Expanded View Figures

Size: px
Start display at page:

Download "Expanded View Figures"

Transcription

1 The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al Expanded View Figures x E3 cells/µl W g/l HG x e3 cells/µl PLT % of cell type 8 day 8 month % of cell type 8 day 8 month 8 day 8 month 8 day 8 month wild-type Dnmt / D recipients recipients 3 recipients nor derived P cells erived P cells % do % donor week 8 week week 6 week week nor derived P cells % do. w post transplant 8 7w post transplant w post transplant D4R D3 Db Ly6G erived P cells % donor d week 8 week week 7 week D4R D3 Db Ly6G nor derived P cells % do erived P cells % donor d week 8 week week * D4R D3 Db Ly6G Figure EV. Peripheral blood cell counts. Total blood cell counts of wild-type and Dnmt / mice showing no significant differences. Total white blood cell counts, hemoglobin concentration, and platelet cell counts of wild-type and Dnmt / mice (n = 3 mice per group). W: white blood cell counts; HG: hemoglobin; PLT: platelets. Lineage distribution of peripheral blood analyzed by the DVI hematology analyzer system. RETI: reticulocytes; NEUT: neutrophiles; LYMPH: lymphocytes; MONO: monocytes; EOS: eosinophiles; SO: basophiles; LU: large unstained cells. Giemsa staining of a representative femoral section from 4-month-old mice showing restoration of ossification defects. Scale bar: lm. D Stable engraftment (upper panels) and multi-lineage reconstitution (lower panels) in wild-type and Dnmt / recipient mice. Donor chimerism is indicated by D4. expression of peripheral blood (P) cells using flow cytometry. Peripheral blood was collected monthly and analyzed for engraftment and lineage distribution (Db: macrophages; Ly6G: granulocytes; D4R: cells; D3: T cells). Data information: Data are presented as mean SD. sterisks indicate statistically significant (P <., t-test) differences. EV The EMO Journal ª The uthors

2 Francesca Tuorto et al Dnmt regulates translational fidelity The EMO Journal Figure EV. nalysis of protein synthesis rates. nalysis of total protein synthesis in primary bone marrow stromal and haematopoietic cells by pulse-labeling with 3 H-Gly. s a negative control, protein synthesis was blocked in wild-type cells by treatment with lm sodium arsenite (so 3 ). Results were obtained from three independent experiments, and error bars represent standard deviations. Representative polysome profiles from Dnmt / and control primary bone marrow culture. Haematopoietic cells growing in suspension (ss) and attached stromal (st) cells were independently harvested and showed a higher proteins synthesis rate. s a measure for the global rate of translation, the fraction of polysomal ribosomes was quantified from polysome profiles. Results are shown for two independent biological replicates, and error bars represent standard deviations. ce at 4 nm (U) ss st - ss - st bsorba time on Polysomal fracti ss -ss st -st ª The uthors The EMO Journal EV

3 The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al difference % codon frequency difference codon frequency Figure EV3. Regulation of codon fidelity. Heatmaps showing the significant codon biases in Dnmt down-regulated proteins in the DML dataset. n increase of a codon frequency relative to the average frequency of that codon in all identified proteins is displayed in red, whereas a reduction is depicted in green. odons showing no deviation from average values are displayed in white according to the scale provided in the figure. Heatmaps showing codon biases in all protein datasets. hanges of codon frequencies relative to the average frequency of the indicated codon are displayed according to the scale provided in the figure. EV3 The EMO Journal ª The uthors

4 Francesca Tuorto et al Dnmt regulates translational fidelity The EMO Journal Log footprint density (RPKM) Spearman correlation =.96 M SS Log footprint density (RPKM) Spearman correlation =.94 M SS Log footprint density (RPKM) replicate Log footprint density (RPKM) replicate Log footprint density (RPKM) Spearman correlation =.9 M ST Log footprint density (RPKM) replicate Log footprint density (RPKM) Spearman correlation =.9 M SS rrn aligned unaligned Log footprint density (RPKM) replicate replicate SS SS ST ST SS SS ST ST read counts [x 4 ] 3 9,, 8,, number of reads D read counts [x 4 ] position from start [nt] position from start [nt] Figure EV4. Reproducibility and quality control of ribosome profiling. orrelation between ribosome profiling dataset replicates. Haematopoietic cells growing in suspension (ss) and attached stromal cells (st) were independently harvested. Mapping results from the two independent ribosome profiling replicates. Representative metaplot of wild-type haematopoietic (ss) cells. 8-mer ribosome footprint reads were summed across all start codons. D Representative in-frame 8-mer ribosome footprint abundance in wild-type haematopoietic (ss) cells showing the correct periodicity. ª The uthors The EMO Journal EV4

5 The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al k-s test P-value:.8E-3 GU Log codon occupancy at site k-s test P-value:4.9E- GU Log codon occupancy at site k-s test P-value:.7E-9 G k-s test P-value:3.E- G Log codon occupancy at site Log codon occupancy at site k-s test P-value:.E-6 GG k-s test P-value: 4.E-3 GG Log codon occupancy at site Log codon occupancy at site Fraction of codon ns k-s test P-value:.3E-8 GUU st Fraction of codon ns k-s test P-value:.6E- GUU Log codon occupancy at site Log codon occupancy at site ss P-values codon occupancy GG Glu G GU sp G GG -Gly GUU -Val others st P ss P Log / P P P ll Down Up Figure EV. Single-codon occupancy metric shows that differences in ribosome footprint occupancy at Dnmt target codons are statistically significant. Heatmap of P-values (Kolmogorov Smirnov test) for all sense codons in wild-type and Dnmt / ribosome and P sites. The two biological replicates of each cell type were pooled. : ribosomal -site; P: ribosomal P-site; st: stromal cells, ss: suspension cells. umulative distributions of single-codon occupancy for select codons in wild-type and Dnmt / stromal (st) and suspension (ss) cells. hanges in bulk codon occupancy in Dnmt / bone marrow suspension cells versus wild-type cells. Dnmt target codons and Glu codons are highlighted with the indicated colors. The two biological replicates of each cell type were pooled. : ribosomal -site; P: ribosomal P-site. EV The EMO Journal ª The uthors

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre

More information

Expanded View Figures

Expanded View Figures Gregory T Ellis et al Lung damage by monocyte TRIL allows coinfection EMO reports Expanded View Figures % survival Clinical score Influenza Matrix /HPRT (log ) CFU/L (log ) 3 irway early.7.7 + h Survival

More information

Expanded View Figures

Expanded View Figures EMO Molecular Medicine Proteomic map of squamous cell carcinomas Hanibal ohnenberger et al Expanded View Figures Figure EV1. Technical reproducibility. Pearson s correlation analysis of normalised SILC

More information

Blood Cells Med Terms Quiz

Blood Cells Med Terms Quiz Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:

More information

Supplementary material page 1/10

Supplementary material page 1/10 Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base

More information

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values

More information

HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM

HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM Login: http://histopath.westernu.edu Histology Atlas AND Virtual Histology links. I. HEMATOLOGY - PERIPHERAL BLOOD Purpose: To be able to identify

More information

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed

More information

LUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE. 1. European Institute of Oncology, Department of Experimental Oncology,

LUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE. 1. European Institute of Oncology, Department of Experimental Oncology, Supplementary information LUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE MARROW RECONSTITUTION WITH k-ras V12 CELLS. Elena Belloni 1*, Ines Martin Padura 2#*, Elvira Gerbino 1, Stefania Orecchioni

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis. Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected

More information

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages

More information

Complete Blood Count PSI AP Biology

Complete Blood Count PSI AP Biology Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

Transfer protocol of human HSC into NOG mice

Transfer protocol of human HSC into NOG mice Transfer protocol of human HSC into NOG mice Mice: Adult NOG mice are aged 8-12 weeks. Newborn mice are 1 2 days old. 8-12 week old NOG mice irradiated with 2.5 Gy Intravenous transfer of 1-0.5 x 10 5

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood. Multiple Choice

Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood. Multiple Choice Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood Multiple Choice 1) The matrix of blood is called: A) buffy coat B) plasma C) erythrocytes D) lymphocytes E) formed elements Diff: 1 Page

More information

The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System

The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage

More information

Summary of Changes Page BMT CTN 1205 Protocol Amendment #4 (Version 5.0) Dated July 22, 2016

Summary of Changes Page BMT CTN 1205 Protocol Amendment #4 (Version 5.0) Dated July 22, 2016 Page 1 of 8 Date: July 22, 2016 Summary of Changes Page BMT CTN 1205 Protocol #4 Dated July 22, 2016 The following changes, and the rationale for the changes, were made to the attached protocol in this

More information

Bone marrow transplantation for PID

Bone marrow transplantation for PID BMT Bone marrow transplantation for PID hello@piduk.org 0800 987 898 www.piduk.org About this leaflet Bone marrow transplant (BMT; also known as haematopoietic stem cell transplant or HSCT) is increasingly

More information

Supplementary Information

Supplementary Information Supplementary Information Distinct bone marrow-derived and tissue resident macrophage lineages proliferate at key stages during inflammation. 1 Luke C. Davies, 1 Marcela Rosas, 2 Stephen J. Jenkins, 1

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Supporting Information

Supporting Information Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary

More information

Chapter 21 Outline. General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements

Chapter 21 Outline. General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements Chapter 21 Outline General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements Introduction Blood serves many functions. Some examples

More information

CELL-DYN 3700 Strength in Technology, Proven Reliability

CELL-DYN 3700 Strength in Technology, Proven Reliability CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

LAB TIME/DATE. 1. most numerous leukocyte. 3. also called an erythrocyte; anucleate formed element. 6. ancestral cell of platelets

LAB TIME/DATE. 1. most numerous leukocyte. 3. also called an erythrocyte; anucleate formed element. 6. ancestral cell of platelets ighapmlre29apg245_250 5/12/04 2:46 PM Page 245 impos03 302:bjighapmL:ighapmLrevshts:layouts: NAME Blood LAB TIME/DATE REVIEW SHEET exercise 29A Composition of Blood 1. What is the blood volume of an average-size

More information

4. TEXTBOOK: ABUL K. ABBAS. ANDREW H. LICHTMAN. CELLULAR AND MOLECULAR IMMUNOLOGY. 5 TH EDITION. Chapter 2. pg

4. TEXTBOOK: ABUL K. ABBAS. ANDREW H. LICHTMAN. CELLULAR AND MOLECULAR IMMUNOLOGY. 5 TH EDITION. Chapter 2. pg LECTURE: 03 Title: CELLS INVOLVED IN THE IMMUNE RESPONSE LEARNING OBJECTIVES: The student should be able to: Identify the organs where the process of the blood formation occurs. Identify the main cell

More information

Genetic information flows from mrna to protein through the process of translation

Genetic information flows from mrna to protein through the process of translation Genetic information flows from mrn to protein through the process of translation TYPES OF RN (RIBONUCLEIC CID) RN s job - protein synthesis (assembly of amino acids into proteins) Three main types: 1.

More information

Blood. Water compartments

Blood. Water compartments Blood Water compartments 2/8 about 60% of our body is water (young-old, male-female) water is located in compartments, movement is regulated intracellular : extracellular 2:1, i.e. 40:20% interstitial

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12391 Table 1. Binding of A(H7N9) viruses to individual glycan structures. # Structure a Anhui1 Shanghai1 1 Neu5Acα nb nb 2 Neu5Acα ++ nb 3 Neu5Acβ nb nb 4 Neu5Acα2-3(6-O-Su)Galβ1-4GlcNAcβ

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Chronic variable stress activates hematopoietic stem cells

Chronic variable stress activates hematopoietic stem cells SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur

More information

SUPPLEMENTARY APPENDIX

SUPPLEMENTARY APPENDIX SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Histocompatibility. HLA Serologic Typing (Class I/II) ABO, HLAS, HLAS Surveys & Anatomic Pathology Education Programs

Histocompatibility. HLA Serologic Typing (Class I/II) ABO, HLAS, HLAS Surveys & Anatomic Pathology Education Programs www.cap.org Histocompatibility Analytes/procedures in bold type are regulated for proficiency testing by the Centers for Medicare & Medicaid Services (CMS). HLA Serologic Typing (Class I/II) ABO, HLAS,

More information

Leukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University

Leukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University Leukocytosis dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University My first day at work in 1997 3y with fever, cough Is this bronchitis, pneumonia, pharyngitis, sinusitis, else? Is this

More information

Formation of Blood Cells

Formation of Blood Cells Hematopoiesis Lecture Objectives Name organs responsible for hematopoiesis in the fetus. List the developmental stages of hematopoiesis both prenatally and postnatally. Outline the major steps of post

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Aquaporin-9-expressing neutrophils are required for the establishment of contact hypersensitivity

Aquaporin-9-expressing neutrophils are required for the establishment of contact hypersensitivity Supplemental Material quaporin-9-expressing neutrophils are required for the establishment of contact hypersensitivity atharina Sagita Moniaga 1, Sachiko Watanabe 1, Tetsuya Honda 1, 2, Søren Nielsen 3,

More information

Brief Communication Diagnostic Hematology

Brief Communication Diagnostic Hematology Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy

More information

Performance evaluation of Celltac G: a new automated hematology analyzer

Performance evaluation of Celltac G: a new automated hematology analyzer Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo

More information

I. Concepts: Fill in the following sections with information from the text and lecture.

I. Concepts: Fill in the following sections with information from the text and lecture. Name: Period: 10 Blood Study Guide I. Concepts: Fill in the following sections with information from the text and lecture. 1. Composition and Function of Blood: 2. Hematopoiesis: 1 Miss School, Miss Out

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Medical School Histology Basics Introduction to Microscopy. VIBS 289 lab

Medical School Histology Basics Introduction to Microscopy. VIBS 289 lab Medical School Histology Basics Introduction to Microscopy VIBS 289 lab Larry Johnson Texas A&M University Objectives Learn the difference in magnification and resolution Learn about different types of

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

Nature Genetics: doi: /ng.3812

Nature Genetics: doi: /ng.3812 Nature Genetics: doi:10.1038/ng.3812 Supplementary Figure 1 Smarcd2-knockout mice die perinatally with impaired energy homeostasis. (a) Generation of the Smarcd2 conditional knockout allele. Deletion of

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

Haematopoietic stem cells

Haematopoietic stem cells Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)

More information

Chapter 13 The Blood

Chapter 13 The Blood Chapter 13 The Blood Copyright 2015 Wolters Kluwer Health Lippincott Williams & Wilkins Overview Key Terms agglutination erythrocyte lymphocyte albumin fibrin megakaryocyte anemia hematocrit monocyte antigen

More information

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly

More information

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs 1 BIO 212: ANATOMY & PHYSIOLOGY II LAB BLOOD PLATES EOSINOPHIL Contains large red-staining granules Usually 2 lobes 12-17 µm: about the size of neutrophils (2X erythrocytes) regulation/reduction of Histamine.

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Monocyte subsets in health and disease. Marion Frankenberger

Monocyte subsets in health and disease. Marion Frankenberger Monocyte subsets in health and disease Marion Frankenberger main cellular components: Leukocytes Erythrocytes Composition of whole blood Monocytes belong to the cellular components of peripheral blood

More information

five lineages of stem cells producing all of the various formed elements.

five lineages of stem cells producing all of the various formed elements. Chapter 6 Blood Tissue 6.1. Basic Composition of Blood Blood is a connective tissue composed of free cells in a fluid matrix. Unlike other types of connective tissues, blood lacks fibers except during

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

ONLINE SUPPLEMENTAL INFORMATION

ONLINE SUPPLEMENTAL INFORMATION 1 ONLINE SUPPLEMENTAL INFORMATION Small trna-derived RNAs are increased and more abundant than micrornas in chronic hepatitis B and C Sara R. Selitsky 1-3, Jeanette Baran-Gale 1,2, Masao Honda 4, Daisuke

More information

From the Diagnostic Immunology Laboratories

From the Diagnostic Immunology Laboratories Immunology Laboratories ISSUE 9 SPRING 2012 PAGE 1 Spring Meetings Please stop by and say hello in May at this year s American Society of Pediatric Hematology/Oncology (ASPHO) Annual Meeting in New Orleans

More information

Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat

Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat Supplementary Tables Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat condition, skin condition, weight, posture, mobility, and vitality are individually scored and summed to achieve

More information

Setting The setting was secondary care. The economic analysis was carried out in Canada.

Setting The setting was secondary care. The economic analysis was carried out in Canada. Allogeneic stem cell transplantation: an economic comparison of bone marrow, peripheral blood, and cord blood technologies Jacobs P, Hailey D, Turner R, MacLean N Record Status This is a critical abstract

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice. competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

More information

Extramedullary precursor T-lymphoblastic transformation of CML at presentation

Extramedullary precursor T-lymphoblastic transformation of CML at presentation Extramedullary precursor T-lymphoblastic transformation of CML at presentation Neerja Vajpayee, Constance Stein, Bernard Poeisz & Robert E. Hutchison Clinical History 30 year old man presented to the emergency

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

BLOOD. EEI n: t.ee# Required Name : Due : April 12,2018 COMPOSITION AND FUNCTIONS OF BLOOD. Beginningof Class

BLOOD. EEI n: t.ee# Required Name : Due : April 12,2018 COMPOSITION AND FUNCTIONS OF BLOOD. Beginningof Class t.ee# Required Name : Due : April 12,2018 Beginningof Class BLOOD Blood, the "life fluid" that courses through the body's blood vessels, provides the means by which the body's cells receive vital nutrients

More information

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the

More information

Non-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice

Non-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice Non-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice Samit Ghosh 1,2, Chibueze A. Ihunnah 2, Rimi Hazra 2, Aisha L. Walker 2, Jason M. Hansen 3, David R. Archer 4,

More information

Introduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria

Introduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria Introduction to Haematology Prof Roger Pool Department of Haematology University of Pretoria Suggested reading Haematology at a Glance Atul Mehta & Victor Hoffbrand Second Edition Published by Blackwell

More information

The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix

The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix Blood In Detail The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix (blood plasma). The formed elements

More information

Flow cytometry leukocyte differential : a critical appraisal

Flow cytometry leukocyte differential : a critical appraisal Flow cytometry leukocyte differential : a critical appraisal Francis Lacombe Flow cytometry department University Hospital of Bordeaux, Pessac, France francis.lacombe@chu-bordeaux.fr 2008 HORIBA ABX, All

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Myeloproliferative Disorders - D Savage - 9 Jan 2002

Myeloproliferative Disorders - D Savage - 9 Jan 2002 Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

XIV. HLA AND TRANSPLANTATION MEDICINE

XIV. HLA AND TRANSPLANTATION MEDICINE XIV. HLA AND TRANSPLANTATION MEDICINE A. Introduction 1. The HLA system includes a complex array of genes and their molecular products that are involved in immune regulation and cellular differentiation.

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

#2 - Hematology I Blood Typing

#2 - Hematology I Blood Typing #2 - Blood Typing Objectives: Learn the theory behind blood typing Be able to perform simulated blood typing and analysis Understand the theory behind blood transfusions (donors and recipients) Observe

More information

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 R. HERKLOTZ and A. R. HUBER Zentrum für Labormedizin, Kantonsspital Aarau, 5001 Aarau, Switzerland. The automated leukocyte(wbc)

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Hematopoiesis Simplified: Part 1 Erythropoiesis

Hematopoiesis Simplified: Part 1 Erythropoiesis Hematopoiesis Simplified: Part 1 Erythropoiesis Larry Johnson Texas A&M University Hematopoiesis Simplified: Part 1 Erythropoiesis Objectives are to: Identify the developmental cells of erythropoiesis

More information

Blood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume.

Blood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume. 11 Blood FOCUS: Blood consists of plasma and formed elements. The plasma is 91% water with dissolved or suspended molecules, including albumin, globulins, and fibrinogen. The formed elements include erythrocytes,

More information

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal

More information

Supplemental Figure 1. Protein L

Supplemental Figure 1. Protein L Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction

More information

Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte-macrophage colonystimulating factor (G-CSF).

Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte-macrophage colonystimulating factor (G-CSF). Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte colony-stimulating factor(g-csf). Granulocyte-macrophage colonystimulating factor (G-CSF). Interleukin-11

More information