PI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb

Size: px
Start display at page:

Download "PI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb"

Transcription

1 NEWSLETTER Version 1 From Research to Discovery PI3K / AKT / mtor Signalling Pathway in Cancer PI3K / AKT / mtor Related Antibodies from CovalAb CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

2 Amongst the numerous pathways implicated in cancer development, the PI3K/AKT/mTOR signalling pathway is highly active in cancer cells. Mutation or amplification of the PI3-kinase or AKT genes, as well as loss of function of PTEN protein, result in the activation of the mtor pathway, which is associated with a poor prognosis in cancer, and therapy resistance. Antibodies (60C10) Ms Hu, Ms, Rat IHC - P, WB mab (C-Terminus) Rb Rat, Hu, Ms... IHC - P, WB pab Rb Hu, Ms, Rat IHC - P, IP, WB pab Beta (aa1-246) (J2E9) Ms Hu ELISA, IHC - P, WB mab Beta (N-Terminus) Rb Hu, Ms, Rat IHC - P pab Beta (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab Beta Rb Hu, Zfi ICC, IF, IHC - P pab Beta Rb Hu, Zfi ICC, IF, IHC - P pab Beta Rb Hu, Ms, Rat IHC - P, WB pab Epsilon / YWHAE (aa1-255) (5A5) Ms Hu ELISA, IHC - P, WB mab Eta / YWHAH (N-Terminus) Rb Chick, Hu, Ms IHC - P, WB pab Gamma (KC21) Ms Hu, Ms, Rat WB mab Gamma / YWHAG (aa1-247) (J3H10) Ms Hu ELISA, IHC - P, WB mab Gamma (HS23) Ms Hu, Ms, Rat WB mab protein Sigma (Stratifin) Rb Hu, Ms, Rat ELISA, IHC, WB pab protein Sigma phosphoserine 248 (Stratifin-pSer248) Rb Hu ELISA, WB, IHC pab protein Zeta/Delta phosphoserine 184 (KCIP-1/pSer184) Rb Hu ELISA, WB, IHC pab Tau / YWHAQ (aa1-245) (AT1A1) Ms Hu ELISA, IHC - P, WB mab Zeta Delta / YWHAZ (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab Zeta Delta / YWHAZ (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab Zeta Delta / YWHAZ (pser58) Rb Hu, Ms, Rat IHC - P, WB pab72083 AKT Rb Hu, Ms, Rat IHC - P, IP, WB pab75231 AKT1 (C-Terminus) Rb Hu IHC - P, WB pab72125 AKT1 (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab70307 AKT1 (pser473) Rb Hu ELISA, IHC - P, WB pab70039 AKT1 (pthr308) Rb Hu ELISA, IHC - P, WB pab70040 AKT1 (pthr308) Rb Hu, Ms, Rat IHC - P, WB pab71951 AKT1 Rb Hu, Ms, Rat WB, IHC, IF... pab80597 AKT1 Rb Hu, Rat, Ms ELISA, WB, IHC pab0895-p AKT1 pser473 Rb Hu, Rat, Ms ELISA, WB pab0834-p AKT1 pthr308 Rb Hu, Rat, Ms ELISA, WB pab0832-p AKT1 pthr450 Rb Hu, Rat, Ms ELISA, WB pab0833-p AKT1/2/3 (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74277 AKT2 (1B6) Ms Hu, Mk, Rat IF, IHC - P, WB... mab70099 AKT3 (aa ) (66C1247.1) Ms Hu, Ms, Rat IHC - P, WB mab70131 AKT3 (aa ) Rb Hu, Ms, Rat IHC - P, WB pab74591 AKT3 (Internal) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72934 AKT3 (N-Terminus) Rb Hu, Ms IHC - P, WB pab70308 ATG13 (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab Beta pab Gamma mab50036 AKT1(pSer473) pab70039 Anti Beta ICC staining (in green) of HeLa cells. Immunocytochemistry of paraformalhehydefixed cells. DAPI in blue. Anti Gamma western blot staining of lane 1 : HeLa cell lysate lane 2 & 3 : bengamide treated (8h) cell lysate. Anti-AKT1 IHC staining of human skeletal muscle. Immunohistochemistry of formalin-fixed paraffinembedded tissue after heat-induced antigen retrieval. CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

3 REFERENCES 1. Yuan TL and Cantley LC. PI3K pathway alterations in cancer: variations on a theme Oncogene 27: Yang WL et al. Regulation of Akt signaling activation by ubiquitination Cell Cycle 9: Zhao B. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control Genes Dev 21: Sakamaki JI et al. Arginine methylation of BCL-2 antagonist of cell death (BAD) counteracts its phosphorylation and inactivation by Akt PNAS 108: Takahashi-Yanaga F and Sasaguri T. GSK-3beta regulates cyclin D1 expression: a new target for chemotherapy Cell Signal 20: Wullschleger S et al. TOR signaling in growth and metabolism Cell 124: De Benedetti A and Graff JR. eif-4e expression and its role in malignancies and metastases Oncogene 23: Wade M et al. The p53 orchestra: Mdm2 and Mdmx set the tone Trends Cell Biol 20: Chipuk JE et al. Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis Science 303: Fu Z and Tindall DJ. FOXOs, cancer and regulation of apoptosis Oncogene 27: CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0) ABBREVIATIONS Akt = protein kinase B; BAD = Bcl-2-associated death promoter; Bax = Bcl2-associated X protein; Bcl-2 = B-cell lymphoma protein-2; Bim = BH3-only protein; Cyclin D1 = G1/S-specific cyclin-d1; eif4ebp1 = eukaryotic translation initiation factor 4E-binding protein 1; FoxO1 = forkhead box protein O1; GAB2 = GRB2-associated-binding protein 2; Grb2 = growth factor receptor-bound protein 2; GSK3 = glycogen synthase kinase 3; IRS-1 = insulin receptor substrate 1; Mdm2 = mouse double-minute 2 protein; mlst8/gβl = mammalian lethal with SEC13 protein 8/G protein beta subunit-like; mtor = mammalian target of rapamycin; mtorc1 = mammalian target of rapamycin complex 1; mtorc2 = mammalian target of rapamycin complex 2; PDCD4 = programmed cell death protein 4; PDK1 = 3-phosphoinositide-dependent protein kinase 1; PI3K = phosphatidylinositol 3 kinase; PRR5 = proline-rich protein 5; PTEN = phosphatase and tensin homolog; p27kip1 = cyclin-dependent kinase inhibitor 1B; p53 = tumor protein 53; Rheb = Ras homolog enriched in brain; RTK = receptor tyrosine kinase; XIAP = X-linked inhibitor of apoptosis; YAP = Yes-Associated Protein/ Yorkie homolog. CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

4 Antibodies BAD pab80585 Bim mab70713 CCND1 pab70552 Anti-BAD IF staining of rat thymus. Anti-BCL2L11/Bim IHC staining of human heart. Immunohistochemistry of formalinfixed, paraffin-embedded tissue after heatinduced antigen retrieval. Anti-Cyclin D1 IF staining (in green) of HeLa cells. Actin filaments in red. ATG13 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab81118 BAD (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab80585 BAD (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab74999 BAD (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74258 BAD (Internal) Rb Hu, Ms, Rat ELISA, IHC - P pab74329 BAD (N-Terminus) (BYC001) Ms Ms, Hu IHC - P, IP, WB mab70326 BAD (pser112) Rb Hu, Ms, Rat IHC - P, WB pab71955 BAX (6A7) Ms Hu, Ms, Rat IHC - P, IP, WB mab71211 BAX (Internal) Rb Hu, Ms, Rat ELISA, IF, IHC - P pab73965 BAX (N-Terminus) Rb Ms, Hu, Rat IHC - P, IP, WB pab74913 BAX (N-Terminus) Rb Hu ICC, IHC - P, WB pab74874 BAX Rb Hu WB, ICC, IF... pab80303 BCL2 / Bcl-2 (11C5) Ms Hu IHC - P, IP, WB mab71374 BCL2 / Bcl-2 (aa41-54) Ms Hu FC, IF, IHC - P mab70328 BCL2 / Bcl-2 (Internal) Rb Hu, Ms, Rat IF, IHC - P, WB... pab73966 BCL2 / Bcl-2 (pser70) Rb Hu IHC - P pab71957 BCL2 / Bcl-2 (pthr56) Rb Hu IHC - P, WB pab71956 BCL2 / Bcl-2 Rb Hu IHC - P, WB pab75275 BCL2 Rb Hu ELISA, WB, ICC pab80216 BCL2 Rb Hu, Ms WB, IHC, IF... pab80584 Bim / BCL2L11 (Internal) Rb Hu, Ms, Rat ICC, IHC - P, WB pab70412 Bim / BCL2L11 (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab74063 Bim Ms Hu, Ms, Rat WB, ICC, IF... mab80032 Bim Rb Hu, Ms, Rat ELISA, WB, IHC pab80416 Bim Rb Hu, Ms, Rat WB, ICC, IF... pab80307 CCND1 / Cyclin D1 (CD1.1) Ms Hu, Rat FC, ICC, IHC - F mab70713 CCND1 / Cyclin D1 (Ser90) Rb Hu, Ms IF, IHC - P, WB... pab70552 CDKN1B / p27 Kip1 (4B4-E6) Ms Hu IF, IHC - P, WB... mab70794 CDKN1B / p27 Kip1 (C-Terminus) Rb Hu, Ms, Rat IHC - P, IP, WB pab73599 CDKN1B / p27 Kip1 (C-Terminus) Rb Hu, Ms, Rat IHC - P, IP, WB pab74928 CDKN1B / p27 Kip1 (Internal) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72942 CDKN1B / p27 Kip1 (pthr187) Rb Hu ELISA, IHC - P, WB pab70627 CDKN1B / p27 Kip1 (pser10) Rb Hu, Ms, Rat IHC - P, WB pab72061 CDKN1B / p27 Kip1 Rb Hu IHC - P, WB pab74994 EIF4B (aa ) Rb Hu, Ms, Rat... IHC - P, WB pab74158 EIF4B (aa ) Rb Hu, Mk, Ms IHC - P, WB pab74169 EIF4B (pser422) Rb Hu ELISA, IHC - P, WB pab CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

5 Antibodies EIF4EBP1 pab70848 FOXO1 pab74237 mtor pab74323 Anti-EIF4EBP1/4EBP1 IHC staining of human prostate. Immunohistochemistry of formalin-fixed paraffin-embedded tissue after heat-induced antigen retrieval. Anti-FOXO1 western blot staining of HeLa cell lysate. Anti-MTOR IHC staining of human testis. Immunohistochemistry of formalin-fixed, paraffinembedded tissue after heat-induced antigen retrieval. EIF4E (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74060 EIF4E (N-Terminus) Rb Hu IHC - P, WB pab72277 EIF4EBP1 / 4EBP1 (aa ) Rb Hu, Ms, Rat GS, IHC - P, WB pab72829 EIF4EBP1 / 4EBP1 (C-Terminus) Rb Hu ICC, IHC - P, WB pab70848 EIF4EBP1 / 4EBP1 (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74250 EIF4EBP2 / 4EBP2 (aa99-120) Rb Hu, Ms, Rat IHC - P, WB pab72830 EIF4ENIF1 (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72332 FOXO1 (aa ) (7H3) Ms Hu IHC - P, WB mab70133 FOXO1 (C-Terminus) Goat Hu, Ms, Rat... IHC - P pab73015 FOXO1 (Internal) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74237 FOXO1 (N-Terminus) Rb Hu, Ms, Rat WB, ICC, IF... pab81123 FOXO1 (N-Terminus) Rb Hu, Ms, Rat ICC, IHC - P, WB pab70979 FOXO1 (pser256) Rb Hu, Ms, Rat IHC, IHC - P, WB pab73083 GAB2 (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74281 Glycogen synthase kinase-3 Rb P. fals. ELISA, IHC, WB pab0250 Glycogen synthase kinase-3 Beta 2 Rb Hu ELISA, WB, IF pab0668 GRB2 (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab73178 GRB2 (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72922 GRB2 Rb Hu IHC - P, WB pab72987 GSK3B / GSK3 Beta (C-Terminus) Rb Hu, Ms, Rat IHC, IHC - P, WB pab75210 GSK3B / GSK3 Beta (pser9) Rb Hu GS, IF, IHC - P pab70152 GSK3B / GSK3 Beta Rb Rat, Hu, Ms IF, IHC - P, WB pab75234 IRS1 (aa ) Rb Hu, Ms, Rat IHC - P pab72749 IRS1 (C-Terminus) Rb Hu IHC - P, WB pab72768 IRS1 (Internal) Rb Hu, Ms, Rat ELISA, IF, IHC - P pab73796 IRS1 (Internal) Rb Hu, Ms ICC, IHC - P, WB pab71542 IRS1 Rb Hu, Ms WB, ICC, IF... pab80318 MDM2 (1A7) Ms Hu ELISA, IHC - P, WB mab70863 MDM2 (aa ) (SMP14) Ms Hu, Ms IHC, IHC - F, IP mab71411 MDM2 (aa ) Rb Ms ELISA, IHC - P, WB pab70162 MDM2 (pser185) Rb Ms ELISA, IHC - P, WB pab70163 MDM2 (pser395) Rb Hu ELISA, IHC - P pab71722 MDM4 / MDMX (2D10F4) Ms Hu ELISA, IF, IHC, WB mab70075 MLST8/ GBL (aa ) Rb Hu, Ms, Rat IHC - P, WB pab74502 MLST8/ GBL (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab71043 mtor (aa ) Rb Hu, Ms, Rat IF, IHC - P, WB... pab70158 mtor (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

6 Antibodies mtor (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74267 mtor (N-Terminus) Rb Hu, Ms ICC, IHC - P, WB pab71788 mtor (pser2448) Rb Hu ELISA, IHC - P, WB pab70076 mtor Rb Hu, Ms ELISA, WB, IHC pab0894-p p53 / TP53 (Acetyl-Lys379) Rb Hu, Ms, Rat ELISA, IF, IHC - P pab73997 p53 / TP53 (C-Terminus) Rb Hu IF, IHC - P, WB... pab74272 p53 / TP53 (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74392 p53 / TP53 (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74391 p53 / TP53 (N-Terminus) Rb Hu, Rat ELISA, IHC - P, WB pab74269 p53 / TP53 (N-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74271 p53 / TP53 Ms Hu ELISA, IHC - P, IP, WB mab70600 p53 (H53C2) Ms Hu ELISA, WB, IHC, IP mab0052-p p53r2 Rb Hu, Ms, Rat WB, IHC, IF... pab80536 PDCD4 (aa1-469) (K4C1) Ms Hu ELISA, IHC - P, WB mab70283 PDCD4 (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab70157 PDCD4 (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab72099 PDCD4 (C-Terminus) Rb Hu, Ms, Rat ELISA, WB, IHC pab80473 PDCD4 (pser457) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab70146 PDCD4 Rb Hu, Ms, Rat IHC - P, WB pab75081 PHLPP1 (N-Terminus) Rb Hu ELISA, WB pab81508 PHLPP2 (C-Terminus) Rb Hu ELISA, WB pab81509 PI 3 Kinase p110 Delta (aa ) Rb Hu IHC - P, WB pab72240 PIK3C2A (3E7) Ms Hu ELISA, IHC - P, WB mab71053 PIK3CA (Internal) Goat Hu, Ms, Rat ELISA, IHC - P pab72400 Protor-1 / PRR5 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab81287 Protor-1 / PRR5 (C-Terminus) Rb Hu IHC - P, WB pab72514 Protor-2 / PRR5L Rb Hu ELISA, IHC, WB pab0500 Protor-2 / PRR5L Rb Hu, Ms WB, ICC, IF... pab81288 PRR5 (C-Terminus) Rb Hu IHC - P, WB pab72514 PRR5 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab81287 PTEN (C-Terminus) Rb Hu, Ms ELISA, WB pab80085 PTEN (N-Terminus) Rb Hu, Ms ELISA, WB, IF pab80388 PDK1 Rb Hu, Ms, Rat... IHC - P, WB pab75233 PDK1 Rb Hu ELISA, IHC - P, WB pab75048 Pyruvate dehydrogenase kinase (PDK1) [Biotin] Rb Hu WB pab50698 Pyruvate dehydrogenase kinase (PDK1) [Biotin] Rb Hu WB pab50692 Pyruvate dehydrogenase kinase (PDK1) [DyLight 488] Rb Hu WB pab50700 p53(h53c2) mab0052 PI3K p110 Delta pab72240 PDK1 pab75233 Immunoprecipitation of p53 mutated forms stably expressed in the p53 null HEp3B cell line: lane 1: Hep3B - lane 2: Hep3B143 lane 3: Hep3B248 - lane 4: Hep3B249. Anti-PI3 kinase p110 Delta IHC staining of human placenta, neutrophils. Immunohistochemistry of formalin-fixed, paraffin-embedded tissue after heatinduced antigen retrieval. Anti-PDK1 western blot staining of lysate from: lane 1: MWM cell, lane 2: HeLa cell, lane 3: rat brain, lane 4: mouse brain, lane 5: Vero cell, lane 6: ESK-4 cell, lane 7: RK-13 cell, lane 8: MDCK cell. CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

7 Antibodies Pyruvate dehydrogenase kinase (PDK1) [DyLight 488] Rb Hu WB pab50694 Pyruvate dehydrogenase kinase (PDK1) [DyLight 550] Rb Hu WB pab50702 Pyruvate dehydrogenase kinase (PDK1) [DyLight 550] Rb Hu WB pab50696 Pyruvate dehydrogenase kinase (PDK1) [DyLight 650] Rb Hu WB pab50699 Pyruvate dehydrogenase kinase (PDK1) [DyLight 650] Rb Hu WB pab50693 Pyruvate dehydrogenase kinase (PDK1) [HRP] Rb Hu WB pab50701 Pyruvate dehydrogenase kinase (PDK1) Rb Hu, Ms, Rat WB pab50211 Rheb (Internal) Rb Hu, Ms, Rat IHC - P, WB pab75117 Rheb (N-Terminus) Rb Hu, Ms, Rat ELISA, WB pab80082 Rheb Rb Hu, Ms, Rat IHC - P, WB pab72847 Rheb Rb Hu, Ms, Rat WB, IHC, IF pab80596 RICTOR (1F3) Ms Hu IHC - P, IP, WB mab71077 RICTOR (C-Terminus) Goat Hu, Ca, Ms ELISA, IHC - P pab74051 RPS6 (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab73900 RPS6 (pser235) Rb Hu, Ms, Rat IHC - P, WB pab72108 RPS6KB1 / S6K (C-Terminus) Rb Hu, Ms, Rat IHC - P, IP, WB pab70130 RPS6KB1 / S6K (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab73148 RPS6KB1 / S6K (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74280 RPS6KB1 / S6K (Internal) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74275 RPS6KB1 / S6K (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74363 RPS6KB1 / S6K (pser411) Rb Hu, Ms, Rat IHC - P, WB pab71965 RPTOR / Raptor (aa ) Rb Hu, Ms IHC - P, WB pab74797 RPTOR / Raptor (N-Terminus) Rb Hu, Ms ICC, IHC - P, WB pab72900 RPTOR / Raptor Rb Hu, Ms ICC, IHC - P, WB pab72901 RPTOR / Raptor Rb Hu IHC - P, WB pab72114 Serine / threonine-protein Phosphatase 2A (PP2A) Ms Hu, Ms IP, WB mab50072 SGK1 (1C4) Ms Hu IF, IHC - P, WB... mab70910 SGK1 (3C4) Ms Hu IF, IHC - P, WB... mab70911 SGK1 (3E3) Ms Hu IF, IHC - P, WB... mab70909 SGK1 (3G8) Ms Hu IF, IHC - P, WB... mab70912 SGK1 (aa ) Rb Hu ELISA, IHC - P, WB pab70167 SGK1 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF pab81299 SIN1 (aa ) Rb Hu, Ms, Rat IHC - P, WB pab73961 SIN1 (Internal) Rb Hu, Ms, Rat IHC - P, WB pab73206 SIN1 (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab73207 PDK1 pab50211 Rheb pab80596 RPTOR pab72114 Anti-PDK1 western blot staining of human heart lysate. Anti-Rheb IF staining of mouse brain cells. Anti-RPTOR IHC staining of human kidney. Immunohistochemistry of formalin-fixed, paraffinembedded tissue after heat-induced antigen retrieval. CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

8 Antibodies TSC1 pab73745 VPS43 pab50333 Yorkie homolog pab0848-p Anti-TSC1 IHC staining of human heart. Immunohistochemistry of formalin-fixed, paraffinembedded tissue after heat-induced antigen retrieval. Anti-VPS34 western blot staining of HepG2 cell lysate. Anti-YAP1 homolog staining of HeLa cells expressing YAP1. SIN1 / MAPKAP1 (N-Terminus) Rb Hu, Ms, Rat WB, IHC, IF pab80667 SIN1 / MAPKAP1 Rb Hu, Ms, Rat ELISA, WB, IHC pab80481 THEM4 / CTMP (Internal) Rb Hu, Ms, Rat IHC, IHC - P, WB pab73519 THEM4 / CTPM Rb Hu, Ms, Rat WB, IHC, IF pab80905 TSC1 (C-Terminus) Rb Hu, Ms ELISA, WB pab80083 TSC1 (C-Terminus) Rb Hu, Ms IHC - P, WB pab73744 TSC1 (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab73166 TSC1 Rb Hu, Ms, Rat WB, ICC, IF... pab80315 TSC1 Rb Hu, Ms, Rat ICC, IHC - P, WB pab73745 TSC2 (C-Terminus) Rb Hu, Ms ELISA, WB pab80084 TSC2 (N-Terminus) Rb Hu, Ms WB, ICC, IF... pab80316 TSC2 / Tuberin (C-Terminus) Rb Hu, Ms IHC - P, WB pab73746 TSC2 / Tuberin (N-Terminus) Rb Hu, Ms ICC, IHC - P, WB pab73747 TSC2 / Tuberin (pser664) Rb Hu IF, IHC - P pab74899 TSC2 / Tuberin (pthr1462) Rb Hu IF, IHC - P pab74900 TSC2 / Tuberin (pser1798) Rb Hu ELISA, IHC - P, WB pab73749 VPS34 Rb Hu, Ms, Rat... WB pab50333 VPS34 [Biotin] Rb Hu WB pab51579 VPS34 [DyLight 488] Rb Hu WB pab51581 VPS34 [DyLight 550] Rb Hu WB pab51583 VPS34 [DyLight 650] Rb Hu WB pab51580 VPS34 [HRP] Rb Hu WB pab51582 XIAP (C-Terminus) Rb Hu, Ms IHC - P, WB pab74231 XIAP Rb Hu ICC, IF, IHC - P pab73363 XIAP Rb Hu WB pab51048 Yorkie homolog (YAP1) (2F12) Ms Hu IF, IHC - P, WB... mab70705 YAP1 (2H1) Ms Hu IF, IHC - P, WB... mab70706 YAP1 Rb Hu IHC - P, WB, IP pab50282 YAP1 [Biotin] Rb Hu IHC - P, IP, WB pab51306 YAP1 [DyLight 488] Rb Hu IHC - P, IP, WB pab51308 YAP1 [DyLight 550] Rb Hu IHC - P, IP, WB pab51310 YAP1 [DyLight 650] Rb Hu IHC - P, IP, WB pab51307 YAP1 [HRP] Rb Hu IHC - P, IP, WB pab51309 YAP1 Rb Hu WB, IHC, IF pab0848-p CovalAb - 11 avenue Albert Einstein VILLEURBANNE - France Tel: +33 (0)

9 Custom Services Custom Polyclonal Antibodies Development Anti-Protein Anti-Peptide Anti-Post-Translational Modification Custom Monoclonal Antibodies Development Monoclonal Antibody Production In vivo In vitro Expertise Advices for projects design and optimisation of R&D processes Customised technical troubleshooting support Active follow-up of projects Peptide Synthesis Antibody Purification Biomolecule Labelling Development of Immunoaffinity Supports (columns) Functionalisation of Solid Phases (microtitration plates) From Research to Discovery Our range of products constantly increases, but if you don t find the antibody you re looking for in our catalog, we can develop it for you. Our services allow you to create a custom antibody that meets your needs. So contact us by phone at +33 (0) or submit your enquiries at: enquiries@covalab.com. CovalAb 11 avenue Albert Einstein VILLEURBANNE - FRANCE Tel: +33 (0) Fax: +33 (0) s: for order: orders@covalab.com - for information: enquiries@covalab.com

10 PI3K/AKT/mTOR Signaling Pathway in Cancer Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0) T BE +32 (0) Begonialaan 3a F NL +31 (0) F BE +32 (0) TE Huissen E info@bio-connect.nl The Netherlands W

PI3K-Akt-mTOR. Signalling pathway in cancer PI3K-Akt-mTOR-related products from Covalab

PI3K-Akt-mTOR. Signalling pathway in cancer PI3K-Akt-mTOR-related products from Covalab From Research to Discovery PI3K-Akt-mTOR Signalling pathway in cancer PI3K-Akt-mTOR-related products from Covalab www.covalab.com Covalab 69100 VILLEURBANNE France Tel: +33(0) 437.654.230 PI3K-Akt-mTOR

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

Interrogating mtor Inhibition in Patients with HRPC

Interrogating mtor Inhibition in Patients with HRPC Interrogating mtor Inhibition in Patients with HRPC Daniel George, John Madden, Andrew Armstrong, Mark Dewhirst, Nancy Major, and Phillip Febbo Divisions of Medical Oncology, Urology, Pathology, Radiology,

More information

Antibodies for Unfolded Protein Response

Antibodies for Unfolded Protein Response Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Phosphorylation Site Company Cat #

Phosphorylation Site Company Cat # Supplemental Table 1. Antibodies used for RPPA analysis. Label Protein Phosphorylation Site Company Cat # Used on MDA_CLSS Used on MDA_Pilot 4EBP1 4EBP1 Cell Signaling 9452 No 4EBP1.pS65 4EBP1 S65 Cell

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have

More information

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855 Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,

More information

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28 A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF

More information

PI3K-Akt-mTOR Pathway, Flyer

PI3K-Akt-mTOR Pathway, Flyer PI3K-Akt-mTOR Pathway, Flyer Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44

More information

Anti-Lamin B1/LMNB1 Picoband Antibody

Anti-Lamin B1/LMNB1 Picoband Antibody Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins

More information

FACTORS AFFECTING SKELETAL MUSCLE PROTEIN SYNTHESIS IN THE HORSE

FACTORS AFFECTING SKELETAL MUSCLE PROTEIN SYNTHESIS IN THE HORSE University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2011 FACTORS AFFECTING SKELETAL MUSCLE PROTEIN SYNTHESIS IN THE HORSE Ashley Leigh Wagner University

More information

Signal Transduction Pathway Smorgasbord

Signal Transduction Pathway Smorgasbord Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.

More information

Crosstalk Between MDM2 and Akt Signaling Pathway in Oncogenesis.

Crosstalk Between MDM2 and Akt Signaling Pathway in Oncogenesis. Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2008 Crosstalk Between MDM2 and Akt Signaling Pathway in Oncogenesis. Mahesh Ramamoorthy Virginia Commonwealth

More information

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b. Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure

More information

Supplementary Information. Table of contents

Supplementary Information. Table of contents Supplementary Information Table of contents Fig. S1. Inhibition of specific upstream kinases affects the activity of the analyzed readouts Fig. S2. Down-regulation of INCENP gene induces the formation

More information

S6K1 mediates oncogenic glycolysis in Pten deficient leukemia

S6K1 mediates oncogenic glycolysis in Pten deficient leukemia S6K1 mediates oncogenic glycolysis in Pten deficient leukemia A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of

More information

q 2017 by The University of Chicago. All rights reserved. DOI: /690105

q 2017 by The University of Chicago. All rights reserved. DOI: /690105 q 2017 by The University of Chicago. All rights reserved. DOI: 10.1086/690105 Appendix from R. M. Cox et al., Hormonally Mediated Increases in Sex-Biased Gene Expression Accompany the Breakdown of Between-

More information

Expanding mtor signaling

Expanding mtor signaling 666 REVIEW Cell Research (2007) 17:666-681. 2007 IBCB, SIBS, CAS All rights reserved 1001-0602/07 $ 30.00 www.nature.com/cr Qian Yang 1,2, Kun-Liang Guan 1,2,3 1 Life Sciences Institute; 2 Department of

More information

Optimizing Nutritional Strategies to Promote Growth in Newborns

Optimizing Nutritional Strategies to Promote Growth in Newborns Optimizing Nutritional Strategies to Promote Growth in Newborns Teresa A. Davis, Ph.D. Professor of Pediatrics USDA/ARS Children s Nutrition Research Center, Baylor College of Medicine, Houston, TX Disclosure

More information

Megan S. Lim MD PhD. Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application

Megan S. Lim MD PhD. Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application Megan S. Lim MD PhD FRCPC Department of Pathology, University of Michigan, Ann Arbor, MI Proteomics is a multi-faceted

More information

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Product Datasheet DARC Antibody NB100-2421 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb100-2421

More information

Oxidant Stress and Signal Transduction in the Nervous System with the PI 3-K, Akt, and mtor Cascade

Oxidant Stress and Signal Transduction in the Nervous System with the PI 3-K, Akt, and mtor Cascade Int. J. Mol. Sci. 2012, 13, 13830-13866; doi:10.3390/ijms131113830 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Oxidant Stress and Signal Transduction

More information

Ras, PI(3)K and mtor signalling controls tumour cell growth Reuben J. Shaw 1 & Lewis C. Cantley 2

Ras, PI(3)K and mtor signalling controls tumour cell growth Reuben J. Shaw 1 & Lewis C. Cantley 2 NATURE Vol 441 25 May 2006 doi:10.1038/nature04869 Ras, and mtor signalling controls tumour cell growth Reuben J. Shaw 1 & Lewis C. Cantley 2 All eukaryotic cells coordinate cell growth with the availability

More information

Product Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2

Product Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2 Product Datasheet EMMPRIN/CD147 Antibody (MEM-M6/1) NB500-430 Unit Size: 0.1 mg Store at 4C. Do not freeze. Publications: 2 Protocols, Publications, Related Products, Reviews, Research Tools and Images

More information

Studies on cell growth promoting AKT signaling pathway a promising anti-cancer drug target

Studies on cell growth promoting AKT signaling pathway a promising anti-cancer drug target DISSERTATIONES BIOLOGICAE UNIVERSITATIS TARTUENSIS 294 KRISTINA MÄEMETS-ALLAS Studies on cell growth promoting AKT signaling pathway a promising anti-cancer drug target DISSERTATIONES BIOLOGICAE UNIVERSITATIS

More information

Product Datasheet. IGF-I R Antibody (3G5C1) NB Unit Size: 0.1 ml

Product Datasheet. IGF-I R Antibody (3G5C1) NB Unit Size: 0.1 ml Product Datasheet IGF-I R Antibody (3G5C1) NB110-87052 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 2 Publications: 8 Protocols, Publications,

More information

Product Datasheet. ERCC1 Antibody (8F1) NB Unit Size: 0.1 ml

Product Datasheet. ERCC1 Antibody (8F1) NB Unit Size: 0.1 ml Product Datasheet ERCC1 Antibody (8F1) NB500-704 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications: 15 Protocols, Publications,

More information

JOSÉ BASELGA. Massachusetts General Hospital Cancer Center, Boston, Massachusetts, USA

JOSÉ BASELGA. Massachusetts General Hospital Cancer Center, Boston, Massachusetts, USA The Oncologist Targeting the Phosphoinositide-3 (PI3) Kinase Pathway in Breast Cancer JOSÉ BASELGA Massachusetts General Hospital Cancer Center, Boston, Massachusetts, USA Disclosures: José Baselga: Consultant/advisory

More information

The Relationship Between Insulin Resistance and Hyperinsulinemia on Mammary Cancer Growth and Development

The Relationship Between Insulin Resistance and Hyperinsulinemia on Mammary Cancer Growth and Development The Relationship Between Insulin Resistance and Hyperinsulinemia on Mammary Cancer Growth and Development by Sarah Khalid A thesis submitted in conformity with the requirements for the degree of Master

More information

Phospho-PRAS40 Thr246 predicts trastuzumab response in patients with HER2-positive metastatic breast cancer

Phospho-PRAS40 Thr246 predicts trastuzumab response in patients with HER2-positive metastatic breast cancer ONCOLOGY LETTERS 9: 785-789, 2015 Phospho-PRAS40 Thr246 predicts trastuzumab response in patients with HER2-positive metastatic breast cancer KAI YUAN, HONGYAN WU, YULONG WANG, HONGQIANG CHEN, MINGWEN

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

More information

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called

More information

Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis

Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis Nature Reviews Cancer AOP, published online 2 February 2006; doi:10.1038/nrc1819 REVIEWS Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis Megan Cully*, Han

More information

Lecture #27 Lecturer A. N. Koval

Lecture #27 Lecturer A. N. Koval Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates

More information

ProteoScan Cancer Lysate Arrays. QC and Validation Data

ProteoScan Cancer Lysate Arrays. QC and Validation Data ProteoScan Cancer Lysate Arrays QC and Validation Data 4.5 mm Barcode Cancer Lysate Array Layout PA02 60 mm B1 C2 K3 Ly1 O2 P3 Mel1 Lv2 St3 B2 C3 L1 Ly2 O3 Pr1 Mel2 Lv3 B3 K1 L2 Ly3 P1 Pr2 Mel3 St1 C1

More information

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway AWARD NUMBER: W81XWH-12-1-0560 TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway PRINCIPAL INVESTIGATOR: Andrew S. Kraft, MD CONTRACTING ORGANIZATION:

More information

Fluorescence Microscopy

Fluorescence Microscopy Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized

More information

VEGF Polyclonal Antibody Catalog Number PA Product data sheet

VEGF Polyclonal Antibody Catalog Number PA Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 VEGF Polyclonal Antibody Catalog Number PA5-16754 Product data sheet Details Size

More information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Case Study - Informatics

Case Study - Informatics bd@jubilantbiosys.com Case Study - Informatics www.jubilantbiosys.com Validating as a Prognostic marker and Therapeutic Target for Multiple Cancers Introduction Human genome projects and high throughput

More information

Primary resistance to ATP-competitive mtor inhibitors for the treatment of solid tumors. Gregory Stuart Ducker

Primary resistance to ATP-competitive mtor inhibitors for the treatment of solid tumors. Gregory Stuart Ducker Primary resistance to ATP-competitive mtor inhibitors for the treatment of solid tumors By Gregory Stuart Ducker A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor

More information

Antibodies. for the study of CELL BIOLOGY & CANCER RESEARCH

Antibodies. for the study of CELL BIOLOGY & CANCER RESEARCH Antibodies for the study of CELL BIOLOGY & CANCER RESEARCH Antibodies for the study of CELL BIOLOGY & CANCER RESEARCH This pamphlet includes Cayman s most significant antibodies for the identification

More information

Product Datasheet. KAP1 Antibody NB Unit Size: 100 ul. Store at 4C. Do not freeze. Publications: 16

Product Datasheet. KAP1 Antibody NB Unit Size: 100 ul. Store at 4C. Do not freeze. Publications: 16 Product Datasheet KAP1 Antibody NB500-158 Unit Size: 100 ul Store at 4C. Do not freeze. Publications: 16 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb500-158

More information

Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles.

Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles. Product Datasheet Endothelin-1 Antibody (TR.ET.48.5) NB300-526 Unit Size: 100 ul Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols, Publications, Related Products, Reviews,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

Molecular mechanisms of metabolic regulation by insulin in Drosophila

Molecular mechanisms of metabolic regulation by insulin in Drosophila Biochem. J. (2010) 425, 13 26 (Printed in Great Britain) doi:10.1042/bj20091181 13 REVIEW ARTICLE Molecular mechanisms of metabolic regulation by insulin in Drosophila Aurelio A. TELEMAN 1 German Cancer

More information

Diabetes. Insulin Signaling PTPases PI 3-K / Akt Pathway GSK-3 Nutrient Sensing (mtor / AMPK ) PPARs GLP-1, DPPIV & Neprilysin

Diabetes. Insulin Signaling PTPases PI 3-K / Akt Pathway GSK-3 Nutrient Sensing (mtor / AMPK ) PPARs GLP-1, DPPIV & Neprilysin Diabetes Insulin Signaling PTPases PI 3-K / Akt Pathway GSK-3 Nutrient Sensing (mtor / AMPK ) PPARs GLP-1, DPPIV & Neprilysin Enabling Discovery in Life Science Enzo Life Sciences, Inc. Enzo Life Sciences,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-09-1-0279 TITLE: Regulation of mtor by Nutrients PRINCIPAL INVESTIGATOR: Kun-Liang Guan CONTRACTING ORGANIZATION: University of San Diego La Jolla, CA 92093 REPORT DATE: July 2010

More information

TITLE: A Genetic Approach to Define the Importance of Rheb in Tuberous Sclerosis

TITLE: A Genetic Approach to Define the Importance of Rheb in Tuberous Sclerosis AD Award Number: W81XWH-05-1-0164 TITLE: A Genetic Approach to Define the Importance of Rheb in Tuberous Sclerosis PRINCIPAL INVESTIGATOR: Fuyuhiko Tamanoi, Ph.D. CONTRACTING ORGANIZATION: The University

More information

REVIEW AKT in cancer: new molecular insights and advances in drug development

REVIEW AKT in cancer: new molecular insights and advances in drug development British Journal of Clinical Pharmacology Br J Clin Pharmacol (2016) 82 943 956 943 REVIEW AKT in cancer: new molecular insights and advances in drug development Correspondence Kevin Kalinsky, Assistant

More information

Review Article Mammalian target of rapamycin: a central node of complex signaling cascades

Review Article Mammalian target of rapamycin: a central node of complex signaling cascades Int J Clin Exp Pathol 2011;4(5):476-495 www.ijcep.com /IJCEP1106002 Review Article Mammalian target of rapamycin: a central node of complex signaling cascades Yoh Dobashi, Yasutaka Watanabe 1, Chihiro

More information

K-LISA mtor Activity Kit Cat. No. CBA055

K-LISA mtor Activity Kit Cat. No. CBA055 User Protocol CBA055 Rev. 20 December 2006 JSW Page 1 of 8 K-LISA mtor Activity Kit Cat. No. CBA055 Note that this user protocol is not lot-specific and is representative of the current specifications

More information

New Insights Into Molecular Basis of Glioblastoma Multiforme and Associated Immunosuppression

New Insights Into Molecular Basis of Glioblastoma Multiforme and Associated Immunosuppression ACTA FACULTATIS MEDICAE NAISSENSIS DOI: 10.2478/afmnai-2013-0009 UDC: 616.831-006-097 Scientific Journal of the Faculty of Medicine in Niš 2013;30(4):165-184 Review article New Insights Into Molecular

More information

ABSTRACT: INTRODUCTION

ABSTRACT: INTRODUCTION / Oncotarget, April, Vol.3, No 4 Two hits are better than one: targeting both phosphatidylinositol 3-kinase and mammalian target of rapamycin as a therapeutic strategy for acute leukemia treatment Alberto

More information

Product Datasheet. Caspase-8 Antibody - (active/cleaved) NB Unit Size: 0.05 ml. Store at -20C. Avoid freeze-thaw cycles.

Product Datasheet. Caspase-8 Antibody - (active/cleaved) NB Unit Size: 0.05 ml. Store at -20C. Avoid freeze-thaw cycles. Product Datasheet Caspase-8 Antibody - (active/cleaved) NB100-56116 Unit Size: 0.05 ml Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 38 Protocols, Publications, Related Products, Reviews,

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Concise Reference. HER2 Testing in Breast Cancer. Mary Falzon, Angelica Fasolo, Michael Gandy, Luca Gianni & Stefania Zambelli

Concise Reference. HER2 Testing in Breast Cancer. Mary Falzon, Angelica Fasolo, Michael Gandy, Luca Gianni & Stefania Zambelli Concise Reference Testing in Breast Cancer Mary Falzon, Angelica Fasolo, Michael Gandy, Luca Gianni & Stefania Zambelli Extracted from Handbook of -Targeted Agents in Breast Cancer ublished by Springer

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-18-095 Title: Insulin Receptor Substrate 2:A Bridge between Hippo and AKT Pathways Article Type: Perspective (Invited Only) Keywords:

More information

p53 and Apoptosis: Master Guardian and Executioner Part 2

p53 and Apoptosis: Master Guardian and Executioner Part 2 p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy

More information

Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays

Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays Dr. Markus Ehrat Zeptosens A Division of Bayer Schweiz AG SSOM Meeting March 16 /17

More information

ab For the qualitative measurement of phosphorylated Ser2448 of mtor protein in cell and tissue lysates.

ab For the qualitative measurement of phosphorylated Ser2448 of mtor protein in cell and tissue lysates. ab168538 mtor (pser2448) ELISA Kit Instructions for Use For the qualitative measurement of phosphorylated Ser2448 of mtor protein in cell and tissue lysates. This product is for research use only and is

More information

PIK3CA Mutations in HER2-Positive Breast Cancer

PIK3CA Mutations in HER2-Positive Breast Cancer 2016.4.29. GBCC PIK3CA Mutations in HER2-Positive Breast Cancer Seock-Ah Im, MD, PhD. Department of Internal Medicine Seoul National University Hospital Contents Introduction TCGA data HER2 signaling pathway

More information

7. PI3K-Akt regulation as a molecular mechanism of the stress response during aerobic dormancy

7. PI3K-Akt regulation as a molecular mechanism of the stress response during aerobic dormancy Research Signpost 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Hypometabolism: Strategies of Survival in Vertebrates and Invertebrates, 2011: 147-182 ISBN: 978-81-308-0471-2 Editors: Anna Nowakowska

More information

Phosphoserine Detection Kit

Phosphoserine Detection Kit Kit 0701/PSER-KIT 02/080507 Background and Specificity extracellular signals to the nucleus. Phosphorylated epitopes may serve as docking sites for the assembley of protein complexes or may alter the 3-dimensional

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

Current development of mtor inhibitors as anticancer agents

Current development of mtor inhibitors as anticancer agents Current development of mtor inhibitors as anticancer agents Sandrine Faivre*, Guido Kroemer and Eric Raymond* Abstract Mammalian target of rapamycin (mtor) is a kinase that functions as a master switch

More information

PCB 3023 Exam 4 - Form A First and Last Name

PCB 3023 Exam 4 - Form A First and Last Name PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this

More information

Organ Size Control by Hippo and TOR Pathways

Organ Size Control by Hippo and TOR Pathways Current Biology 22, R368 R379, May 8, 2012 ª2012 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2012.03.003 Organ Size Control by Hippo and TOR Pathways Review Karen Tumaneng, Ryan C. Russell, and

More information

Glycogen Synthase Kinase 3 is Required for Optimal AKT Activation

Glycogen Synthase Kinase 3 is Required for Optimal AKT Activation Texas Medical Center Library DigitalCommons@TMC UT GSBS Dissertations and Theses (Open Access) Graduate School of Biomedical Sciences 12-2011 Glycogen Synthase Kinase 3 is Required for Optimal AKT Activation

More information

Easy50 PI3K Inhibitor Array*

Easy50 PI3K Inhibitor Array* Easy50 PI3K Inhibitor Array* Catalog # IAP001 Instruction Manual For Research Use Only *Patent pending Introduction This Easy50 PI3K Inhibitor Array is a panel of serial dilutions of inhibitors that are

More information

Iso-Insulin ELISA ( ), Brochure

Iso-Insulin ELISA ( ), Brochure Iso-Insulin ELISA (10-1128-01), Brochure Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53

More information

TITLE: Cyclin E, A Powerful Predictor of Survival in Breast Cancer-A Prospective Study

TITLE: Cyclin E, A Powerful Predictor of Survival in Breast Cancer-A Prospective Study AD Award Number: DAMD17-02-1-0452 TITLE: Cyclin E, A Powerful Predictor of Survival in Breast Cancer-A Prospective Study PRINCIPAL INVESTIGATOR: Khandan Keyomarsi, Ph.D. CONTRACTING ORGANIZATION: MD Anderson

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

M.Sc Thesis- Yaryna Storozhuk- McMaster University- Medical Sciences MOLECULAR RESPONSES OF LUNG CANCER TO IONIZING RADIATION:

M.Sc Thesis- Yaryna Storozhuk- McMaster University- Medical Sciences MOLECULAR RESPONSES OF LUNG CANCER TO IONIZING RADIATION: MOLECULAR RESPONSES OF LUNG CANCER TO IONIZING RADIATION: INVESTIGATION OF THE BIGUANIDE METFORMIN IN COMBINATION WITH IONIZING RADIATION. YARYNA STOROZHUK, B.Sc. A Thesis Submitted to the School of Graduate

More information

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular

More information

Novel Strategies in Systemic Therapies: Overcoming Endocrine Therapy Resistance

Novel Strategies in Systemic Therapies: Overcoming Endocrine Therapy Resistance Novel Strategies in Systemic Therapies: Overcoming Endocrine Therapy Resistance Richard S. Finn, MD Division of Hematology/ Oncology Director, Translational Oncology Laboratory Geffen School of Medicine

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

PI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program:

PI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program: PI3K Background The phosphatidylinositol 3-kinase (PI3K) pathway is a key cell signaling node whose dysregulation commonly results in the transformation of normal cells into cancer cells. The role of PI3K

More information

Supporting Information

Supporting Information Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with

More information

Critical Review. What Controls TOR? Estela Jacinto Department of Physiology and Biophysics, UMDNJ-Robert Wood Johnson Medical School, Piscataway, NJ

Critical Review. What Controls TOR? Estela Jacinto Department of Physiology and Biophysics, UMDNJ-Robert Wood Johnson Medical School, Piscataway, NJ IUBMB Life, 60(8): 483 496, August 2008 Critical Review What Controls TOR? Estela Jacinto Department of Physiology and Biophysics, UMDNJ-Robert Wood Johnson Medical School, Piscataway, NJ Summary The target

More information

cdc2 cyclin B regulates eef2 kinase activity in a cell cycle- and amino acid-dependent manner

cdc2 cyclin B regulates eef2 kinase activity in a cell cycle- and amino acid-dependent manner The EMBO Journal (2008) 27, 1005 1016 & 2008 European Molecular Biology Organization All Rights Reserved 0261-4189/08 www.embojournal.org cyclin B regulates eef2 kinase activity in a cell cycle- and amino

More information

Cell Lysis Buffer. Catalog number: AR0103

Cell Lysis Buffer. Catalog number: AR0103 Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state

More information

The mtor Signalling Pathway in Human Cancer

The mtor Signalling Pathway in Human Cancer Int. J. Mol. Sci. 2012, 13, 1886-1918; doi:10.3390/ijms13021886 OPEN ACCESS Review International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms The mtor Signalling Pathway in Human

More information

Diagnostic test Suggested website label Description Hospitals available

Diagnostic test Suggested website label Description Hospitals available Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular

More information

Minireview Shrinkage control: regulation of insulin-mediated growth by FOXO transcription factors Thomas P Neufeld

Minireview Shrinkage control: regulation of insulin-mediated growth by FOXO transcription factors Thomas P Neufeld Journal of Biology BioMed Central Minireview Shrinkage control: regulation of insulin-mediated growth by FOXO transcription factors Thomas P Neufeld Address: Department of Genetics, Cell Biology, and Development,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine

More information

PI3K/mTOR Dual Inhibitor

PI3K/mTOR Dual Inhibitor PI3K/mTOR Dual Inhibitor LY3023414 Courtney KD, et al 1 Drug Discovery Platform: Cancer Cell Signaling A Double-Blinded, Placebo-Controlled, Randomized Phase II Study of Enzalutamide With or Without the

More information

PI3K-AKT-mTOR-Signaling and beyond: the Complex Network in Gastroenteropancreatic Neuroendocrine Neoplasms

PI3K-AKT-mTOR-Signaling and beyond: the Complex Network in Gastroenteropancreatic Neuroendocrine Neoplasms 336 Review Ivyspring International Publisher Theranostics 2014; 4(4):336-365. doi: 10.7150/thno.7851 PI3K-AKT-mTOR-Signaling and beyond: the Complex Network in Gastroenteropancreatic Neuroendocrine Neoplasms

More information