SUPPLEMENTARY DATA Therapeutic targeting malignant mesothelioma with a novel 6-substituted pyrrolo[2,3- d

Size: px

Start display at page:

Download "SUPPLEMENTARY DATA Therapeutic targeting malignant mesothelioma with a novel 6-substituted pyrrolo[2,3- d"

Brianna Richardson
6 years ago
Views:

1 SUPPLEMENTARY DATA Therapeutic targeting malignant mesothelioma with a novel 6-substituted pyrrolo[2,3-d]pyrimidine thienoyl antifolate via its selective uptake by the proton-coupled folate transporter Christina Cherian, Sita Kugel Desmoulin, Lei Wang, Lisa Polin, Kathryn White, Juiwanna Kushner, Mark Stout, Zhanjun Hou, Aleem Gangjee, and Larry H. Matherly Graduate Program in Cancer Biology, Wayne State University School of Medicine, Detroit, MI 48 (SKD, LHM) Department of Oncology, Wayne State University School of Medicine, Detroit, MI 48 (CC, SKD, LP, KW, JK, ZH, LHM) Molecular Therapeutics Program, Barbara Ann Karmanos Cancer Institute, Detroit, MI 48 (CC, LP, ZH, LHM) Department of Pharmacology, Wayne State University School of Medicine, Detroit, MI 48 (LHM) Department of Pediatrics, Children s Hospital of Michigan, Detroit, MI 48(MS) Division of Medicinal Chemistry, Graduate School of Pharmaceutical Science, Duquesne University, Pittsburgh, PA (LW, AG) 1

2 Table 1S. RT-PCR primers. Gene Primer Sequences Size (bp) hpcft hrfc GAPDH Upper: 5 -CCTCCGGCATCTTCAACTCACTCTA -3 Lower: 5 -CTCTGGGGAAACTGCTGGAACTC -3 Upper: 5 -GTGGAGAAGCAGGTGCCCGTGGAA -3 Lower: 5 -GGCAAAGAACGTGTTGACC -3 Upper: 5 AACGGGAAGCTTGTCATCAATGGAAA -3 Lower: 5 -CGTGACCTGCTCCCGCGTGAAGTT-3 Annealing ( C) GenBank Accession NM_ U NM_6 Percent Growth Compound 2 No Additions Adenosine (6 µm) Thymidine (1 µm) AICA (32 µm) Concentration (nm) Figure 1S. Protection of R1-11-PCFT cells from growth inhibition by the 6- substituted pyrrolo[2,3-d] pyrimidine thienoyl antifolate 2 in the presence of nucleosides and AICA. Inhibition of cell proliferation was measured for R1-11- PCFT4 HeLa cells over a range of concentrations of compound 2, in the presence or absence of adenosine (6 µm), thymidine (1 µm), or AICA (32 µm). Results were normalized to cell density in the absence of drug. Results are shown for mean values (+/- standard errors) from triplicate experiments. 2

3 Table 2S: Treatment of early stage human mesothelioma H2542 with Compound 2 in SCID Mice Diet Agent Total dose No treatment (mg/kg) Cisplatin 11.2 Pmx (Alimta) 28.8 No treatment Cisplatin 11.2 Pmx (Alimta) 28.8 Median tumor mass in mg (range) on day 115 ( ) (all zeroes) 163 (126 5) 576 ( ) 176 (663-11) 1374 ( ) 176 (82 114) 4 (151 36) 8 (812 19) 1347 ( ) T/C (%) Median time for tumors to reach 1g (range in days) ( 26) 43 (39 44) 34 (32 34) 27 ( 41) (22-28) (2 ) ( 25) 34 (32 36) 28 ( 28) (19-) Tumor growth delay in days (T-C) Gross Log 1 cell Kill Activity Rating /- Treatments were administered on a Q4dx4 schedule IV starting on day 2. Statistical analyses were performed for differences in T/C, T-C and log 1 kills for mice on the folate-deficient diets treated with compound 2 versus gemcitabine, cisplatin, or Pmx relative to the median control values. The differences between compound 2 and cisplatin or Pmx were statistically significant (p<.5 and p<.1, respectively, for all 3 parameters), whereas the difference between compound 2 and gemcitabine was not statistically significant (p>.5). For comparison of antitumor activities with standard agents and of activities between tumors, log 1 kill values were converted to an arbitrary activity rating (Corbett et al., 1998). For duration of treatment between 5-2 days: >2.8 log 1 kill (highly active ++++); (+++); (++); (+); and <.7 (inactive; ).

4 Table 3S: Treatment of advanced stage human mesothelioma H2542 with Compound 2 in SCID Mice Diet Agent Total dose T/C PR CR Cures (mg/kg) Median tumor mass in mg (range) on day (%) Median time for tumors to reach 1g (range in days) Tumor growth delay in days (T-C) Gross Log 1 cell Kill Activity Rating No Treatment 186 ( ) /5 /5 /5 (22 3) 75 ( - 138) 7 4/5 1/5 /5 45 (4 53) ( 75) 5/5 1/5 /5 4 (39 47) No Treatment 192 (115155) /4 /4 /4 (2 ) 132 (111354) >1 /3 /3 /3 ( ) none 63 ( 15) 17 3/4 1/4 / (37 41) Treatments were administered on a Q4dx4 schedule IV starting on day 1 when tumors were >25mg in size. Statistical analyses were performed for the differences in T/C, T-C and log 1 kills for mice on the folate-deficient diets treated with compound 2 versus gemcitabine relative to the median control values. For T/C, the difference was not significant (p=.25), whereas the differences in T- C and log 1 kills approached but did not quite achieve statistical significance (both gave p=.625). For comparison of antitumor activities with standard agents and comparisons of activities between tumors, the log 1 kill values were converted to an arbitrary activity rating (Corbett et al., 1998). For duration of treatment between 5-2 days: >2.8 log 1 kill (highly active ++++); (+++); (++); (+); and <.7 (inactive; ). A partial remission (PR) is defined as a tumor that regressed 5% or more during treatment; a complete remission (CR) is a tumor that regressed to zero (not palpable). For these studies, a CR is also by definition counted as a PR. It should be noted that an activity rating of +++ to ++++ is needed to effect PRs and CRs of 1 to 3 mg size tumors so an activity rating of + or ++ (less than 2 logs of cell kill) would not be considered efficacious by the usual clinical criteria (Corbett et al., 1998). 4

5 Reference Corbett TH, LoRusso P, Demchick L, Simpson C, Pugh S, White K, Kushner J, Polin L, Meyer J, Czarnecki J, Heilbrun L, Horwitz JP, Gross JL, Behrens CH, Harrison BA, McRipley RJ, Trainor G (1998). Preclinical antitumor efficacy of analogs of XK-469:Sodium-(2-[4-(7-chloro-2-quinoxalinyl oxy)phenoxy]propionate. Invest New Drugs 16:

MOLECULAR PHARMACOLOGY SUPPLEMENT

MOLECULAR PHARMACOLOGY SUPPLEMENT Therapeutic targeting of a novel 6-substituted pyrrolo[2,3-d]pyrimidine thienoyl antifolate to human solid tumors based on selective uptake by the proton-coupled folate