Supplementary Figures and Tables
|
|
|
- Godwin Newman
- 5 years ago
- Views:
Transcription
1 Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature blast cells. B) Autopsy from a representative mouse that developed T-cell lymphoblastic lymphoma, showing enlarged spleen, thymus, and lymph nodes (arrows). 1
2 C) Representative analysis of a mouse that developed AML, showing an enlarged spleen and normal sized thymus (arrow). Mice with these phenotypes usually showed hemorrhage and white eyes (arrow), indicative of leukocyte infiltration. D) Hematoxylin and Eosin-stained paraffin sections demonstrate disruption of organ architecture due to tumor cell infiltration (arrow). 2
3 Supplementary Figure S2. Immunophenotype of the two different cell lines isolated from bone marrow of CNTRL-FGFR1 transduced BALB/c mice, respectively. 3
4 Supplementary Figure S3. Myeloid lineage disease trans differentiates into T-cell leukemia/lymphoma. A) Scheme of serial bone marrow transplantation of CNTRL-FGFR1 BABLB/c. B) Flow cytometric characterization of bone marrow (BM) cells from both primary and secondary recipients. The procedure and antibodies are described in the Experimental Procedures. C) Schematic representation showing the relative location of the PCR primers used to analyze the Tcrb locus (upper panel). Genomic PCR analysis of Tcrb rearrangement showing the germinal and predominant bands bone marrow (BM), spleen (SP) and thymus (Thy) from the serially transplanted CNTRL-FGFR1 mice. 4
5 Supplementary Figure S4. Pathology analysis of NSG mice carrying CNTRL-FGFR1 transduced human CD34+ progenitor cells. A) Wright-Giemsa stained peripheral blood from a representative mouse and a normal (transduced with the MIEG3 empty vector) mouse (left panel). Splenohepatomegaly (right panel) is seen in the disease mouse compared with the control mouse. 5
6 B) Representative Hematoxylin and Eosin-stained paraffin sections from leukemic mice demonstrate disruption of the architecture of various organs. C) Flow cytometry analysis shows absence of GFP expression in splenocytes from a representative NSG disease mouse (left panel), where the CNTRL-FGFR1 fusion transcript can be detected by RT-PCR (right panel). 6
7 Supplementary Table S1. Characteristics of the CNTRL-FGFR1 transduced BABL/c mice CNTRL-BALB/c mouse # Organomegaly Diagnosis Immunophenotype Hemorrhage Latency 1 spleen AML B220+GR1+Mac1+ Yes 10 month 3 spleen, lymph nodes, thymus Myeloid+T-leukemia/lymphoma CD4+/CD8+ Yes 6 month 4 spleen, lymph nodes, thymus Myeloid+T-leukemia/lymphoma CD4+/CD8+ No 6.5 month 5 none AML B220+GR1+Mac1+ Yes 10 month 7 lymph nodes AML B220+GR1+Mac1+ Yes 6.5 month 8 spleen AML B220+GR1+Mac1+ Yes 10 month 9 spleen, thymus AML B220+GR1+Mac1+ No 6.5 month 10 none AML B220+GR1+Mac1+ Yes 9.5 month Supplementary Table S2. Characteristics of the CNTRL-FGFR1 transduced human CD34+ progenitor NSG mice CNTRL-NSG mouse # Organomegaly Diagnosis Immunophenotype Hemorrhage Latency 1 spleen AML CD45+CD13+ No 8 m 2 spleen, kidney AML+ T-leukemia CD45+CD13+, CD4+CD8+ No 8 m 3 spleen, liver AML CD45+CD13+ No 10 m 4 spleen, liver AML CD45+CD13+ No 10.5 m 5 spleen, liver AML CD45+CD13+ Yes 10.5 m 6 spleen, liver AML CD45+CD13+ No 11 m 7 spleen, liver AML+ T-leukemia CD45+CD13+, CD4+CD8+ Yes 11 m 8 spleen AML+ T-leukemia CD45+CD13+, CD4+CD8+ No 14.5 m 9 spleen, liver, lymph nodes AML+ T-leukemia/lymphoma CD45+CD13+, CD4+CD8+ No 14.5 m 7
8 Supplementary Table S3. Characteristics of the reported cases of CNTRL-FGFR1 Case # Age/sex Karyotype Organomegaly Diagnosis T/B lymphoma BMT/aBMT Survival Reference 1 3.5/F 46,XX,t(8;9) splenomegaly acml none Yes alive (158+ Lewi et al. months) 2 84/F 46,XX,t(8;9) none MPD none No died Friedhoff et al. 3 32/M 46,XY,t(8;9) splenomegaly acml AML none No died Oscier et al. 4 41/M 46,XY,t(8;9) splenomegaly acml AML none No died Jotterand et al /F 46,XX,t(8;9) tonsils acml AML T-LBL Yes alive (29+ months) Nakayama et al /M 46,XY,t(8;9) tonsils MPD T-LBL Yes alive (24+ months) Van den Berg et al. 7 37/M 46,XY,t(8;9), splenhepatomegaly ECL AML none No died (11 month) Guasch et al. +der(9) /M 46,XY,t(8;9), N/A acml N/A Yes N/A Sohal et al. Inv (2) 9 N/A N/A MPD N/A N/A N/A Vandergoten et al /F 46,XX,t(8;9) none acml AML B/T lymphoma Yes alive (6+ months) Yamamoto et al /M 46,XY,t(8;9) none AML none No died (5 month) Mozzicoacci 12 36/M 46,XY,t(8;9) tonsils EMS AML T-LBL no N/A Park et al /M 46,XY,t(3;8;9) none EMS AML T/B-LBL No died (9 month) Post et al. 14 8/F 46,XX,t(8;9) splenohepatomegaly, EMS AML? No died (6 month) Hu et al. tonsils, lymph nodes 15 42/F 46,XX,t(8;9) lymph nodes EMS AML T-LBL NO alive (24+ months) Zhou, et al /M 46,XY,t(8;9) +21 splenhepatomegaly, lymph nodes AML T-LBL Yes died (3 month) Yamamoto, et al. Note: BMT- bone marrow transplantation; abmt-allogeneic bone marrow transplantation; acml-atypical chronic myeloid leukemia; MPD- myeloid proliferative disorder; AML=acute myeloid leukemia; LBL-lymphoblastic lymphoma; ECL- eosiniphilic chronic leukemia; EMS-8p11 myeloproliferative syndrome; N/A- not available. 8
9 Supplementary Table S4. PCR Primer sequences, annealing temperatures and expected sizes of PCR products. Gene Primers sequences Annealing PCR Flt3-FWD 5 - AAGAAGCTCTCATGTCGGAGCTCA 60 o C 431 bp Flt3-RVS 5 - TGGTACGCAAAGCAAAGGAGGTCT Gfi1-FWD 5 - AAGATCATGGCCACGAGCTGCA 60 o C 313 bp Gfi1-RVS G 5 - AGCGTGGATGACCTCTTGAAGCT Spi1-FWD 5 - CACACCATGTCCACAACAACGAGT 60 o C 300 bp Spi1-RVS 5 - AGCCATCAGCTTCTCCATCAGACA Irf8-FWD 5 - AGTGGCTGATCGAACAGATCGACA 60 o C 239 bp Irf8-RVS 5 - ATCTGGGCTCTTGTTCAGAGCACA Klf4-FWD 5 - TCAACGACCTCCTGGACCTAGACT 60 o C 280 bp Klf4-RVS 5 - ACGTCATTGATGTCCGCCAGGTT Csf1r-FWD 5 - GCGATGTGTGAGCAATGGCAGT 60 o C 300 bp Csf1r-RVS 5 - AGTGAGACACTGTCCTTCAGTGCA Kit-FWD 5 - CACATACACGTGCAGCAACAGCA 60 o C 315 bp Kit-RVS 5 - TCAGAATGCAGCCATGTACCGTCA Cebpa-FWD 5 - CAAACAAGAGCCCCGCGAGGA 60 o C 507 bp Cebpa-RVS 5 - TTGCGCAGGCGGTCATTGTCA Pax5-FWD 5 - TCCTCGGACCATCAGGACAG 60 o C 385 bp Pax5-RVS 5 - CCTGTTGATGGAGCTGACGC Vpreb1-FWD 5 - CGTCTGTCCTGCTCATGCT 60 o C 340 bp Vpreb1-RVS 5 - ACGGCACAGTAATACACAGCC Ebf-FWD 5 - AACTGGCTGTGAATGTCTCG 60 o C 451 bp Ebf-RVS 5 - CACATGGGAGGGACAATCA DFS-FWD 5 - ACGTCGACTTTTGTSAAGGGATCT 60 o C DQ52-FWD 5 -ACGTCGACGCGGASSACCACAGTGCAACTG JH4A-RVS 5 -GGGTCTAGACTCTCAGCCGGCTCCCTCAGGG 9
IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
Case #16: Diagnosis. T-Lymphoblastic lymphoma. But wait, there s more... A few weeks later the cytogenetics came back...
Case #16: Diagnosis T-Lymphoblastic lymphoma But wait, there s more... A few weeks later the cytogenetics came back... 46,XY t(8;13)(p12;q12)[12] Image courtesy of Dr. Xinyan Lu Further Studies RT-PCR
Acute myeloid leukemia. M. Kaźmierczak 2016
Acute myeloid leukemia M. Kaźmierczak 2016 Acute myeloid leukemia Malignant clonal disorder of immature hematopoietic cells characterized by clonal proliferation of abnormal blast cells and impaired production
Role of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED
Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Acute Myeloid Leukemia Firstly we ll start with this introduction then enter the title of the lecture, so be ready and let s begin by the name of Allah : We
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Hematopathology Case Study
Hematopathology Case Study AMP Outreach Course 2009 AMP Annual Meeting John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine November 19, 2009 HISTORY Case History An
SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies
SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,
Chronic Idiopathic Myelofibrosis (CIMF)
Chronic Idiopathic Myelofibrosis (CIMF) CIMF Synonyms Agnogenic myeloid metaplasia Myelosclerosis with myeloid metaplasia Chronic granulocytic-megakaryocytic myelosis CIMF Megakaryocytic proliferation
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Differential diagnosis of hematolymphoid tumors composed of medium-sized cells. Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital
Differential diagnosis of hematolymphoid tumors composed of medium-sized cells Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital Lymphoma classification Lymphoma diagnosis starts with morphologic
Pathology. #11 Acute Leukemias. Farah Banyhany. Dr. Sohaib Al- Khatib 23/2/16
35 Pathology #11 Acute Leukemias Farah Banyhany Dr. Sohaib Al- Khatib 23/2/16 1 Salam First of all, this tafreegh is NOT as long as you may think. If you just focus while studying this, everything will
Mixed Phenotype Acute Leukemias
Mixed Phenotype Acute Leukemias CHEN GAO; AMY M. SANDS; JIANLAN SUN NORTH AMERICAN JOURNAL OF MEDICINE AND SCIENCE APR 2012 VOL 5 NO.2 INTRODUCTION Most cases of acute leukemia can be classified based
A pediatric patient with acute leukemia of ambiguous lineage with a NUP98-NSD1 rearrangement SH
A pediatric patient with acute leukemia of ambiguous lineage with a NUP98NSD1 rearrangement SH20170203 Rebecca LeemanNeill, Ronald Rice, Anita Malek, Patricia Raciti, Susan Hsiao, Mahesh Mansukhani, Bachir
Diagnostic Approach for Eosinophilia and Mastocytosis. Curtis A. Hanson, M.D.
Diagnostic Approach for Eosinophilia and Mastocytosis Curtis A. Hanson, M.D. 2014 MFMER slide-1 DISCLOSURES: Relevant Financial Relationship(s) None Off Label Usage None 2014 MFMER slide-2 Molecular Classification
Classification of Hematologic Malignancies. Patricia Aoun MD MPH
Classification of Hematologic Malignancies Patricia Aoun MD MPH Objectives Know the basic principles of the current classification system for hematopoietic and lymphoid malignancies Understand the differences
Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms. Daniel A. Arber, MD Stanford University
Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms Daniel A. Arber, MD Stanford University What is an integrated approach? What is an integrated approach? Incorporating all diagnostic
HEMATOLOGIC MALIGNANCIES BIOLOGY
HEMATOLOGIC MALIGNANCIES BIOLOGY Failure of terminal differentiation Failure of differentiated cells to undergo apoptosis Failure to control growth Neoplastic stem cell FAILURE OF TERMINAL DIFFERENTIATION
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data
Instructions for Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data (Form 2114) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Myelodysplasia/Myeloproliferative
Immunopathology of Lymphoma
Immunopathology of Lymphoma Noraidah Masir MBBCh, M.Med (Pathology), D.Phil. Department of Pathology Faculty of Medicine Universiti Kebangsaan Malaysia Lymphoma classification has been challenging to pathologists.
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
NUP214-ABL1 Fusion: A Novel Discovery in Acute Myelomonocytic Leukemia
Case 0094 NUP214-ABL1 Fusion: A Novel Discovery in Acute Myelomonocytic Leukemia Jessica Snider, MD Medical University of South Carolina Case Report - 64 year old Caucasian Male Past Medical History Osteoarthritis
Supporting Information
Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations.
Supplementary Figure 1 TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations. The CpG motifs closest to the breakpoints are highlighted in red boxes and the
WBCs Disorders 1. Dr. Nabila Hamdi MD, PhD
WBCs Disorders 1 Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features
Instructions for Chronic Lymphocytic Leukemia Post-HSCT Data (Form 2113)
Instructions for Chronic Lymphocytic Leukemia Post-HSCT Data (Form 2113) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the CLL Post-HSCT Data Form. E-mail
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
2402: Pre-TED Disease Classification
2402: Pre-TED Disease Classification The Pre-TED Form is now required for all transplants, including subsequent transplants on * the comprehensive report form track. All transplant centers participating
PRECURSOR LYMHPOID NEOPLASMS. B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma
PRECURSOR LYMHPOID NEOPLASMS B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma B lymphoblastic leukaemia/lymphoma Definition: B lymphoblastic leukaemia/lymphoma is a neoplasm of precursor
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Cost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic
Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship
De novo mast cell leukemia without CD25 expression and KIT mutations: a rare case report in a 13-year-old child
Zheng et al. Diagnostic Pathology (2018) 13:14 https://doi.org/10.1186/s13000-018-0691-2 CASE REPORT Open Access De novo mast cell leukemia without CD25 expression and KIT mutations: a rare case report
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Hematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
Case 3. Ann T. Moriarty,MD
Case 3 Ann T. Moriarty,MD Case 3 59 year old male with asymptomatic cervical lymphadenopathy. These images are from a fine needle biopsy of a left cervical lymph node. Image 1 Papanicolaou Stained smear,100x.
Correspondence should be addressed to Eric X. Wei;
Hindawi Case Reports in Hematology Volume 217, Article ID 587315, 7 pages https://doi.org/1.1155/217/587315 Case Report γδ T-Cell Acute Lymphoblastic Leukemia/Lymphoma: Discussion of Two Pediatric Cases
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Myeloproliferative Disorders - D Savage - 9 Jan 2002
Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2
Supplementary Material
Supplementary Material Taghon, Yui, and Rothenberg: Mast cell diversion of T-lineage precursor cells by the essential T-lineage transcription factor GATA Supplemental Table Supplemental Figures 1-6 Supplemental
Molecular Characterization of Leukemia Stem Cell Development. Scott A. Armstrong MD, Ph.D.
Molecular Characterization of Leukemia Stem Cell Development Scott A. Armstrong MD, Ph.D. Normal and Leukemic Hierarchies NORMAL HSC (SRC) Myeloid progenitor LTC-IC CFU AML LSC (SL-IC) Leukemic LTC-IC
Case Workshop of Society for Hematopathology and European Association for Haematopathology
Case 24 2007 Workshop of Society for Hematopathology and European Association for Haematopathology Aliyah Rahemtullah 1, Martin K Selig 1, Paola Dal Cin 2 and Robert P Hasserjian 1 Departments of Pathology,
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Leukocytosis - Some Learning Points
Leukocytosis - Some Learning Points Koh Liang Piu Department of Hematology-Oncology National University Cancer Institute National University Health System Objectives of this talk: 1. To provide some useful
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/339/339ra69/dc1 Supplementary Materials for The caspase-8 inhibitor emricasan combines with the SMAC mimetic birinapant to induce necroptosis and
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Diagnostic challenge: Acute leukemia with biphenotypic blasts and BCR-ABL1 translocation
Case Study Diagnostic challenge: Acute leukemia with biphenotypic blasts and BCR-ABL1 translocation Ling Wang 1 and Xiangdong Xu 1,2,* 1 Department of Pathology, University of California, San Diego; 2
N Engl J Med Volume 373(12): September 17, 2015
Review Article Acute Myeloid Leukemia Hartmut Döhner, M.D., Daniel J. Weisdorf, M.D., and Clara D. Bloomfield, M.D. N Engl J Med Volume 373(12):1136-1152 September 17, 2015 Acute Myeloid Leukemia Most
Allogeneic Hematopoietic Stem-Cell Transplantation for Myelodysplastic Syndromes and Myeloproliferative Neoplasms. Policy Specific Section:
Medical Policy Allogeneic Hematopoietic Stem-Cell Transplantation for Myelodysplastic Syndromes and Myeloproliferative Type: Medical Necessity and Investigational / Experimental Policy Specific Section:
Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
Aberrant Expression of CD7 in Myeloblasts Is Highly Associated With De Novo Acute Myeloid Leukemias With FLT3/ITD Mutation
Hematopathology / CD7 Expression and FLT3/ITD Mutation in AML Aberrant Expression of CD7 in Myeloblasts Is Highly Associated With De Novo Acute Myeloid Leukemias With FLT3/ITD Mutation Veronica Rausei-Mills,
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan
LEUKAEMIA and LYMPHOMA. Dr Mubarak Abdelrahman Assistant Professor Jazan University
LEUKAEMIA and LYMPHOMA Dr Mubarak Abdelrahman Assistant Professor Jazan University OBJECTIVES Identify etiology and epidemiology for leukemia and lymphoma. Discuss common types of leukemia. Distinguish
Lymphoma: What You Need to Know. Richard van der Jagt MD, FRCPC
Lymphoma: What You Need to Know Richard van der Jagt MD, FRCPC Overview Concepts, classification, biology Epidemiology Clinical presentation Diagnosis Staging Three important types of lymphoma Conceptualizing
Initial Diagnostic Workup of Acute Leukemia
Initial Diagnostic Workup of Acute Leukemia Guideline from the College of American Pathologists (CAP) and the American Society of Hematology (ASH) Publication: Archives of Pathology and Laboratory Medicine
Mast Cell Disease Case 054 Session 7
Mast Cell Disease Case 054 Session 7 Rodney R. Miles, M.D., Ph.D. Lauren B. Smith, M.D. Cem Akin, M.D. Diane Roulston,, Ph.D. Charles W. Ross, M.D. Departments of Pathology and Internal Medicine University
Case Report Pitfalls in the Diagnosis of Anaplastic Large Cell Lymphoma with a Small Cell Pattern
Case Reports in Hematology Volume 23, Article ID 84253, 6 pages http://dx.doi.org/.55/23/84253 Case Report Pitfalls in the Diagnosis of Anaplastic Large Cell Lymphoma with a Small Cell Pattern Rowan L.
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
WBCs Disorders. Dr. Nabila Hamdi MD, PhD
WBCs Disorders Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features and
Case year old male with abdominal lymphadenopathy Treated with 8 cycles of R-CHOP One year later B-symptoms and progressive disease
Codirectors Tsieh Sun, M.D., FASCP Francisco Vega, M.D., Ph.D. Department of Hematopathology UT MD Anderson Cancer Center Houston Texas There is no conflict of interest involved in the content and presentation
Impaired DNA replication within progenitor cell pools promotes leukemogenesis
Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert
2013 AAIM Pathology Workshop
2013 AAIM Pathology Workshop John Schmieg, M.D., Ph.D. None Disclosures 1 Pathology Workshop Objectives Define the general philosophy of reviewing pathology reports Review the various components of Bone
ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression
AD Award Number: W81XWH-04-1-0795 TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression PRINCIPAL INVESTIGATOR: Kenneth Dorshkind, Ph.D. CONTRACTING ORGANIZATION: University of California,
Katrina L. Lancaster-Shorts, Joanna Chaffin, Natasha M. Savage. Department of Pathology, Augusta University, Augusta, GA, USA;
Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Leukaemia Section Review Katrina L. Lancaster-Shorts, Joanna Chaffin, Natasha M. Savage Department of Pathology,
Acute Myeloid Leukemia with Recurrent Cytogenetic Abnormalities
Acute Myeloid Leukemia with Recurrent Cytogenetic Abnormalities Acute Myeloid Leukemia with recurrent cytogenetic Abnormalities -t(8;21)(q22;q22)(aml/eto) -inv(16) or t(16;16) -t(15;17) -11q23 Acute Myeloid
Case Presentation No. 075
Case Presentation No. 075 Session 4. Myelodysplastic Syndrome Cristina Montalvo, MD Baylor College of Medicine Houston, Texas 2007 Workshop of Society for Hematopathology and European Association for Haematopathology
Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota
Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics What is it? Terminology Clinical value What details are important Diagnostic Tools for Leukemia
Hypereosinophili c syndrome
Hypereosinophili c syndrome Eosinophilia Eosinophilia is commonly defined as an elevated percentage of eosinophils, with an absolute eosinophil count > 500 cells per cubic millimeter Secondary Primary
SH A CASE OF PERSISTANT NEUTROPHILIA: BCR-ABL
SH2017-0124 A CASE OF PERSISTANT NEUTROPHILIA: BCR-ABL NEGATIVE John R Goodlad 1, Pedro Martin-Cabrera 2, Catherine Cargo 2 1. Department of Pathology, NHS Greater Glasgow & Clyde, QEUH, Glasgow 2. Haematological
8p11 myeloproliferative syndrome: diagnostic challenges and pitfalls
JBUON 2016; 21(3): 745-749 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com SHORT COMMUNICATION 8p11 myeloproliferative syndrome: diagnostic challenges and pitfalls
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Clinical Study of Acute Mixed-lineage Leukemia in 14 Children
Original Article Iran J Pediatr Dec 2011; Vol 21 (No 4), Pp: 521-525 Clinical Study of Acute Mixed-lineage Leukemia in 14 Children Yaodong Zhang 1, MD; Lina Tan 1 ; Xiaoling Zhang 2, PhD; Haiyan Wei 1,
The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice
Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
9/25/2017. Disclosure. I have nothing to disclose. Young S. Kim MD Dept. of Pathology
Disclosure MAST CELLNEOPLASM I have nothing to disclose. Young S. Kim MD Dept. of Pathology 1 Objectives What is mast cell lineage? Changes in updated WHO 2016 mastocytosis Issues of Mastocytosis CD30
Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
Juvenile Myelomonocytic Leukemia (JMML)
Juvenile Myelomonocytic Leukemia (JMML) JMML: Definition Monoclonal hematopoietic disorder of childhood characterized by proliferation of the granulocytic and monocytic lineages Erythroid and megakaryocytic
HEMATOPATHOLOGY SUMMARY REPORT RL;MMR;
HEMATOPATHOLOGY SUMMARY REPORT RL;MMR; Page 1 of 1 05/15/20XX HP000000-20XX 05/21/20XX (212) 123-457 (51) 32-3455 (51) 123-457 Age: 78 DOB: 0/05/19XX SS#: 45-45-45 Clinical Information: 78 y/o female with
Case Report Blasts-more than meets the eye: evaluation of post-induction day 21 bone marrow in CBFB rearranged acute leukemia
Int J Clin Exp Pathol 2014;7(7):4498-4502 www.ijcep.com /ISSN:1936-2625/IJCEP0000851 Case Report Blasts-more than meets the eye: evaluation of post-induction day 21 bone marrow in CBFB rearranged acute
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
NUMERATOR: Patients who had baseline cytogenetic testing performed on bone marrow
Quality ID #67 (NQF 0377): Hematology: Myelodysplastic Syndrome (MDS) and Acute Leukemias: Baseline Cytogenetic Testing Performed on Bone Marrow National Quality Strategy Domain: Effective Clinical Care
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos
BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos Ph like ALL BCR ABL1 like acute lymphoblastic leukemia (ALL)
Pathology of Hematopoietic and Lymphoid tissue
Pathology of Hematopoietic and Lymphoid tissue Peerayut Sitthichaiyakul, M.D. Department of Pathology and Forensic Medicine Faculty of Medicine, Naresuan University CONTENTS White blood cells and lymph
0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type
Fig S1 A B Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell Tumor type -/- (n = 46) Q/- (n = 76) Q/Q (n = 31) Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima