Expanded View Figures
|
|
- David Norton
- 5 years ago
- Views:
Transcription
1 The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al Expanded View Figures x E3 cells/µl W g/l HG x e3 cells/µl PLT % of cell type 8 day 8 month % of cell type 8 day 8 month 8 day 8 month 8 day 8 month wild-type Dnmt / D recipients recipients 3 recipients nor derived P cells erived P cells % do % donor week 8 week week 6 week week nor derived P cells % do. w post transplant 8 7w post transplant w post transplant D4R D3 Db Ly6G erived P cells % donor d week 8 week week 7 week D4R D3 Db Ly6G nor derived P cells % do erived P cells % donor d week 8 week week * D4R D3 Db Ly6G Figure EV. Peripheral blood cell counts. Total blood cell counts of wild-type and Dnmt / mice showing no significant differences. Total white blood cell counts, hemoglobin concentration, and platelet cell counts of wild-type and Dnmt / mice (n = 3 mice per group). W: white blood cell counts; HG: hemoglobin; PLT: platelets. Lineage distribution of peripheral blood analyzed by the DVI hematology analyzer system. RETI: reticulocytes; NEUT: neutrophiles; LYMPH: lymphocytes; MONO: monocytes; EOS: eosinophiles; SO: basophiles; LU: large unstained cells. Giemsa staining of a representative femoral section from 4-month-old mice showing restoration of ossification defects. Scale bar: lm. D Stable engraftment (upper panels) and multi-lineage reconstitution (lower panels) in wild-type and Dnmt / recipient mice. Donor chimerism is indicated by D4. expression of peripheral blood (P) cells using flow cytometry. Peripheral blood was collected monthly and analyzed for engraftment and lineage distribution (Db: macrophages; Ly6G: granulocytes; D4R: cells; D3: T cells). Data information: Data are presented as mean SD. sterisks indicate statistically significant (P <., t-test) differences. EV The EMO Journal ª The uthors
2 Francesca Tuorto et al Dnmt regulates translational fidelity The EMO Journal Figure EV. nalysis of protein synthesis rates. nalysis of total protein synthesis in primary bone marrow stromal and haematopoietic cells by pulse-labeling with 3 H-Gly. s a negative control, protein synthesis was blocked in wild-type cells by treatment with lm sodium arsenite (so 3 ). Results were obtained from three independent experiments, and error bars represent standard deviations. Representative polysome profiles from Dnmt / and control primary bone marrow culture. Haematopoietic cells growing in suspension (ss) and attached stromal (st) cells were independently harvested and showed a higher proteins synthesis rate. s a measure for the global rate of translation, the fraction of polysomal ribosomes was quantified from polysome profiles. Results are shown for two independent biological replicates, and error bars represent standard deviations. ce at 4 nm (U) ss st - ss - st bsorba time on Polysomal fracti ss -ss st -st ª The uthors The EMO Journal EV
3 The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al difference % codon frequency difference codon frequency Figure EV3. Regulation of codon fidelity. Heatmaps showing the significant codon biases in Dnmt down-regulated proteins in the DML dataset. n increase of a codon frequency relative to the average frequency of that codon in all identified proteins is displayed in red, whereas a reduction is depicted in green. odons showing no deviation from average values are displayed in white according to the scale provided in the figure. Heatmaps showing codon biases in all protein datasets. hanges of codon frequencies relative to the average frequency of the indicated codon are displayed according to the scale provided in the figure. EV3 The EMO Journal ª The uthors
4 Francesca Tuorto et al Dnmt regulates translational fidelity The EMO Journal Log footprint density (RPKM) Spearman correlation =.96 M SS Log footprint density (RPKM) Spearman correlation =.94 M SS Log footprint density (RPKM) replicate Log footprint density (RPKM) replicate Log footprint density (RPKM) Spearman correlation =.9 M ST Log footprint density (RPKM) replicate Log footprint density (RPKM) Spearman correlation =.9 M SS rrn aligned unaligned Log footprint density (RPKM) replicate replicate SS SS ST ST SS SS ST ST read counts [x 4 ] 3 9,, 8,, number of reads D read counts [x 4 ] position from start [nt] position from start [nt] Figure EV4. Reproducibility and quality control of ribosome profiling. orrelation between ribosome profiling dataset replicates. Haematopoietic cells growing in suspension (ss) and attached stromal cells (st) were independently harvested. Mapping results from the two independent ribosome profiling replicates. Representative metaplot of wild-type haematopoietic (ss) cells. 8-mer ribosome footprint reads were summed across all start codons. D Representative in-frame 8-mer ribosome footprint abundance in wild-type haematopoietic (ss) cells showing the correct periodicity. ª The uthors The EMO Journal EV4
5 The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al k-s test P-value:.8E-3 GU Log codon occupancy at site k-s test P-value:4.9E- GU Log codon occupancy at site k-s test P-value:.7E-9 G k-s test P-value:3.E- G Log codon occupancy at site Log codon occupancy at site k-s test P-value:.E-6 GG k-s test P-value: 4.E-3 GG Log codon occupancy at site Log codon occupancy at site Fraction of codon ns k-s test P-value:.3E-8 GUU st Fraction of codon ns k-s test P-value:.6E- GUU Log codon occupancy at site Log codon occupancy at site ss P-values codon occupancy GG Glu G GU sp G GG -Gly GUU -Val others st P ss P Log / P P P ll Down Up Figure EV. Single-codon occupancy metric shows that differences in ribosome footprint occupancy at Dnmt target codons are statistically significant. Heatmap of P-values (Kolmogorov Smirnov test) for all sense codons in wild-type and Dnmt / ribosome and P sites. The two biological replicates of each cell type were pooled. : ribosomal -site; P: ribosomal P-site; st: stromal cells, ss: suspension cells. umulative distributions of single-codon occupancy for select codons in wild-type and Dnmt / stromal (st) and suspension (ss) cells. hanges in bulk codon occupancy in Dnmt / bone marrow suspension cells versus wild-type cells. Dnmt target codons and Glu codons are highlighted with the indicated colors. The two biological replicates of each cell type were pooled. : ribosomal -site; P: ribosomal P-site. EV The EMO Journal ª The uthors
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationSupplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently
Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre
More informationExpanded View Figures
Gregory T Ellis et al Lung damage by monocyte TRIL allows coinfection EMO reports Expanded View Figures % survival Clinical score Influenza Matrix /HPRT (log ) CFU/L (log ) 3 irway early.7.7 + h Survival
More informationExpanded View Figures
EMO Molecular Medicine Proteomic map of squamous cell carcinomas Hanibal ohnenberger et al Expanded View Figures Figure EV1. Technical reproducibility. Pearson s correlation analysis of normalised SILC
More informationBlood Cells Med Terms Quiz
Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:
More informationSupplementary material page 1/10
Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base
More informationSupplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationFigure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.
Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values
More informationHISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM
HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM Login: http://histopath.westernu.edu Histology Atlas AND Virtual Histology links. I. HEMATOLOGY - PERIPHERAL BLOOD Purpose: To be able to identify
More informationCRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
More informationLUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE. 1. European Institute of Oncology, Department of Experimental Oncology,
Supplementary information LUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE MARROW RECONSTITUTION WITH k-ras V12 CELLS. Elena Belloni 1*, Ines Martin Padura 2#*, Elvira Gerbino 1, Stefania Orecchioni
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationNature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.
Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationSUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
More informationMorphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
More informationSUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
More informationComplete Blood Count PSI AP Biology
Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationTransfer protocol of human HSC into NOG mice
Transfer protocol of human HSC into NOG mice Mice: Adult NOG mice are aged 8-12 weeks. Newborn mice are 1 2 days old. 8-12 week old NOG mice irradiated with 2.5 Gy Intravenous transfer of 1-0.5 x 10 5
More informationONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.
ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationEssentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood. Multiple Choice
Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood Multiple Choice 1) The matrix of blood is called: A) buffy coat B) plasma C) erythrocytes D) lymphocytes E) formed elements Diff: 1 Page
More informationThe Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System
The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage
More informationSummary of Changes Page BMT CTN 1205 Protocol Amendment #4 (Version 5.0) Dated July 22, 2016
Page 1 of 8 Date: July 22, 2016 Summary of Changes Page BMT CTN 1205 Protocol #4 Dated July 22, 2016 The following changes, and the rationale for the changes, were made to the attached protocol in this
More informationBone marrow transplantation for PID
BMT Bone marrow transplantation for PID hello@piduk.org 0800 987 898 www.piduk.org About this leaflet Bone marrow transplant (BMT; also known as haematopoietic stem cell transplant or HSCT) is increasingly
More informationSupplementary Information
Supplementary Information Distinct bone marrow-derived and tissue resident macrophage lineages proliferate at key stages during inflammation. 1 Luke C. Davies, 1 Marcela Rosas, 2 Stephen J. Jenkins, 1
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSupporting Information
Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary
More informationChapter 21 Outline. General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements
Chapter 21 Outline General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements Introduction Blood serves many functions. Some examples
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationLAB TIME/DATE. 1. most numerous leukocyte. 3. also called an erythrocyte; anucleate formed element. 6. ancestral cell of platelets
ighapmlre29apg245_250 5/12/04 2:46 PM Page 245 impos03 302:bjighapmL:ighapmLrevshts:layouts: NAME Blood LAB TIME/DATE REVIEW SHEET exercise 29A Composition of Blood 1. What is the blood volume of an average-size
More information4. TEXTBOOK: ABUL K. ABBAS. ANDREW H. LICHTMAN. CELLULAR AND MOLECULAR IMMUNOLOGY. 5 TH EDITION. Chapter 2. pg
LECTURE: 03 Title: CELLS INVOLVED IN THE IMMUNE RESPONSE LEARNING OBJECTIVES: The student should be able to: Identify the organs where the process of the blood formation occurs. Identify the main cell
More informationGenetic information flows from mrna to protein through the process of translation
Genetic information flows from mrn to protein through the process of translation TYPES OF RN (RIBONUCLEIC CID) RN s job - protein synthesis (assembly of amino acids into proteins) Three main types: 1.
More informationBlood. Water compartments
Blood Water compartments 2/8 about 60% of our body is water (young-old, male-female) water is located in compartments, movement is regulated intracellular : extracellular 2:1, i.e. 40:20% interstitial
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12391 Table 1. Binding of A(H7N9) viruses to individual glycan structures. # Structure a Anhui1 Shanghai1 1 Neu5Acα nb nb 2 Neu5Acα ++ nb 3 Neu5Acβ nb nb 4 Neu5Acα2-3(6-O-Su)Galβ1-4GlcNAcβ
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationChronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
More informationSUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
More informationSupplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationHistocompatibility. HLA Serologic Typing (Class I/II) ABO, HLAS, HLAS Surveys & Anatomic Pathology Education Programs
www.cap.org Histocompatibility Analytes/procedures in bold type are regulated for proficiency testing by the Centers for Medicare & Medicaid Services (CMS). HLA Serologic Typing (Class I/II) ABO, HLAS,
More informationLeukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University
Leukocytosis dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University My first day at work in 1997 3y with fever, cough Is this bronchitis, pneumonia, pharyngitis, sinusitis, else? Is this
More informationFormation of Blood Cells
Hematopoiesis Lecture Objectives Name organs responsible for hematopoiesis in the fetus. List the developmental stages of hematopoiesis both prenatally and postnatally. Outline the major steps of post
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationAquaporin-9-expressing neutrophils are required for the establishment of contact hypersensitivity
Supplemental Material quaporin-9-expressing neutrophils are required for the establishment of contact hypersensitivity atharina Sagita Moniaga 1, Sachiko Watanabe 1, Tetsuya Honda 1, 2, Søren Nielsen 3,
More informationBrief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
More informationPerformance evaluation of Celltac G: a new automated hematology analyzer
Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo
More informationI. Concepts: Fill in the following sections with information from the text and lecture.
Name: Period: 10 Blood Study Guide I. Concepts: Fill in the following sections with information from the text and lecture. 1. Composition and Function of Blood: 2. Hematopoiesis: 1 Miss School, Miss Out
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationMedical School Histology Basics Introduction to Microscopy. VIBS 289 lab
Medical School Histology Basics Introduction to Microscopy VIBS 289 lab Larry Johnson Texas A&M University Objectives Learn the difference in magnification and resolution Learn about different types of
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationNature Genetics: doi: /ng.3812
Nature Genetics: doi:10.1038/ng.3812 Supplementary Figure 1 Smarcd2-knockout mice die perinatally with impaired energy homeostasis. (a) Generation of the Smarcd2 conditional knockout allele. Deletion of
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationHaematopoietic stem cells
Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity
Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)
More informationChapter 13 The Blood
Chapter 13 The Blood Copyright 2015 Wolters Kluwer Health Lippincott Williams & Wilkins Overview Key Terms agglutination erythrocyte lymphocyte albumin fibrin megakaryocyte anemia hematocrit monocyte antigen
More informationA. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters
A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly
More information1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs
1 BIO 212: ANATOMY & PHYSIOLOGY II LAB BLOOD PLATES EOSINOPHIL Contains large red-staining granules Usually 2 lobes 12-17 µm: about the size of neutrophils (2X erythrocytes) regulation/reduction of Histamine.
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More information3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationMonocyte subsets in health and disease. Marion Frankenberger
Monocyte subsets in health and disease Marion Frankenberger main cellular components: Leukocytes Erythrocytes Composition of whole blood Monocytes belong to the cellular components of peripheral blood
More informationfive lineages of stem cells producing all of the various formed elements.
Chapter 6 Blood Tissue 6.1. Basic Composition of Blood Blood is a connective tissue composed of free cells in a fluid matrix. Unlike other types of connective tissues, blood lacks fibers except during
More informationStem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
More informationONLINE SUPPLEMENTAL INFORMATION
1 ONLINE SUPPLEMENTAL INFORMATION Small trna-derived RNAs are increased and more abundant than micrornas in chronic hepatitis B and C Sara R. Selitsky 1-3, Jeanette Baran-Gale 1,2, Masao Honda 4, Daisuke
More informationFrom the Diagnostic Immunology Laboratories
Immunology Laboratories ISSUE 9 SPRING 2012 PAGE 1 Spring Meetings Please stop by and say hello in May at this year s American Society of Pediatric Hematology/Oncology (ASPHO) Annual Meeting in New Orleans
More informationSupplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat
Supplementary Tables Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat condition, skin condition, weight, posture, mobility, and vitality are individually scored and summed to achieve
More informationSetting The setting was secondary care. The economic analysis was carried out in Canada.
Allogeneic stem cell transplantation: an economic comparison of bone marrow, peripheral blood, and cord blood technologies Jacobs P, Hailey D, Turner R, MacLean N Record Status This is a critical abstract
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationSupplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
More informationExtramedullary precursor T-lymphoblastic transformation of CML at presentation
Extramedullary precursor T-lymphoblastic transformation of CML at presentation Neerja Vajpayee, Constance Stein, Bernard Poeisz & Robert E. Hutchison Clinical History 30 year old man presented to the emergency
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationBLOOD. EEI n: t.ee# Required Name : Due : April 12,2018 COMPOSITION AND FUNCTIONS OF BLOOD. Beginningof Class
t.ee# Required Name : Due : April 12,2018 Beginningof Class BLOOD Blood, the "life fluid" that courses through the body's blood vessels, provides the means by which the body's cells receive vital nutrients
More informationBlood Physiology. Rodolfo T. Rafael, M.D.,CFP
Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the
More informationNon-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice
Non-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice Samit Ghosh 1,2, Chibueze A. Ihunnah 2, Rimi Hazra 2, Aisha L. Walker 2, Jason M. Hansen 3, David R. Archer 4,
More informationIntroduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria
Introduction to Haematology Prof Roger Pool Department of Haematology University of Pretoria Suggested reading Haematology at a Glance Atul Mehta & Victor Hoffbrand Second Edition Published by Blackwell
More informationThe fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix
Blood In Detail The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix (blood plasma). The formed elements
More informationFlow cytometry leukocyte differential : a critical appraisal
Flow cytometry leukocyte differential : a critical appraisal Francis Lacombe Flow cytometry department University Hospital of Bordeaux, Pessac, France francis.lacombe@chu-bordeaux.fr 2008 HORIBA ABX, All
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationMyeloproliferative Disorders - D Savage - 9 Jan 2002
Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationXIV. HLA AND TRANSPLANTATION MEDICINE
XIV. HLA AND TRANSPLANTATION MEDICINE A. Introduction 1. The HLA system includes a complex array of genes and their molecular products that are involved in immune regulation and cellular differentiation.
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More information#2 - Hematology I Blood Typing
#2 - Blood Typing Objectives: Learn the theory behind blood typing Be able to perform simulated blood typing and analysis Understand the theory behind blood transfusions (donors and recipients) Observe
More informationPrecision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100
Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 R. HERKLOTZ and A. R. HUBER Zentrum für Labormedizin, Kantonsspital Aarau, 5001 Aarau, Switzerland. The automated leukocyte(wbc)
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationHematopoiesis Simplified: Part 1 Erythropoiesis
Hematopoiesis Simplified: Part 1 Erythropoiesis Larry Johnson Texas A&M University Hematopoiesis Simplified: Part 1 Erythropoiesis Objectives are to: Identify the developmental cells of erythropoiesis
More informationBlood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume.
11 Blood FOCUS: Blood consists of plasma and formed elements. The plasma is 91% water with dissolved or suspended molecules, including albumin, globulins, and fibrinogen. The formed elements include erythrocytes,
More informationVETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION
VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal
More informationSupplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
More informationHematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte-macrophage colonystimulating factor (G-CSF).
Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte colony-stimulating factor(g-csf). Granulocyte-macrophage colonystimulating factor (G-CSF). Interleukin-11
More information