr analysis were designed using DNAMAN software (Table 1), with U6 used as a house-keeping gene (Jeyaraj et al. 2014). All data were generated on a Roche LightCycler 480 qrt-pcr instrument (Roche, Switzerland). Excel (2003) was used for data analysis and figures were generated with Graphpad software Prediction and identification of mirnas involved in catechin synthesis Online prediction of mirnas interacting with catechin synthesis-related genes The online software tool psrna- Target ( was used to predict mirnas involved in regulating catechin synthesis-related genes. Target genes were then predicted from the generated scores as follows. First, mismatch scores with potential targets were calculated for mirnas that were 20 nt in length, with G-U mismatches, deletion/insertion, and other mismatches scored as 0.5, 2 and 1, respectively. Scores for mirnas with more than 20 nt were obtained by choosing the minimum score calculated from all possible sets of 20 consecutive nucleotides. If a mismatch other than G-U was found in the 2 7 nt region of the 5-terminus of the mirna under consideration, 0.5 was added to the total score. Mismatches in the middle of the mirna-mrna complementary region were acceptable as long as they were located between nucleotides 9 and 11. Finally, sequences with scores no higher than 5 were considered as potential mirna targets (Table 2). Verification of mirna cleavage sites in targets by RNA ligase-mediated rapid amplification of cdna ends (RLM- RACE) Total RNAs of tea leaves of different maturities and young stems were separately extracted using Trizol reagent (Invitrogen) according to the kit protocol. RNA purity and integrity were tested by 1% agarose gel electrophoresis after measuring RNA concentrations. Equal amounts of Table 1 Specific primers used for quantitative real-time PCR (qrt-pcr) of micrornas (mirnas) from bioinformatics analysis mirna Primer sequences 5 3 Tm ( C) mir1109 GCTAGTGGCAGATTTTGTCT 55 mir1533 GCGAAATAAAAATAATAATAA 51 mir156g-3p GCTTTCTCTCTCCTTGTCTCC 57 mir156h TGAGAGAGAGAGAGAGAGCA 54 mir156i GAGAGAGAGAGAGAGAGCAG 52 mir164b-3p CGCTATCCATCTTCTCCACC 60 mir1863a GCGCTCTCATACCATGTT 56 mir1863b CGCTCTGATACCATGAAGC 57 mir3437-3p GCTGTTGGATTTTGTTTTT 53 mir3513-3p CGCATAAGATGGAAATTGTAC 55 mir477c CTGTCCTCAAAGGCTTCC 56 mir5021a CGAAGAAGAAGAAGAAGAAAG 53 mir529-5p AGATGAGAGAGAGTACACAC 50 mir529d AGAAGAGAGAGAGAGAGCCA 54 mir535 TGACAATGAGAGAAAAACAC 52 mir5385 CACCAACCCCACCCTTGT 61 mir2868 GCGTGGTTTTGTGTAGTTGT 56 mir5180b GCGTGATCAGTTTTGAACT 54 mir6462a CTCTTTTGCATTTTTGCTGC 58 mir5240 CGAAAACATTGTGGATTGTG 57 mir7814 GCGGTTGATTTTATGCTTTG 58 mir5998a CGCACATGTTTGTGTTTTAT 55 mir5641 GCGGAAGAAGATGATAGAATT 55 mir5559-5p CGCTTGGTGAATTGTTTG 56 mir5638 TGGCAAAACTCTCTTACTTT 52 mir6191 CGATTTTTCTAGATATGAT 50 mir6281 ATGAGAGAGAGAGAGAGTGAG 50 mir7539 GAGAGAGAGAGAGCGAGAGG 56 mir865-3p GCGCCTCAAATTCATACC 57 mirmir397a-5p CATTGAGCGCAGGTCATG 60 mirmir399a GGCCATTGGAGATTTGTCC 60 RNA from shoots, leaves of different ages, and young stems were combined and used as a template for RLM-RACE reverse-transcription performed with a GeneRacer Kit (Invitrogen) according to the method of Lin (2011). Specific and universal primers designed with DNAMAN software (Table 3) were used for nested-pcr amplification, with the resulting products examined by 1% agarose gel electrophoresis. Target bands were recovered, cloned into vectors, and sent to Huada Biotech (Shenzhen, China) for sequencing to verify cleavage sites on target genes qrt-pcr analysis of mirnas and target genes Total RNA was extracted as described in and used as a template to generate first-strand cdna using a First- Strand Synthesis and SYBR qrt-pcr Kit (Takara, Japan). GAPDH, 18s, and β-actin were used as house-keeping genes following the method of Sun (Meilian et al. 2010). All primers were designed using DNAMAN software and synthesized by Huada Biotech, China (Table 3). qrt-pcr

4 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): Table 2 Potential micrornas (mirnas) regulating catechin biosynthetic pathway genes Target 1) Accession ID mirna E 2) UPE 3) Sites Inhibition CHS1 D ptc-mir Cleavage CHS2 D ath-mir5998a Translation ptc-mir Cleavage CHS3 D ath-mir Cleavage ptc-mir Cleavage CHI DQ ppt-mir529d Cleavage F3H AY aly-mir156g-3p Cleavage ptc-mir6462a Translation F35H KP gma-mir Translation ath-mir5998a Cleavage DFR comp136300_c0 vvi-mir156h Translation mtr-mir Cleavage LAR EF osa-mir Cleavage csi-mir Translation ANS AY bdi-mir408-5p Translation ppe-mir1511-5p Translation zma-mir164b-3p Translation ANR1 GU cre-mir Cleavage mtr-mir5559-5p Cleavage ptc-mir Cleavage ANR2 GU mtr-mir Cleavage mtr-mir Cleavage mtr-mir5559-5p Translation 1) CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F35H, flavonoid 3, 5 -hydroxylase; DFR, dihydroflavonol 4-reductase; LAR, leucoanthocyanidin reductase; ANS, anthocyanidin synthase; ANR, anthocyanidin reductase. 2) E, expectation. 3) UPE, unpaired energy. amplifications were carried out in 20-µL reaction volumes consisting of 10 µl SYBR Mix, 0.8 µl each of sense and antisense primers, 1 µl cdna as a template, and 7.4 µl distilled deionized water. Cycling conditions were as follows: initial denaturation at 95 C for 30 s, followed by 45 cycles of denaturation at 95 C for 30 s, annealing for 10 s and extension at 72 C for 15 s, with a melting curve generated at the end of the reaction. All data were obtained on a Roche LightCycler 480 instrument and analyzed in Excel (2003). 3. Results 3.1. Prediction of mirnas in tea and sequence analysis of their precursors In plants, mirna sequences are highly conserved. In this study, we used known mirnas of other plant species from mibase to identify 92 members of 81 mirna families in tea strain 1005 by high-throughput sequencing of a cdna library. mirna sequence lengths ranged from 19 to 24 nt (Appendix A). Although most of the identified mirna families in tea strain 1005 had only one member, families csn-mir156, csnmir1863, csn-mir1533, csn-mir1436, csn-mir5998, and csn-mir529 were represented by four, three, three, three, two, and two members, respectively. According to the results of the analysis, only eight mirnas (mir156j, mir1155, mir2119, mir2925, mir3521, mir399a, mir408-5p, and mir5385) contained low percentages of (A+U) ranging between 40.4 and 48.3%. The (A+U) percentage of the majority of identified mirnas from tea strain 1005 ranged between 50 and 82.5%, thus satisfying the requirement that the (A+U) percentage should be greater than that of (G+C) in mirna sequences (Zhang et al. 2006c). In contrast to animal cells, where the length of mature mirna precursors ranges from 70 to 80 bp, the length and structure of plant mirna precursors is highly variable. As shown in Appendix A, lengths of mirna precursors in tea strain 1005 ranged from 54 to 298 bp. We also found that 47 and 49 mirnas were located at the 3 and 5 ends of the precursor, respectively. Even in mirnas from the same family, such as mir1436, mir156, mir1863, and mir1533, precursor lengths and locations were variable, further verifying the diversity of the identified mirna precursors in tea. Characteristics used for bioinformatic prediction of mirnas include precursor hairpin structure and minimal free energy for folding (Zhang et al. 2006c). mirna precursors in plants such as Arabidopsis are characterized by highly diverse hairpin structures (Bartel 2004; Millar and Waterhouse 2005). In this study, secondary structures of mirna precursors were analyzed with Mfold software (Appendix B), which

5 6 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): Table 3 Primers used to amplify MicroRNA (mirna) cleavage sites Gene 1) Function 2) Primer sequences(5 3 ) Tm ( C) CHS1 RLM-RACE CAAATAGGGCTTGACCCAC 57 GACCGCAGTTATCTCAGAGC 58 qrt-pcr GTGATTGTGTTATGGGTTGGC 58 GCAAAGAACATGTTATTTTCC CHS3 RLM-RACE GTCTGACCCAATAATAATGG 56 CGGGCACCTTTGTTGTTCT 59 qrt-pcr CAGCCACCACCCTAAACAT 61 AACTCCACCTTATGCTCGC CHI RLM-RACE CTGGCATGCCTTCCTTG 58 CATCATTGCCGAGAAACAGT 58 qrt-pcr TCTCTCTCCTAAACTCTCATC 61 CATTTGTGGCTCTTCATCAG F3H RLM-RACE GAATCCACCTTTCTTCCCG 59.5 ATGCCTCCACAATCTTCCG 60 qrt-pcr CGGGAAGAAAGGTGGATTC 61 TAGGTCTCCGTTACAGCCCT DFR RLM-RACE GCTGCTTTCTCTGCCAATG 60 AACGGGTTGTTGGTGTTCC 60 qrt-pcr GGAAGGCGGATTTGAATG 58 CACCAGCCTCTTCACTGTCT LAR RLM-RACE TGCTTTGACACTGCCATCAC 61 TCCGATGGGTGAGTATTGTC 58 qrt-pcr GCTACCAAGACCCTCTCAAT 59 AAGTCAGTGTGGGCTTCAA ANR1 RLM-RACE GGGAGATGGAGATTGAGCC 59 TGAGAGTTGGGATGACAGT 56 qrt-pcr TTGTGGCAGAGAAAGAATCG 60 CCCATACTTGAAACTGAATCC ANR2 RLM-RACE TGATTCTTTCTCCGCCAC 57 CACCACAAACATCCTCTACG 57 RLM-RACE GCGTTAGTGCCTTCAGTTCT 57 ACTTGGCTTTGGACGGC 59 qrt-pcr CAACAACAACCAAACCGATG 60 CATCAGTTAGGTCTGCTCGG 1) CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F35H, flavonoid 3, 5 -hydroxylase; DFR, dihydroflavonol 4-reductase; LAR, leucoanthocyanidin reductase; ANS, anthocyanidin synthase; ANR, anthocyanidin reductase. 2) RLM-RACE: RNA ligase-mediated rapid amplification of cdna ends; qrt-pcr: quantitative real-time PCR. revealed free energies for folding of 9.4 to 80.0 kcal mol 1. This wide range of values may have been due to the great difference in lengths of the mirna precursors. After their alignment with precursor sequences of other plant species from mibase, we found that mirna precursor lengths and stem-loop structures varied among plant species, whereas the locations of mature mirnas and base complementary sequences of mirna precursors were conserved Expression analysis of identified mirnas by qrt-pcr We used qrt-pcr to confirm the existence of mirnas predicted by the bioinformatics approach in tea strain 1005, thereby verifying the reliability of this method. In addition, we uncovered five expression patterns among the 31 mir- NAs analyzed in the qrt-pcr assay (Fig. 1). First, eight mirnas displayed expression levels that were negatively correlated with tea leaf maturity; in particular, mir1533, mir1863a, mir865-3p, mir399a, mir156g-3p, mir477c, mir5638a, and mir5641 all had higher expression levels in the first leaves compared to the third leaves, but low or even no expression in old leaves. Second, expression levels of another 18 mirnas (mir156h, mir1863b, mir529-5p, mir164b-3p, mir535, mir5559-5p, mir5021a, mir529d, mir156i, mir2868, mir5240, mir3437-3p, mir5264, mir5180b, mir5385, mir6191, mir6462a, and mir1109) were not obviously correlated with tea leaf maturity. The third leaves generally exhibited the highest expression, followed by the first ones, with old leaves having only low or even no expression. mir529d, mirna1863b, mirna5021a and mir1109 were exceptions, however, exhibiting similar levels in both first and old leaves. The third expression pattern was exactly contrary to the first one, with low expression levels observed in young leaves that increased with leaf maturation. This expression pattern was only detected for mir3513-3p. Fourth, mir5998a, mir7814, and mir6261 had the same expression pattern: high expression in first and third tea leaves, but low or even no expressions in old ones. Finally, the expression of mir7539 was steady across all leaf ages, which indicated that mir7539 might play an important role in growth of tea leaves. We hypothesized that mir7539 could be analyzed as a potential reference gene to analyze the quantitative expressions of mirnas in tea Prediction of mirna target genes Using the mirnas identified in this study and transcriptome sequences of tea strain 1005, we applied PsTarget software to predict target genes according to other studies (Zhang et al. 2006c). To annotate these targets, we further aligned them to the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) databases. After screening out unannotated and repeated sequences, we obtained target genes that can be regulated by mirnas (Appendix C). The identified targets were found to be involved in multiple processes, such as plant growth and development and primary and secondary metabolism. According to the results of the KEGG analysis, we artificially divided these targets into three classes. The first class included genes for transcriptional regulatory factors involved in plant growth and development. Members of the second class encoded functional proteins related to: starch; sucrose; amino acids; various metabolic processes such as glycolysis, photosynthesis, the citric acid cycle, oxidative phosphorylation, purine

6 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): Fig. 1 Expression of micrornas (mirnas) of tea leaves with different levels of maturity. CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F35H, flavonoid 3, 5 -hydroxylase; DFR, dihydroflavonol 4-reductase; LAR, leucoanthocyanidin reductase; ANS, anthocyanidin synthase; ANR, anthocyanidin reductase. The L1, L3 and L indicated the first, the third and the old leaves in tea 1005 strain. and nitrogen metabolism; and carotenoid biosynthesis and ubiquitin-mediated protein degradation. The third class is comprised of targets involved in biological regulation and interaction with pathogens Prediction and identification of mirnas involved in regulating catechin biosynthesis-related genes Catechin, one of the main secondary metabolites in tea plants, is a polyphenol. In tea, both the phenylpropanoid and flavonoid pathways participate in catechin biosynthesis in a manner similar to the anthocyanin biosynthetic pathway operating in plant species such as V. vinifera (Wang et al. 2009). In particular, non-galloylated catechins are first produced in the phenylpropanoid and flavonoid pathways and are then converted to ester catechins. To date, multiple key genes have been identified that are related to the phenylpropanoid and flavonoid pathways. To understand the regulatory roles of mirnas in catechin biosynthesis, we used the identified mirnas as probes to predict catechin synthesis-related genes that can act as targets, and thereby identified 11 potential targets. To confirm the predicted results, we next used RLM- RACE to detect the cleavage sites of these targets, and thereby confirmed seven targets (Fig. 2). CHS1 (D ) and CHS3 (D ), which belong to the same family and have highly similar coding regions, were identically cleaved by ptc-mir7814. This finding indicates that a single mirna can target different members of one family at similar or identical cleavage sites. In addition, we found that ANR1 and ANR2 can be cleaved by mtr-mir5559-5p at different sites; however, ANR2 can also be regulated by mtr-mir5264 at multiple cleavage sites, which indicates that a single target gene can be regulated by different mirnas at various sites. Furthermore, as shown in Fig. 3, CHI and F3H can be targeted by ppt-mir529d and mir156g-3p at one site each, respectively, while LAR can be cleaved by osa-mir2868 at two sites. We also observed multiple cleavage sites in a single transcript, and noted that some other sites might be inconsistent with predicted ones. This

7 8 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): The expression patterns of these elements, which included mir529d and its target gene CHI, and mir2868 and its target gene LAR, indicated that the targets involved in catechin synthesis were downregulated by the corresponding mirnas. We also found that the expression of some mirnas was negatively related to targets only in certain leaves; for example, expression levels of mir156g-3p were negatively correlated with its target F3H in first and third leaves, whereas both had low expression levels in old leaves. Similarly, mir5240 and its target gene DFR were negatively correlated in all tested leaves except for old ones, where both were not expressed. In addition, expression patterns of some mirnas and their targets were similar in different leaves or under various treatments. For example, mir7814 was expressed similarly in the first and the third leaves, but showed no expression in old leaves. The targets of mir7814, including CHS1 and CHS3, had similar expression patterns, but neither target was negatively correlated with mir7814 in terms of expression levels. Furthermore, the expression pattern of mir5559-5p, which cleaved both ANR1 and ANR2, did not have an opposite trend compared to its targets; the same was true for mir5246, which targeted ANR2 as well. 4. Discussion Fig. 2 The cleavage sites of target genes by RNA ligasemediated rapid amplification of cdna ends (RLM-RACE). CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F35H, flavonoid 3, 5 -hydroxylase; DFR, dihydroflavonol 4-reductase; LAR, leucoanthocyanidin reductase; ANS, anthocyanidin synthase; ANR, anthocyanidin reductase. The boxes indicate the cleavage sites; the numbers indicate the fraction of cloned PCR products terminating at different positions. latter situation may have arisen due to universal cleavage of mrnas by mirnas (Kasschau et al. 2003) due to small RNA interference (Elbashir et al. 2001). Alternatively, these genes may be regulated simultaneously by some unknown mirnas or sirnas. These data reveal the complexity of post-transcriptional regulation of genes and indicate that additional efforts are required to explore mirnas in tea plants Expression analysis of mirnas and their targets in tea leaves To further understand the regulatory roles of the aforementioned mirnas in target gene expression and catechin synthesis, we used qrt-pcr to monitor the expression of mirnas and their targets in tea leaves of different ages. The results of this analysis are shown in Fig. 3. The expression of some mirnas and their targets were negatively related in tested tea leaves of different ages Bioinformatics-based prediction of mirnas Much evidence currently exists that mirnas play essential regulatory roles in many aspects of plant growth and development, including nutrition and secondary metabolism, organelle morphogenesis, and response to environmental stresses. At present, the main approaches used to isolate and identify mirnas from plants are direct cloning, Northern blotting, in situ hybridization, microarray analysis, high-throughput sequencing, and bioinformatics-based prediction. The latter strategy was the main approach used in this study to identify mirnas from tea strain Bioinformatics prediction of novel mirnas is performed computationally based on the conservation of known mirnas and secondary structural features of plant mirna precursors, including minimum folding free energy index (MFEI) and mismatches between mirnas and base complementary sequences of mirna precursors (Zhang et al. 2007). This approach has been widely used to identify novel mirnas in many plant species, such as V. vinifera (Song et al. 2010b), Gossypium spp. (Qiu et al. 2007), B. campestris (Xie et al. 2007), Z. mays (Zhang et al. 2006b), and Coffea arabica (Devi et al. 2016). Furthermore, mirnas predicted by the bioinformatics approach have been subsequently confirmed by qrt-pcr, high-throughput sequencing, and various other methods (Xie et al. 2007; Song et al. 2010a).

8 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): CHS1 CHS1 mir CHS3 CHS3 mir CHI DFR CHI mir529d DFR mir LAR 2 F3H LAR mir F3H mir156g-3p 1 0 ANR1 ANR1 mir5559-5p 1 0 ANR2 ANR2 mir5559-5p mir5264 Fig. 3 Analysis of expression of microrna (mirna) and target gene in different tea leaves. CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F35H, flavonoid 3, 5 -hydroxylase; DFR, dihydroflavonol 4-reductase; LAR, leucoanthocyanidin reductase; ANS, anthocyanidin synthase; ANR, anthocyanidin reductase. The X axis indicated different tea leaves; and the L1, L3 and L indicated the first, the third and the old leaves in tea 1005 strain. And the errors bars indicated SD. The bioinformatics method has been used to identify novel mirnas in tea (Prabu and Mandal 2010); for example, 13 conserved mirnas in nine families were detected from a tea expressed sequence tag database (Das 2010). In this study, we identified 55 conserved mirnas based on known mirnas and using a transcriptome database of tea strain We used qrt-pcr to confirm this result and found 25 mirnas expressed in tea leaves of different ages. The possible reason for this discrepancy may be that some mirnas were low-copy or were weakly expressed; however, some mirnas could not be detected by qrt-pcr. Another possible reason is lack of primer specificity due to the unavailability of exact sequences of mirnas predicted by the bioinformatics method, which may have hindered

9 10 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): detection as well. The rest of the mirnas could be verified by cloning or sequencing in future experiments The important roles of mirnas in catechin biosynthesis The health benefits of catechin, the main polyphenol and secondary metabolite in tea, include antioxidant, anti-diabetes, anti-cardiovascular disease, and even anticancer activities (Giménez 2006; Wang et al. 2012). To further understand the function of mirnas in regulating catechin biosynthesis, we used RLM-RACE to identify eight mirnas targeting seven genes involved in catechin synthesis. Our findings demonstrate that these mirnas play negative regulatory roles during catechin synthesis by cleaving target genes. CHS is a rate-limiting enzyme in flavonoid and isoflavone synthesis. Tea plants possess four CHS genes, three of which, CHS1, CHS2, and CHS3, are homologous (Takeuchi et al. 1994). Our RLM-RACE experiments confirmed that CHS1 and CHS3 are simultaneously cleaved by mir7814. Other researchers (Zhang et al. 2014) have reported that CHS1 and CHS3 are structurally conserved and that no intron is present in the CHS2 DNA sequence. We thus speculate that the factors transcriptionally regulating CHS2 are different from those controlling CHS1 and CHS3. In addition, we experimentally verified that mir529d can cleave the target gene CHI because the expression of mir529d and the CHI gene in tea leaves of different ages showed opposite trends, further confirming that mir529d is a negative regulatory factor of the CHI gene. F3H is a key enzyme in the catechin biosynthesis pathway (Punyasiri et al. 2004). A previous study has revealed that expression of the F3H gene is down-regulated under abscisic acid treatment (Singh et al. 2008). Moreover, enzyme activities of F3H and DFR are improved after pre-harvest spraying with thidiazuron, a cytokinin activator (Moalembeno et al. 1997). DFR, a key enzyme of the catechin biosynthesis pathway, catalyzes the production of the common precursor of catechin, anthocyanin, and procyanidine synthesis pathways (Xia and Gao 2009). Little evidence exists, however, that DFR expression can be controlled by mirnas. One of the few pieces of such evidence is that DFR can be regulated by mir156 through SQUAMOSA promoter-binding protein-like (SPL) transcription factors in Arabidopsis (Cui et al. 2014). Given the fact that DFR can also be cleaved by mir156 in tea, mir156 has been predicted to affect the catechin content of tea plants through its regulatory role in DFR expression (Fan et al. 2015). In addition to DFR, LAR is an important enzyme in catechin biosynthesis (Ma 2007), and both of these enzymes are thought to influence catechin content. Our data revealed that LAR is negatively regulated by mir2868 at the post-transcriptional level because they had reverse expression trends; even though DFR could be cleaved by mir5240, their expression patterns did not show clear correlations. ANR, a multigene family, converts anthocyanin into epicatechin and epigallocatechin. Although ANR genes are widespread in plants, the regulation of their expression has not been well studied. Previous investigations have demonstrated that ANR is regulated by the fifth subgroup of R2R3-MYB and that transgenesis of CsMYB5-2 into Nicotiana benthamiana can significantly promote ANR expression in flowers of the resulting transgenic plants(zhao 2013). To date, only two ANR genes, ANR1 and ANR2, have been identified in tea. We found that both genes are controlled by mir5559-5p, with ANR2 also regulated simultaneously by mir Conclusion In total, we computationally identified 92 conserved mirnas in tea strain 1005 and verified presence of 31 mirnas with a qrt-pcr assay. We also identified seven mirnas (mir7814, mir529d, mir5240, mir5559-5p, mir5264, mir156g-3p, and mir2868) cleaving eight catechin synthesis pathway-related genes, including CHS, CHI, DFR, ANR, LAR, and F3H through RLM-RACE and qrt-pcr experiments using tea leaves of varying ages. Our data suggest that these mirnas negatively regulate catechin synthesis by cleaving target genes involved in the catechin biosynthesis pathway. Acknowledgements This work was funded by the National Natural Science Foundation of China ( ), the Project of National Agriculture Ministry, China (KCa16022A) and the Major Science and Technology Project in Fujian Province, China (2015NZ ). Appendix associated with this paper can be available on References Akter A, Islam M M, Mondal S I, Mahmud Z, Jewel N A, Ferdous S, Amin M R, Rahman M M Computational identification of mirna and targets from expressed sequence tags of coffee (Coffea arabica). Saudi Journal of Biological Sciences, 21, Bartel D P, Micrornas: Genomics, biogenesis, mechanism, and function. Cell, 116, Cheng X Q, Fu L X, Yi Y Z, Kai G, Si Q H, Li N, Zhi M Y Computational identification of micrornas and their targets

10 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): in gossypium hirsutum expressed sequence tags. Gene, 395, 49. Cui L G, Shan J X, Shi M, Gao J P, Lin H X The mir156- spl9-dfr pathway coordinates the relationship between development and abiotic stress tolerance in plants. Plant Journal for Cell & Molecular Biology, 80, Das A Computational identification of conserved micrornas and their targets in tea (Camellia sinensis). American Journal of Plant Sciences, 1, Devi K J, Chakraborty S, Deb B, Rajwanshi R Computational identification and functional annotation of micrornas and their targets from expressed sequence tags (ests) and genome survey sequences (gsss) of coffee (Coffea arabica). Plant Gene, 6, Ding Y, Zhu C, Wang S, Liu H Regulation of mirnas response to heavy metal stress in plant. Process in Biochemistry and Biophysics, 38, Elbashir S M, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T Duplexes of 21-nucleotide RNAs mediate RNA interference in mammalian cell culture. Nature, 411, Fan K, Fan D, Ding Z, Su Y, Wang X Cs-mir156 is involved in the nitrogen form regulation of catechins accumulation in tea plant (Camellia sinensis). Plant Physiology & Biochemistry, 97, Giménez R Beneficial effects of green tea--a review. Journal of the American College of Nutrition, 25, Hong G, Wang J, Zhang Y, Hochstetter D, Zhang S, Pan Y, Shi Y, Xu P, Wang Y Biosynthesis of catechin components is differentially regulated indark-treated tea (Camellia sinensis). Plant Physiology & Biochemistry, 78, Jeyaraj A, Chandran V, Gajjeraman P Differential expression of micrornas in dormant bud of tea (Camellia sinensis (L.) O. Kuntze). Plant Cell Reports, 33, Kasschau K D, Xie Z, Allen E, Llave C, Chapman E J, Krizan K A, Carrington J C P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and mirna function. Developmental Cell, 4, 205. Lim L P, Bartel D P Vertebrate microrna genes. Science, 299, 501. Lin J, Zheng J, Chen R, Chen C Screening specific tea plant germplasm resources (Camellia sinensis) with high egcg content. Acta Agronomica Sinica, 31, Lin Y Studies on cloning,expression and regulation of sod gene family during somatic embryogenesis in dimocarpus longan. Ph D thesis, Fujian Agriculture and Forestry University, Fuzhou. (in Chinese) Lin Y S, Tsai Y J, Tsay J S, Lin J K Factors affecting the levels of tea polyphenols and caffeine in tea leaves. Journal of Agricultural & Food Chemistry, 51, Ma C Molecular cloning and expression analysis of chalcone isomerase, flavonol synthase and leucoanthocyantin reducase genes of teaplant (Camellia sinensis). Msc thesis, Chinese Academy of Agricultural Sciences, China. (in Chinese) Meilian S, Yunsheng W, Dongqing Y, Chaoling W, liping G, Tao X, Yu S, Yang L Selection of reference genes in real-time quantitative pcr in tea plant. Chinese Bulletin of Botany, 45, Millar A A, Waterhouse P M Plant and animal micrornas: Similarities and differences. Functional & Integrative Genomics, 5, Moalembeno D, Tamari G, Leitnerdagan Y, Borochov A, Weiss D, Sugar-dependent gibberellin-induced chalcone synthase gene expression in petunia corollas. Plant Physiology, 113, Mondal T K, Bhattacharya A, Laxmikumaran M, Ahuja P S Recent advances of tea (Camellia sinensis) biotechnology. Plant Cell Tissue & Organ Culture, 76, Pang Y, Dixon R A Early steps in proanthocyanidin biosynthesis in the model legume medicago truncatula. Plant Physiology, 145, Prabu G R, Mandal A K A Computational identification of mirnas and their target genes from expressed sequence tags of tea (Camellia sinensis). Genomics, Proteomics & Bioinformatics, 08, Punyasiri P A, Abeysinghe I S, Kumar V, Treutter D, Duy D, Gosch C, Martens S, Forkmann G, Fischer T C Flavonoid biosynthesis in the tea plant camellia sinensis: Properties of enzymes of the prominent epicatechin and catechin pathways. Archives of Biochemistry & Biophysics, 431, Puzey J R, Kramer E M Identification of conserved aquilegia coerulea micrornas and their targets. Gene, 448, Qiu C X, Xie F L, Zhu Y Y, Guo K, Huang S Q, Nie L, Yang Z M Computational identification of micrornas and their targets in gossypium hirsutum expressed sequence tags. Comparative & Functional Genomics, 395, Ravaglia D, Espley R V, Henry-Kirk R A, Andreotti C, Ziosi V, Hellens R P, Costa G, Allan A C Transcriptional regulation of flavonoid biosynthesis in nectarine (Prunus persica) by a set of R2R3 MYB transcription factors. BMC Plant Biology, 13, 53. Rhoades M W, Reinhart B J, Lim L P, Burge C B, Bartel B, Bartel D P Prediction of plant microrna targets. Cell, 110, Singh K, Rani A, Kumar S, Sood P, Mahajan M, Yadav S K, Singh B, Ahuja P S An early gene of the flavonoid pathway, flavanone 3-hydroxylase, exhibits a positive relationship with the concentration of catechins in tea Camellia Sinensis, 28, Song C, Fang J, Chen W, Lei G, Nicholas K K, Ma Z. 2010a. Mir-race, a new efficient approach to determine the precise sequences of computationally identified trifoliate orange (Poncirus trifoliata) micrornas. PLoS ONE, 5, e Song C, Jia Q, Fang J, Li F, Wang C, Zhang Z. 2010b. Computational identification of citrus micrornas and target analysis in citrus expressed sequence tags. Plant Biology, 12, Takeuchi A, Matsumoto S, Hayatsu M, Chalcone

11 12 SUN Ping et al. Journal of Integrative Agriculture 2017, 16(0): synthase from camellia sinensis: Isolation of the cdnas and the organ-specific and sugar-responsive expression of the genes. Plant & Cell Physiology, 35, Taylor L P, Grotewold E Flavonoids as developmental regulators. Current Opinion in Plant Biology, 8, Wang C, Fang J, Cao X, Yang G Metabolism of proanthocyanidins in gape. Chinese Agricultural Science Bulletin, 25, Wang D, Will T E, Wang Y, Wan X, Zhang J Encapsulated nanoepigallocatechin-3-gallate and elemental selenium nanoparticles as paradigms for nanochemoprevention. International Journal of Nanomedicine, 7, Wang L, Fan Y Process of microrna in plant. Journal of Agricultral Science and Technology, 9, Wang R, Zhou W, Jiang X Reaction kinetics of degradation and epimerization of epigallocatechin gallate (egcg) in aqueous system over a wide temperature range. Journal of Agricultural & Food Chemistry, 56, Xia T, Gao L Advances in biosynthesis pathways and regulation of flavonoids and catechins Scientia Agricultura Sinica, 42, Xie F L, Huang S Q, Guo K, Xiang A L, Zhu Y Y, Nie L, Yang Z M Computational identification of novel micrornas and targets in brassica napus. Febs Letters, 581, Xu Z, Xie C X Advances on plant microrna and stresses response. Hereditas, 32, Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu J K, Sun Q Cloning and characterization of micrornas from wheat (Triticum aestivum). Genome Biology, 8, R96. Yue M C, Tsao T M, Cheng C L, Lin K C, Ming K W Aluminium and nutrients induce changes in the profiles of phenolic substances in tea plants (Camellia sinensis). Journal of the Science of Food & Agriculture, 91, Zhang B, Pan X, Anderson T A. 2006a. Identification of 188 conserved maize micrornas and their targets. Febs Letters, 580, Zhang B, Pan X, Cannon C H, Cobb G P, Anderson T A. 2006b. Conservation and divergence of plant microrna genes. Plant Journal, 46, Zhang B, Wang Q, Wang K, Pan X, Liu F, Guo T, Cobb G P, Anderson T A Identification of cotton micrornas and their targets. Gene, 397, Zhang L Q, Wei K, Wang L Y, Cheng H, Liu B Y, Gong W Y The structure and single nucleotide polymorphism analysis of chalcone synthase genes in tea plant (Camellia sinenesis). Scientia Agricultura Sinica 47, Zhang W, Liang Y, Zhang F, CHeng C, Zhang Y, Cheng R, Weng B Effects on the yield and quality of oolong tea by covering with shading net. Journal of Tea Science, 24, (in Chinese) Zhang W, Luo Y, Li S. 2006c. Microrna and its role in plant growth and development. Plant Physiology Communications, 42, Zhao L Transcription factors analysis in flavonoid biosynthesis pathway and gene function of aivr in tea plant (Camellia sinensis). Ph D thesis, Anhui Agricultural University, China. (in Chinese) Zheng X Q, Jin J, Chen H, Du Y Y, Ye J H, Lu J L, Lin C, Dong J J, Sun Q Y, Wu L Y, Liang Y R Effect of ultraviolet b irradiation on accumulation of catechins in tea (Camellia sinensis). African Journal of Biotechnology, 7, (Managing editor SHI Hong-liang)