Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis

Size: px
Start display at page:

Download "Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis"

Transcription

1 Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al.

2 .. Supplementary Figure 1 % of initial body weight H + H days after CD4 T cell transfer % weight change after treatment H + H days post anti-cd4 treatment C Histopathological score H + H naïve active disease anti-cd4

3 .. Supplementary Figure 2 colon homogenates pg/g tissue pg/g tissue TNFα IL6 d28 post infection perm. colonization IFNγ d28 post infection perm. colonization IL17 IL1α Cxcl9 G-CSF TNFα IFNγ IL17 1 d28 post infection perm. colonization d28 post infection perm. colonization pg/ml serum 6 IL6 2 IL1α Cxcl9 G-CSF 4 5 pg/ml d post infection 7d post infection 28d post infection perm.colonization 1d post infection 7d post infection 28d post infection perm.colonization 1d post infection 7d post infection 28d post infection perm.colonization 1d post infection 7d post infection 28d post infection perm.colonization C H Helicobacter typhlonius infection day1 day7 day28 + permanent H colonization

4 Supplementary Figure 3 12 % of initial body weight anti-cd4 Histopathological Score C TCRαβ 1.4 active disease active disease d11 p.d. d29 p.d..5 d11 p.d. d29 p.d. CD4 Ki67

5 . Supplementary Figure 4 Helicobacter + Helicobacter active disease active disease 11d p.d. 11d p.d. Ifng Il1a Il1b Il6 Trem1 Lcn2 Il33 Tnfa Il17a Il17e Il17f Il23p19 Il12a Il12b Il18 Il5 Il7 Il1 Il22 Il22ra Tgfb1 Tgfb3 Trem2 Ccl2 Ccl3 Cxcl1 Cxcl1 Cxcl2 Ccl2 Cxcl13 Reg3b Reg3g S1a9 Ptprc Ptx Tnfsf11 Mylk Pro inflammatory nti inflammatory Chemokines IEC related response fold induction Others pg/g tissue TNFα IFNγ IL17 IL6 IL1α ns naive H + anti-cd4 H + active disease H anti-cd4 H ns 3 ns 25 ns 3 ns naive H + anti-cd4 H + active disease H anti-cd4 H 2 1 naive H + anti-cd4 H + active disease H anti-cd4 H naive H + anti-cd4 H + active disease H anti-cd4 H 2 1 naive H + anti-cd4 H + active disease H anti-cd4 H

6

7 . Supplementary Figure 6 % of initial body weight isotype control anti-cd4l Histopathological score days anti-cd4l naive isotype control anti-cd4l

8 .. Supplementary Figure 7 Thy1.2 + isotype control Thy1.2 DN anti-thy1.2 Thy1.1 DN 6 Thy1.1 CD4 CD25 C % weight change after treatment Thy1.2 anti-cd4 Thy1.1 anti-thy days post treatment D Histopathological score isotype control Thy1.1 anti-thy1.2 isotype control Thy1.2 anti-cd4

9 Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. Figure Legends Supplementary Figure 1: Disease kinetics of T cell transfer colitis in Helicobacter typhlonius positive (H + ) and Helicobacter typhlonius negative (H ) lymphopenic mice. () Percent body weight loss. () Percent body weight change in H + and H - mice with active disease treated with anti-cd4 antibodies (C) Colonic histopathology scores of H. typhlonius positive and H. typhlonius negative Rag -/- mice transferred with colitogenic CD4 + CD45R hi T cells during active disease (active disease) or 11 days post depletion of colitogenic CD4 T cells (anti-cd4). Supplementary Figure 2: Infection of lymphopenic mice with Helicobacter typhlonius does not promote local and systemic immune responses. () Protein expression levels of pro-inflammatory cytokines, Cxcl9, G-CSF and GM-CSF in colonic tissue homogenates or () serum of naïve Helicobacter-free mice (H - ), mice infected with H. typhlonius by oral gavage of 5x1 8 live bacteria at different time points (d1, d7, d28), naïve mice permanently colonized with H. typhlonius or H. typhlonius-colonized mice (H + ) with active colitis. (C) Presence of H. typhlonius in fecal pellets as assessed by PCR in the different groups. Supplementary Figure 3: Relapsing-remitting colitis. Helicobacter typhlonius positive Rag -/- mice were transferred with colitogenic CD4 T cells and subsequently depleted of CD4 T cells during active colitis on days 1, 13 and 16 post transfer. Long-term remission was monitored until day 3 post first anti-cd4 treatment (i.e. day 4 post transfer). () Weight loss. () Histopathological score of mice with active disease, 11 days post CD4 T cell depletion (p.d.) or during relapse phase on day 29 p.d. (=day 39 post T cell transfer) (C) Representative FCS plots illustrating CD4 T cell frequencies of CD45 + cells and Ki67 expression of CD4 T cells in the peripheral blood of mice with active disease, 11 days p.d. or during relapse phase on day 29 p.d.. Data shown are representative for 2 independent experiments with n=4. Supplementary Figure 4: Comparison of colonic gene expression profiles in Helicobacter typhlonius positive and Helicobacter typhlonius negative mice with active disease or in remission from colitis. () Heat-map of colonic gene expression profiles of H. typhlonius positive (H + ) and H. typhlonius negative (H + ) Rag -/- mice with active colitis and 11 days post anti-cd4 depletion (p.d). RN values were normalized to the endogenous control genes Gapdh and β2-microglobulin and presented as fold induction/reduction over CD4 + CD45R lo T cell transferred and subsequently anti- CD4 treated controls. () ead-based multiplex assay for protein levels of TNFα, IFNγ, IL17, IL6 and IL1α in colon homogenates. Data with n=4-6 mice per group are shown. ns: not significant.

10 Supplementary Figure 5: Increased proliferation rate of colonic epithelial cells in response to mucosal healing. Immunohistochemistry for Ki67 on paraffin embedded tissue sections from colonic tissue of mice with active disease or upon induction of remission from colitis (days 1, 3, 5 and 11 post anti-cd4 depletion (p.d.)). Photographs are representative for n=3 mice per group. Scale bar: 1µm. Supplementary Figure 6: locking CD4L-CD4 interactions in mice with established disease does not promote remission from colitis: H. typhlonius positive (H + ) Rag -/- mice with active colitis ( 1-15% weight loss associated with clinical signs of colitis) were either treated with an isotype control antibody or anti-cd4l at days 13 and 14 and clinical and histopathological parameters of colitis were assessed. () Percent body weight loss. () Colonic histopathological scores of naïve, isotype control- and anti-cd4l-treated mice. Data are representative of 2 independent experiments with n=3-5 mice per treatment group. Supplementary Figure 7: Colitogenic CD4 T cells are critical for maintenance of disease in the preserved presence of CD4+ innate lymphoid cells. Thy1.1 H + Rag -/- mice were transferred with colitogenic Thy1.2 CD4 + CD45R hi T cells to induce active colitis. Selective depletion of CD4 T cells to induce remission from colitis was achieved by anti-thy1.2 antibody treatment. Representative FCS plots of Thy1.1- and Thy1.2 positive cells in the mesenteric lymph nodes of () isotype control treated or () anti-thy1.2 treated mice. CD4 surface expression of transferred colitogenic T cells (green) or resident Thy1.1 innate lymphoid cells (blue) that co-express CD25 are shown. DN: double negative cells. Cells were gated as singlet, live, lineage- (CD11c, Ly6G, CD19) and autofluorescence negative cells. (C) Percent body weight change in mice with active disease treated with anti-thy1.2 or anti CD4 antibodies. (D) Colonic histopathological scores of mice with active disease treated with isotype control antibodies, anti-thy1.2 or anti-cd4 as a control. Data are representative of two independent experiments with n=3-5 per group.

11 Supplementary materials and methods Culture of Helicobacter typhlonius and infection of mice H. typhlonius was purchased from the culture collection of the University of Göteborg (CCUG) and cultured according to the provided protocol under CCUG T ( Rag -/- mice were gavaged with 5x1 8 CFU H. typhlonius. Genomic DN was extracted from colonic content as previously described (Turnbaugh et al., 29). PCR conditions for Helicobacter spp. based on 16S rrn sequences were adapted from previously described protocols (Fox, 1994; attles, 1995, Shames,1995) using the following primer sequences (PHFwd: 5 -GCT TG CG GGT TC C-3 ; PHRev: 5 -GT TTT CC CCT C CC-3 ). Immunhistochemistry for Ki67 Immunohistochemistry was performed on paraffin embedded tissue sections from colonic tissues of mice using primary antibodies against Ki67 (Dako, clone TEC-3) and isotype matched control (rat-antimouse IgG2a) followed by secondary biotinylated rabbit-anti-rat antibody staining (Dako, E468).

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

D CD8 T cell number (x10 6 )

D CD8 T cell number (x10 6 ) IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Kerdiles et al - Figure S1

Kerdiles et al - Figure S1 Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1 Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action

An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the

More information

Supplementary Information:

Supplementary Information: Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Eosinophils! 40! 30! 20! 10! 0! NS!

Eosinophils! 40! 30! 20! 10! 0! NS! A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection. Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supplementary Materials for

Supplementary Materials for www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,

More information

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Supplemental Figures: Supplemental Figure 1

Supplemental Figures: Supplemental Figure 1 Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,

More information

1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.

1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. 938 939 940 941 942 Figure S1 Schematic of the in silico TCRminer and MiXCR validation. 1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. Then, 100,000 simulated 80 bp

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

NMED-A65251A. Supplementary Figures.

NMED-A65251A. Supplementary Figures. NMED-A65251A Supplementary Figures. Sup. Fig. 1. ILC3 cells are the main source of in obese mice a. We gated on T cells (upper panels) or T cells (lower panels), and examined production. b. CD45 + - IL-13

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

Nature Immunology: doi: /ni.3836

Nature Immunology: doi: /ni.3836 Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

SUPPLEMENTAL INFORMATIONS

SUPPLEMENTAL INFORMATIONS 1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol. Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

17 th International Conference of the Inflammation Research Association: Wednesday AM (Day 4) September 9-13, 2012

17 th International Conference of the Inflammation Research Association: Wednesday AM (Day 4) September 9-13, 2012 17 th International Conference of the Inflammation Research Association: Wednesday AM (Day 4) September 9-13, 2012 The Sagamore Resort, Bolton Landing, NY, USA The following report includes highlights

More information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and

More information

The Case of the Spring Break Consequences

The Case of the Spring Break Consequences The Case of the Spring Break Consequences Hazel reluctantly opened her eyes when her alarm went off. Spring Break was over, and she was definitely NOT ready for the second half of the semester. However,

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

Life Sciences. Cytokine assays

Life Sciences. Cytokine assays Life Sciences Cytokine assays A full range of cytokines Cisbio s kits cover the full range of cytokines: interleukins, interferons (IFN), chemokines, TNF and lymphokines. All our assays are cell based

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig. C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice

More information

qpcr-array Analysis Service

qpcr-array Analysis Service qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

More information

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4+ T cells Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Supplementary Figure 1

Supplementary Figure 1 d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP

More information

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder

More information

Innate immune regulation of T-helper (Th) cell homeostasis in the intestine

Innate immune regulation of T-helper (Th) cell homeostasis in the intestine Innate immune regulation of T-helper (Th) cell homeostasis in the intestine Masayuki Fukata, MD, Ph.D. Research Scientist II Division of Gastroenterology, Department of Medicine, F. Widjaja Foundation,

More information

WISP1 mediates IL-6-dependent proliferation in primary human lung fibroblasts

WISP1 mediates IL-6-dependent proliferation in primary human lung fibroblasts WISP mediates IL-6-dependent proliferation in primary human lung fibroblasts Klee S, Lehmann M, Wagner DE, aarsma H, Königshoff M Comprehensive Pneumology Center, Helmholtz Zentrum München, Munich, Germany;

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Hasan et al analyse the transcriptional program used by pathogenic Th17 cells raised in the presence of IL-23 as compared to

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance

More information

pplementary Figur Supplementary Figure 1. a.

pplementary Figur Supplementary Figure 1. a. pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Intestinal homeostasis and its breakdown in IBD. Fiona Powrie

Intestinal homeostasis and its breakdown in IBD. Fiona Powrie Intestinal homeostasis and its breakdown in IBD Fiona Powrie Translational Gastroenterology Unit Experimental Medicine Division Nuffield Dept of Clinical Medicine University of Oxford fiona.powrie@path.ox.ac.uk

More information

To compare the relative amount of of selected gene expression between sham and

To compare the relative amount of of selected gene expression between sham and Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

More information

?Who binds to it. ? Who binds these inflammatory proteins RAGE SUGAR-FREE GLYCOBIOLOGY INFLAMMATION. BASIC SCIENCE?sugar chain structure

?Who binds to it. ? Who binds these inflammatory proteins RAGE SUGAR-FREE GLYCOBIOLOGY INFLAMMATION. BASIC SCIENCE?sugar chain structure SUGAR-FREE GLYCOBIOLOGY BASIC SCIENCE?sugar chain structure Unusual Sugar Chain It -- is a carboxylate Make lots of It Make an It antibody Inflammatory proteins?who binds to it? Who binds these inflammatory

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

Supplementary Information

Supplementary Information Supplementary Information Splenic red pulp macrophages are intrinsically superparamagnetic and contaminate magnetic cell isolates Lars Franken, arika Klein, arina Spasova, nna Elsukova, Ulf Wiedwald, eike

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Balancing intestinal and systemic inflammation through cell type-specific expression of

Balancing intestinal and systemic inflammation through cell type-specific expression of Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Online Data Supplement. Induction of Pulmonary Granuloma Formation by Propionibacterium acnes is regulated by. MyD88 and Nox2

Online Data Supplement. Induction of Pulmonary Granuloma Formation by Propionibacterium acnes is regulated by. MyD88 and Nox2 Online Data Supplement Induction of Pulmonary Granuloma Formation by Propionibacterium acnes is regulated by MyD88 and Nox2 Jessica L. Werner *, Sylvia G. Escolero *, Jeff T. Hewlett *, Tim N. Mak *3,

More information

M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination

M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.

More information

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott

More information

Supporting Information

Supporting Information Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus

More information

Supplementary information

Supplementary information Supplementary information Intrahepatic myeloid cell-aggregates enable local CD8 + T cell expansion and successful immunotherapy against chronic viral liver infection Li- Rung Huang, Dirk Wohlleber, Florian

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation

Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis. Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information