ProteoScan Cancer Lysate Arrays. QC and Validation Data

Size: px
Start display at page:

Download "ProteoScan Cancer Lysate Arrays. QC and Validation Data"

Transcription

1 ProteoScan Cancer Lysate Arrays QC and Validation Data

2 4.5 mm Barcode Cancer Lysate Array Layout PA02 60 mm B1 C2 K3 Ly1 O2 P3 Mel1 Lv2 St3 B2 C3 L1 Ly2 O3 Pr1 Mel2 Lv3 B3 K1 L2 Ly3 P1 Pr2 Mel3 St1 C1 K2 L3 O1 P2 Pr3 Lv1 St2 4.5 mm Sub-arrays B1-B3 Breast (B) C1-C3 Colon (C) K1-K3 Kidney (K) L1-L3 Lung (L) Ly1-Ly3 Lymphoma (Ly) O1-O3 Ovary (O) P1-P3 Pancreas (P) Pr1-Pr3 Prostate (Pr) Mel1-Mel3 Melanoma (Mel) Lv1-Lv3 Liver (Lv) St1-St3 Stomach (St)

3 BSA Backgroun d controls Cy3, Cy5 location controls Layout - Sub Arrays X1 and X2 PA Case Case 2 Case 3 BSA-Cy3 BSA-Cy BSA-Cy3-Cy5 Case 4 Case 5 Case 6 BSA (ug/ml) Buffer Case 7 Case 8 Case 9 Lysate (ug/ml) Empty Case 10 Case 11 Case Case 13 Case 14 Case 15

4 BSA Backgroun d controls Cy3, Cy5 location controls Layout - Sub Arrays X3 PA Case Case 32 Case 33 HEK293T lysate mg/ml Gene specific over expression Lysate 0.5X-0.004X Case 34 Case 35 Case 36 IgG Mix Positive control (Hu, Rab and Mouse) ug/ml Case 37 Case HEK293T Cell lysate Purified ß-actin ug/ml Lysate (ug/ml) Case 39 Case X 0.1X Over expressed Lysate 0.5X 0.1X X 0.1X BSA (ug/ml) BSA-Cy3-Cy BSA-Cy5 BSA-Cy3 ß-Actin IgG Mix Positive control Buffer Empty

5 Sypro-ruby Protein Staining PA02

6 Detection of β-actin PA02 ProteoScan Cancer Lysate Array was probed with 1:200 dilution of anti-β-actin monoclonal antibody followed by DyLight 649 conjugated goat anti-mouse IgG at 1:400 dilution. The array was scanned with GenePix Pro 4A reader with Cy5 setting

7 Detection of TP53 PA02 ProteoScan Cancer Lysate Array was probed with 1: dilution of anti-tp53 rabbit antibody and detected using TSA enhanced flouremetric method. HRP-conjugated goat anti-rabbit IgG at 1:1,000 dilution was used followed by Alexa Flour 647 tyramide at 1:50 dilution. The array was scanned with GenePix Pro 4A reader with Cy5 setting

8 Detection of TP53 PA02 The ProteoScan Cancer Lysate Array 1.0 was probed with 1:150 dilution of anti TP53 rabbit antibody and detected by the Colorimetric TSA enhanced method.

9 Colon Normal Lung Normal Lymphoma Normal Ovary Normal Proatate Normal Colon Cancer Lung Cancer Lymphoma Cancer Ovarrian Cancer Prostate Cancer Breast Normal Kidney Normal Liver Normal Melanoma Normal Pancreas Normal Stomach Normal Breast Cancer Kidney Cancer Liver Cancer Melanoma Cancer Pancreas Cancer Stomach Cancer TP53 in Normal and Cancer Tissues 1, , , , , , < >4 ProteoScan Cancer Lysate Array (PA02) was probed with rabbit anti TP53 antibody (1:) and detected with the TSA enhanced method. A cancer differential expression index was created by dividing the readout for each cancer sample with the median from all normal samples of the same tissue. The results are presented as heat map format for all 4 protein concentrations (4 columns) Particular cancer types with higher and lower expression (compare to normal) are easily detected. Results can be further analyzed for individual cancers and samples

10 Colon Normal Lung Normal Lymphoma Normal Ovary Normal Proatate Normal Colon Cancer Lung Cancer Lymphoma Cancer Ovarrian Cancer Prostate Cancer Breast Normal Kidney Normal Liver Normal Melanoma Normal Pancreas Normal Stomach Normal Breast Cancer Kidney Cancer Liver Cancer Melanoma Cancer Pancreas Cancer Stomach Cancer Survivin in Normal and Cancer Tissues 1, , , , , , > < ProteoScan Cancer Lysate Array was probed with rabbit anti survivin (BIRC5) antibody (1:) and detected with the TSA enhanced method. A cancer differential expression index was created by dividing the readout for each cancer sample with the median from all normal samples of the same tissue. The results are presented as heat map format for all 4 protein concentrations (4 columns) Particular cancer types with higher and lower expression (compare to normal) are easily detected. Results can be further analyzed for individual cancers and samples

11 Colon Normal Lung Normal Lymphoma Normal Ovary Normal Proatate Normal Colon Cancer Lung Cancer Lymphoma Cancer Ovarrian Cancer Prostate Cancer Breast Normal Kidney Normal Liver Normal Melanoma Normal Pancreas Normal Stomach Normal Breast Cancer Kidney Cancer Liver Cancer Melanoma Cancer Pancreas Cancer Stomach Cancer Phospho-C Myc in Normal and Cancer Tissues 1, , , , , , > < ProteoScan Cancer Lysate Array (PA02) was probed with rabbit anti Phospho c-myc (pt58/s62) monoclonal antibody (1:) and detected with the TSA enhanced method. A cancer differential expression index was created by dividing the readout for each cancer sample with the median from all normal samples of the same tissue. The results are presented as heat map format for all 4 protein concentrations (4 columns) Particular cancer types with higher and lower expression (compare to normal) are easily detected. Results can be further analyzed for individual cancers and samples

12 Quantitative Data Analysis Linear SuperCurve To derive one specific expression value for each cancer sample across all 4 dilutions in replicates, array reading and curve fitting was performed with Microvigene TM software and the RPPA module from VigeneTech Inc. The expression level value is represented by the Y0 value for each curve.

13 Colon Normal Lung Normal Lymphoma Normal Ovary Normal Prostate Normal Colon Cancer Lung Cancer Lymphoma Cancer Ovarrian Cancer Prostate Cancer Breast Normal Kidney Normal Liver Normal Melanoma Normal Pancreas Normal Stomach Normal Breast Cancer Kidney Cancer Liver Cancer Melanoma Cancer Pancreas Cancer Stomach Cancer HER2 in Normal and Cancer Tissues (Heat map view before curve fitting) 1, , , , , , < > < >4 ProteoScan Cancer Lysate Array (PA02) was probed with rabbit anti- HER2-ERBB2 antibody (1:50) and detected with the TSA enhanced method. A cancer differential expression index was created by dividing the readout for each cancer sample with the median from all normal samples of the same tissue. The results are presented as heat map format for all 4 protein concentrations (4 columns). Particular cancer types with higher and lower expression (compare to normal) are easily detected. Results can be further analyzed for individual cancers and samples

14 Breast Normal Colon Normal Breast Cancer Colon Cancer SC SC SC SC SC SC Kidney Normal Lung Normal Kidney Cancer Lung Cancer Liver Normal Lymphoma Normal Liver Cancer Lymphoma Cancer Melanoma Normal Ovary Normal Melanoma Cancer Ovarian Cancer Pancreas Normal Prostate Normal Pancreas Cancer Prostate Cancer Stomach Normal Stomach Cancer HER2 in Normal and Cancer Tissues (Heat map view after curve fitting) < >12 ProteoScan Cancer Lysate Array (PA02) was probed with rabbit anti- HER2-ERBB2 antibody (1:50) and detected with the TSA enhanced method. Expression level were calculated using the SuperCurve curve fitting mode of the RPPA module from VigeneTech Inc. A cancer differential expression index was created by dividing the readout for each cancer sample with the median from all normal samples of the same tissue. The results are presented as heat map format after curve fitting (one column). A Curve fitting model is the preferred analysis method and provide a more accurate relative expression levels results

15 HER2 Expression in Breast Tissue (Y0 value) ProteoScan Cancer Lysate Array (PA02) was probed with rabbit anti HER2-ERBB2 as before. Results were calculated using the RPPA module from VigeneTech Inc and the expression level value (Y0) determined. 17 cancer samples and two normal samples have higher expression of HER2-ERBB2.

16 HER2 Expression Validated by IHC Data HER2 Expression in breast cancer and normal tissues ProteoScan Cancer Lysate Array (PA02) was probed with rabbit anti- ERBB2 as before. Results were calculated as ratio of Y0 of each sample divided by the median of Y0 from all normal breast samples. For comparison with IHC data on record the data was converted to three expression levels. IHC expression scale: 1= Normal expression 2= Moderate over-expression 3= High over-expression RPPA expression converted to IHC scale: 0-5 fold = 1(Normal expression) fold = 2 (Moderate over-expression) > 20 fold = 3 (High over-expression) 21 of the 25 samples (84%) matched the IHC data. two samples had higher expression than detected by IHC and two samples had positive IHC not detected by our panel.

17 ,328 7,460 5,443 1, ,078 21,703 2,099 2,234 1,060 3,491 3, ,608 2, ,250 7,377 21,810 1, , , BC1 BC2 BC3 BC4 BC5 BC6 BC7 BC8 BC9 BC10 BC11 BC12 BC13 BC15 BC16 BC17 BC18 BC19 BC20 BC21 BC22 BC23 BC24 BC25 HEK293T BN1 ERBB2 BN2 BN3 BN4 BN5 Empty BN7 BN8 BN9 BN10 BN11 BN12 BN13 BN15 HER2 Expression in Breast Tissues Sample WB RPPA IHC (from File) Quantitative Results of ERBB2-Her2 expression measured with the ProteoScan Cancer Lysate Array (RPPA) were confirmed by Western blot analysis of breast samples (10 ug) and matches the IHC data from the donor pathology report.

18 1,760 3,263 1,709 1, ,967 2,644 1,009 2,835 2,072 4,220 4,142 15,771 2,830 15,282 5,217 6,607 7,053 6,279 1,406 3,754 4, , ,620 1, OC1 OC2 OC3 OC4 OC5 OC6 OC7 OC8 OC9 OC10 OC11 OC12 OC13 OC14 OC15 ND OC17 OC18 OC19 OC20 OC21 OC22 OC23 OC24 OC25 HEK293T ON1 ON2 ON3 ON4 ON5 ON6 ON7 ON8 ON15 ON10 ON11 ON12 ON13 ON14 ERBB2 HER2 Expression in Ovarian Tissues Sample WB RPPA Quantitative Results of ERBB2-Her2 expression measured with the ProteoScan Cancer Lysate Array (RPPA) were confirmed by Western blot analysis of ovarian samples (10 ug)

19 RFU RFU IgG Mix Positive Control IgG mix Results 3,500,000 3,000,000 2,500,000 2,000,000 1,500,000 1,000, ,000 1,800,000 1,600,000 1,400,000 1,200,000 1,000, , , , , ug/ml IgG y = x R 2 = ug/ml IgG A mix of Human, Mouse and Rabbit IgG each at 0-10 ug/ml are spotted on each 3 rd sub-array. ProteoScan Cancer Lysate Array (PA02) was probed with 1:400 dilution of DyLight 649 conjugated goat anti- mouse IgG and scanned with GenePix Pro 4A reader with Cy5 setting. The IgG curve is linear from 0-5 ug/ml with outstanding repetition The results from the IgG positive control mix can be used to convert the array results to actual protein concentrations The graph present the average and SD of each concentration of spots from the entire array (33 each)

20 RFU Purified β-actin Control Purified Recombinant b-actin 3,000,000 2,500,000 2,000,000 1,500,000 1,000, ,000 y = x R 2 = ug/ml b-actin The β-actin curve is linear from 0-10 ug/ml with outstanding repetition The results from the β-actin control can be used to convert the array results to actual protein concentrations Purified recombinant β- actin at 0-10 ug / ml are spotted on each 3 rd subarray. ProteoScan Cancer Lysate Array (PA02) was probed with anti β-actin diluted 1:200 and detected with 1:400 dilution of DyLight 649 conjugated goat antimouse antibody. The graph present the average and SD of each concentration for spots from the entire array (33 each)

21 14.2 mm Label Assay Validation Array Layout PA01 51 mm 22.5 mm

22 BSA Backgroun d controls Cy3, Cy5 location controls Assay Validation Array Layout PA01 S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12 S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12 S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20 S21 S22 S23 S24 HEK293T lysate mg/ml TP53 over expression Lysate 0.5X-0.004X S13 S14 S13 S14 S15 S15 S16 S16 S17 S17 S18 S18 S19 S20 S21 S22 S23 S24 S19 S20 S21 S22 S23 S24 IgG Mix Positive control (Hu, Rab and Mouse) ug/ml S25 S26 S25 S26 S27 S27 S28 S28 S29 S29 S30 S30 S31 S32 S31 S HEK293T Cell lysate Tissue Lysate samples 1,000 ug/ml S25 S26 S33 S34 S33 S34 S33 S34 S27 S35 S35 S35 S28 S36 S36 S36 S29 S37 S37 S37 S30 S38 S38 S38 S31 S32 S39 S40 S39 S40 S39 S X 0.1X X Over expressed Lysate X 0.1X BSA (ug/ml) BSA-Cy3-Cy5 S41 S42 S43 S BSA-Cy5 BSA-Cy3 S41 S42 S43 S44 IgG Mix Positive control Buffer Empty S41 S42 S43 S44

23 Sypro-ruby Protein Staining PA01

24 Detection of TP53 PA01 The Assay Validation Array was probed with 1:200 dilution of anti TP53 rabbit antibody and detected using TSA enhanced flouremetric method. HRP-conjugated goat anti-rabbit IgG at 1:1,000 dilution was used followed by Alexa Flour 647 tyramide at 1:50 dilution. The array was scanned with GenePix Pro 4A reader with Cy5 setting

25 Detection of TP53 PA01 The ProteoScan Assay Validation Array was probed with 1:150 dilution of anti TP53 rabbit antibody and detected by the Colorimetric TSA enhanced method.

26 Detection of β-actin PA01 The ProteoScan Assay Validation Array was probed with 1:200 dilution of anti β-actin mouse monoclonal antibody followed by DyLight 649 conjugated goat anti-mouse IgG at 1:400 dilution. TSA enhanced method was used. The array was scanned with GenePix Pro 4A reader with Cy5 setting

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

National Cancer Statistics in Korea, 2014

National Cancer Statistics in Korea, 2014 National Cancer Statistics in Korea, 2014 2016. 12. 20. Korea Central Cancer Registry Cancer Incidence in Korea, 2014 National Cancer Incidence, 2014 Trends in Cancer Incidence by Sex and Year * Dark colored

More information

SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE

SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE 45 CLINICAL CASES SERIAL DILUTION MULTIPLE PROTEIN CONCENTRATION QUANTITATIVE ASSAY PRODUCT NUMBER: PM1-001-N SOMAPLEX REVERSE

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

Product Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2

Product Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2 Product Datasheet EMMPRIN/CD147 Antibody (MEM-M6/1) NB500-430 Unit Size: 0.1 mg Store at 4C. Do not freeze. Publications: 2 Protocols, Publications, Related Products, Reviews, Research Tools and Images

More information

Product Datasheet. CD161/NK1.1 Antibody (PK136) NB Unit Size: 0.5 mg. Store at 4C. Do not freeze. Publications: 2

Product Datasheet. CD161/NK1.1 Antibody (PK136) NB Unit Size: 0.5 mg. Store at 4C. Do not freeze. Publications: 2 Product Datasheet CD161/NK1.1 Antibody (PK136) NB100-77528 Unit Size: 0.5 mg Store at 4C. Do not freeze. Publications: 2 Protocols, Publications, Related Products, Reviews, Research Tools and Images at:

More information

Epidemiology in Texas 2006 Annual Report. Cancer

Epidemiology in Texas 2006 Annual Report. Cancer Epidemiology in Texas 2006 Annual Report Cancer Epidemiology in Texas 2006 Annual Report Page 94 Cancer Incidence and Mortality in Texas, 2000-2004 The Texas Department of State Health Services Texas Cancer

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Product Datasheet. PMP70 Antibody (CL2524) NBP Unit Size: 0.1 ml

Product Datasheet. PMP70 Antibody (CL2524) NBP Unit Size: 0.1 ml Product Datasheet PMP70 Antibody (CL2524) NBP2-36770 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 1 Protocols, Publications, Related

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Anti-Lamin B1/LMNB1 Picoband Antibody

Anti-Lamin B1/LMNB1 Picoband Antibody Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Kinex Reverse Lysate Microarray KRLM-1.0. Case Study

Kinex Reverse Lysate Microarray KRLM-1.0. Case Study Kinex Reverse Lysate Microarray KRLM-1. Case Study Probing with an Anti-phospho-ERK1/2 Antibody The Kinex Reverse Lysate Microarray (KRLM) is a powerful tool for rapid characterization of a protein for

More information

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Product Datasheet DARC Antibody NB100-2421 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb100-2421

More information

OxiSelect MDA Adduct ELISA Kit

OxiSelect MDA Adduct ELISA Kit Revised Protocol Product Manual OxiSelect MDA Adduct ELISA Kit Catalog Number STA-332 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipid peroxidation is a well-defined

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Supporting Information

Supporting Information Supporting Information Vaira et al. 10.1073/pnas.0907676107 0h 24h 48h PTEN pathway Expression 0h 24h 48h Time MAP Kinase Signaling Pathway Expression 0h 24h 48h Time Collagen Expression Fig. S1. Differential

More information

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL

More information

Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles.

Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles. Product Datasheet Endothelin-1 Antibody (TR.ET.48.5) NB300-526 Unit Size: 100 ul Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols, Publications, Related Products, Reviews,

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Product Datasheet. inos Antibody NB Unit Size: 200uL. Store at -20C. Avoid freeze-thaw cycles. Reviews: 2 Publications: 28

Product Datasheet. inos Antibody NB Unit Size: 200uL. Store at -20C. Avoid freeze-thaw cycles. Reviews: 2 Publications: 28 Product Datasheet inos Antibody NB300-605 Unit Size: 200uL Store at -20C. Avoid freeze-thaw cycles. Reviews: 2 Publications: 28 Protocols, Publications, Related Products, Reviews, Research Tools and Images

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Henson KE, Brock R, Charnock J, Wickramasinghe B, Will O, Pitman A. Risk of suicide after cancer diagnosis in England. JAMA Psychiatry. Published online November 21, 2018.

More information

Supplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures

Supplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures Supplemental Data Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB Dos D. Sarbassov, Siraj M. Ali, Shomit Sengupta, Joon-Ho Sheen, Peggy P. Hsu, Alex F. Bagley, Andrew L. Markhard, and

More information

OxiSelect HNE-His Adduct ELISA Kit

OxiSelect HNE-His Adduct ELISA Kit Product Manual OxiSelect HNE-His Adduct ELISA Kit Catalog Number STA-334 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipid peroxidation is a well-defined mechanism

More information

NICaN workshop: Colorectal Cancer Follow-up

NICaN workshop: Colorectal Cancer Follow-up NICaN workshop: Colorectal Cancer Follow-up The Changing Picture of Colorectal Cancer in Northern Ireland Dr Helen Coleman Lecturer in Cancer Epidemiology & CRUK Population Research Postdoctoral Fellow

More information

Single and Multiplex Immunohistochemistry

Single and Multiplex Immunohistochemistry Single and Multiplex Immunohistochemistry Steve Westra, BS Reagent Product Specialist Leica Biosystems IHC Theory Polyclonal vs Monoclonal Polyclonal reagents Detect a multitude of epitopes Batch to batch

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Supplements. Figure S1. B Phalloidin Alexa488

Supplements. Figure S1. B Phalloidin Alexa488 Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with

More information

ECL Plex Western Blotting Detection System

ECL Plex Western Blotting Detection System Part of GE Healthcare Data File 28-415-39 AA ECL Plex Western Blotting Detection System Multiplex protein detection based on direct fluorescent CyDye-labeled conjugates ECL Plex fluorescent Western blotting

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland

More information

Workflow. Connecting the Pieces For Total Patient Care

Workflow. Connecting the Pieces For Total Patient Care Workflow Connecting the Pieces For Total Patient Care Biocare provides a full line of IHC and molecular pathology products for cancer and infectious disease diagnosis. From a full range of equipment: including

More information

Protocol for Western Blo

Protocol for Western Blo Protocol for Western Blo ng SDS-PAGE separa on 1. Make appropriate percentage of separa on gel according to the MW of target proteins. Related recommenda ons and rou ne recipes of separa on/stacking gels

More information

Macmillan Publications

Macmillan Publications S1 S2 S3 S3 S3 S4 S5 S6 S7 S8 S8 S9 S10 S11 S11 S12 S13 S14 S15 S17 S18 S19 Bladder Cancer: Non-Invasive, Invasive and Advanced Bone Cancer: Primary, Secondary Colon Cancer, Anal Cancer, Rectal Cancer

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

Outcomes Report: Accountability Measures and Quality Improvements

Outcomes Report: Accountability Measures and Quality Improvements Outcomes Report: Accountability Measures and Quality Improvements The s Cancer Committee ensures that patients with cancer are treated according to the nationally accepted measures. Because we are an accredited

More information

SCIENCE WEBINAR. Autoantibody Biomarkers for Cancer and Autoimmune Disease. Eng M Tan, M. D. The Scripps Research Institute La Jolla, California

SCIENCE WEBINAR. Autoantibody Biomarkers for Cancer and Autoimmune Disease. Eng M Tan, M. D. The Scripps Research Institute La Jolla, California SCIENCE WEBINAR Autoantibody Biomarkers for Cancer and Autoimmune Disease Eng M Tan, M. D. The Scripps Research Institute La Jolla, California Systemic Lupus Erythematosus The Prototype Autoimmune Disease

More information

Product Datasheet. DLL4 Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 14

Product Datasheet. DLL4 Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 14 Product Datasheet DLL4 Antibody NB600-892 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 14 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb600-892

More information

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b. Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure

More information

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Tissue Core Tissue Microarray Inventory List

Tissue Core Tissue Microarray Inventory List size/mm Array description Tissue type # of cases AQUA 1 Pancreas AQUA 1 Pancreas 10 / 2012 1.0 Pancreas IDC, Panin, IPMN, normal & cysts various types Pancreas 21 51 Dr. Malafa / Dr. Centeno Exclusive

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Cancer in Ontario. 1 in 2. Ontarians will develop cancer in their lifetime. 1 in 4. Ontarians will die from cancer

Cancer in Ontario. 1 in 2. Ontarians will develop cancer in their lifetime. 1 in 4. Ontarians will die from cancer Cancer in Ontario 1 in 2 Ontarians will develop cancer in their lifetime 1 in 4 Ontarians will die from cancer 14 ONTARIO CANCER STATISTICS 2016 1 Cancer in Ontario An overview Cancer is a group of more

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Colorectal Cancer Screening

Colorectal Cancer Screening Colorectal Cancer Screening December 5, 2017 Connecticut Cancer Partnership 14th Annual Meeting Xavier Llor, M.D., PhD. Associate Professor of Medicine Co-Director, Cancer Genetics and Prevention Program

More information

Overview of 2009 Hong Kong Cancer Statistics

Overview of 2009 Hong Kong Cancer Statistics Overview of 2009 Hong Kong Cancer Statistics Cancer Registration in Hong Kong The Hong Kong Cancer Registry has since 1963 been providing population-based cancer data for epidemiological research and healthcare

More information

Mouse Estradiol EIA Kit

Mouse Estradiol EIA Kit Mouse Estradiol EIA Kit Catalog No: IRAAKT2553 Lot No: SAMPLE INTENDED USE The Estradiol Immunoassay kit uses a specifically generated antibody to measure estradiol and its metabolites in urine and fecal

More information

Two-color lateral flow assay for multiplex detection of causative agents behind acute febrile illnesses

Two-color lateral flow assay for multiplex detection of causative agents behind acute febrile illnesses Supplementary Information Two-color lateral flow assay for multiplex detection of causative agents behind acute febrile illnesses Seoho Lee 1,2, Saurabh Mehta 2,3*, David Erickson 1,2* 1 Sibley School

More information

Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers

Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers Samuel M. Lesko, MD, MPH Medical Director Karen Ryczak, RN Surveillance Coordinator December 2014 334 Jefferson Avenue, Scranton,

More information

MT09 - Normal Human Tissue Microarray, FDA

MT09 - Normal Human Tissue Microarray, FDA Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA MT09 - Normal Human Tissue Microarray,

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

New Developments in Cancer Treatment. Ian Rabinowitz MD

New Developments in Cancer Treatment. Ian Rabinowitz MD New Developments in Cancer Treatment Ian Rabinowitz MD Treatment Outline Angiogenesis inhibition Targeted therapy Immunotherapy Personalization of therapy Genomics and cancer Stem cells and cancer Angiogenesis

More information

Product Datasheet. CD133 Antibody NB Unit Size: 0.1 mg

Product Datasheet. CD133 Antibody NB Unit Size: 0.1 mg Product Datasheet CD133 Antibody NB120-16518 Unit Size: 0.1 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 8 Protocols, Publications, Related Products,

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to

More information

Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers

Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers Samuel M. Lesko, MD, MPH Medical Director Karen Ryczak, RN Surveillance Coordinator November 2018 334 Jefferson Avenue, Scranton,

More information

Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers

Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers Cancer in Northeastern Pennsylvania: Incidence and Mortality of Common Cancers Samuel M. Lesko, MD, MPH Medical Director Karen Ryczak, RN Surveillance Coordinator December 2017 334 Jefferson Avenue, Scranton,

More information

Overview of 2010 Hong Kong Cancer Statistics

Overview of 2010 Hong Kong Cancer Statistics Overview of 2010 Hong Kong Cancer Statistics Cancer Registration in Hong Kong The Hong Kong Cancer Registry has since the 1960s been providing population-based cancer data for epidemiological research

More information

Amersham ECL Prime Western blotting reagent

Amersham ECL Prime Western blotting reagent GE Healthcare Life Sciences Data file 28-9857-23 AA Western blotting reagents Amersham ECL Prime Western blotting reagent Since its introduction in 199, the enhanced chemiluminescence (ECL) Western Blotting

More information

Physician On-line Staging Application. Darlene Dale Head, PMH Cancer Registry

Physician On-line Staging Application. Darlene Dale Head, PMH Cancer Registry Physician On-line Staging Application Darlene Dale Head, PMH Cancer Registry NAACCR 2004 Outline Overview of Princess Margaret Hospital History of Staging at PMH Steps to On-Line Physician Staging at PMH

More information

The table below presents the summary of observed geographic variation for incidence and survival by type of cancer and gender.

The table below presents the summary of observed geographic variation for incidence and survival by type of cancer and gender. Results and Maps Overview When disparities in cancer incidence and survival are evident, there are a number of potential explanations, including but not restricted to differences in environmental risk

More information

Product Datasheet. HLA ABC Antibody (W6/32) NB Unit Size: 0.25 mg. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22

Product Datasheet. HLA ABC Antibody (W6/32) NB Unit Size: 0.25 mg. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22 Product Datasheet HLA ABC Antibody (W6/32) NB100-64775 Unit Size: 0.25 mg Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22 Protocols, Publications, Related Products, Reviews, Research

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Outcomes Report: Accountability Measures and Quality Improvements

Outcomes Report: Accountability Measures and Quality Improvements Outcomes Report: Accountability Measures and Quality Improvements The FH Memorial Medical Center s Cancer Committee ensures that patients with cancer are treated according to the nationally accepted measures.

More information

Cancer Program Report 2014

Cancer Program Report 2014 Cancer Program Report 2014 Queen of the Valley Hospital St Joseph Health Queen of the Valley Hospital - 2014 Site Table Site Total Class Sex Group Cases Analytic NonAn M F 0 I II ALL SITES 661 494 167

More information

Human PKA (Protein Kinase A) Activity Assay Kit

Human PKA (Protein Kinase A) Activity Assay Kit Human PKA (Protein Kinase A) Activity Assay Kit CATALOG NO: IRAAKT2532 LOT NO: SAMPLE INTENDED USE The PKA (Protein Kinase A) Activity kit is designed to quantitatively measure PKA activity in a variety

More information

Cancer prevalence. Chapter 7

Cancer prevalence. Chapter 7 Chapter 7 Cancer prevalence Prevalence measures the number of people diagnosed with cancer who are still alive. This chapter presents current and historical statistics on cancer prevalence in Ontario.

More information

Impact and implications of Cancer Death Status Reporting Delay on Population- Based Relative Survival Analysis with Presumed-Alive Assumption

Impact and implications of Cancer Death Status Reporting Delay on Population- Based Relative Survival Analysis with Presumed-Alive Assumption Impact and implications of Cancer Death Status Reporting Delay on Population- Based Relative Survival Analysis with Presumed-Alive Assumption X Dong, Y Ren, R Wilson, and K Zhang NAACCR 6-20-2017 Introduction

More information

The role of appropriateness criteria in the planning of health services: the case of FDG-PET in oncology

The role of appropriateness criteria in the planning of health services: the case of FDG-PET in oncology V Annual Meeting of Health Tecnology Assessment International (HTAi) MONTREAL 8 july 2008 The role of appropriateness criteria in the planning of health services: the case of FDG-PET in oncology L. BALLINI

More information

Product Datasheet. ERCC1 Antibody (8F1) NB Unit Size: 0.1 ml

Product Datasheet. ERCC1 Antibody (8F1) NB Unit Size: 0.1 ml Product Datasheet ERCC1 Antibody (8F1) NB500-704 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications: 15 Protocols, Publications,

More information

GSK Medicine: Study No.: Title: Rationale: Objectives: Indication: Study Investigators/Centers: Research Methods:

GSK Medicine: Study No.: Title: Rationale: Objectives: Indication: Study Investigators/Centers: Research Methods: The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.

More information

Information Services Division NHS National Services Scotland

Information Services Division NHS National Services Scotland Cancer in Scotland October 2012 First published in June 2004, revised with each National Statistics publication Next due for revision April 2013 Information Services Division NHS National Services Scotland

More information

LN04 - Lymphoma Tissue Microarray

LN04 - Lymphoma Tissue Microarray Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA LN04 - Lymphoma Tissue Microarray

More information

Product Datasheet. ZEB1 Antibody NBP Unit Size: 0.1 ml. Store at 4C. Do not freeze. Reviews: 6 Publications: 32

Product Datasheet. ZEB1 Antibody NBP Unit Size: 0.1 ml. Store at 4C. Do not freeze. Reviews: 6 Publications: 32 Product Datasheet ZEB1 Antibody NBP1-05987 Unit Size: 0.1 ml Store at 4C. Do not freeze. Reviews: 6 Publications: 32 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nbp1-05987

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

APPENDIX ONE: ICD CODES

APPENDIX ONE: ICD CODES APPENDIX ONE: ICD CODES ICD-10-AM ICD-9-CM Malignant neoplasms C00 C97 140 208, 238.6, 273.3 Lip, oral cavity and pharynx C00 C14 140 149 Digestive organs C15 C26 150 157, 159 Oesophagus 4 C15 150 excluding

More information

Tyramide SuperBoost Kits with Alexa Fluor Tyramides

Tyramide SuperBoost Kits with Alexa Fluor Tyramides USER GUIDE Tyramide SuperBoost Kits with Alexa Fluor Tyramides Pub. No. MAN0015834 Rev. B.0 Table 1. Contents and storage Material Amount Concentration Storage 1 Blocking buffer (10% Goat Serum) (Component

More information

AN EMPIRICAL EVALUATION OF PERIOD SURVIVAL ANALYSIS USING DATA FROM THE CANADIAN CANCER REGISTRY. Larry F. Ellison MSc, Statistics Canada

AN EMPIRICAL EVALUATION OF PERIOD SURVIVAL ANALYSIS USING DATA FROM THE CANADIAN CANCER REGISTRY. Larry F. Ellison MSc, Statistics Canada AN EMPIRICAL EVALUATION OF PERIOD SURVIVAL ANALYSIS USING DATA FROM THE CANADIAN CANCER REGISTRY Larry F. Ellison MSc, Statistics Canada Introduction Long-term survival rates are important outcome measures

More information

Cancer survival in Seoul, Republic of Korea,

Cancer survival in Seoul, Republic of Korea, Cancer survival in Seoul, Republic of Korea, 1993 1997 Ahn YO and Shin MH Abstract The Seoul cancer registry was established in 1991. Cancer is a notifiable disease, and registration of cases is done by

More information

Product Datasheet. SERCA2 ATPase Antibody (IID8) NB Unit Size: 100uL. Store at -20C. Avoid freeze-thaw cycles.

Product Datasheet. SERCA2 ATPase Antibody (IID8) NB Unit Size: 100uL. Store at -20C. Avoid freeze-thaw cycles. Product Datasheet SERCA2 ATPase Antibody (IID8) NB300-529 Unit Size: 100uL Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and

More information

Phosphoserine Detection Kit

Phosphoserine Detection Kit Kit 0701/PSER-KIT 02/080507 Background and Specificity extracellular signals to the nucleus. Phosphorylated epitopes may serve as docking sites for the assembley of protein complexes or may alter the 3-dimensional

More information

Achieving 80% by 2018: Working Together Can Get Us There. Zachary Gregg, MD Sentara Martha Jefferson April 18, 2016

Achieving 80% by 2018: Working Together Can Get Us There. Zachary Gregg, MD Sentara Martha Jefferson April 18, 2016 Achieving 80% by 2018: Working Together Can Get Us There Zachary Gregg, MD Sentara Martha Jefferson April 18, 2016 1 Prostate 21% Lung & bronchus 14% Colon & rectum 8% Urinary bladder 7% Melanoma of skin

More information

National Cancer Registration and Analysis Service Short Report: Chemotherapy, Radiotherapy and Surgical Tumour Resections in England: (V2)

National Cancer Registration and Analysis Service Short Report: Chemotherapy, Radiotherapy and Surgical Tumour Resections in England: (V2) National Cancer Registration and Analysis Service Short Report: Chemotherapy, Radiotherapy and Surgical Tumour Resections in England: 13-14 (V2) Produced as part of the Cancer Research UK - Public Health

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

Cancer in New Mexico 2017

Cancer in New Mexico 2017 Cancer in New Mexico 0 Please contact us! Phone: 0-- E-Mail: nmtr-info@salud.unm.edu URL: nmtrweb.unm.edu TABLE OF CONTENTS Introduction... New Cases of Cancer Estimated Number of New Cancer Cases Description

More information

Samuel M. Lesko, MD, MPH Director of Research/Medical Director

Samuel M. Lesko, MD, MPH Director of Research/Medical Director Cancer in Northeastern Pennsylvania: Incidence, Mortality and Survival for Common Cancers Samuel M. Lesko, MD, MPH Director of Research/Medical Director May 11 334 Jefferson Avenue, Scranton, PA 1851-57-941-7984

More information

Multi-normal human tissues, FDA, 96 samples, 35 organs/sites from three individuals (1.5mm)

Multi-normal human tissues, FDA, 96 samples, 35 organs/sites from three individuals (1.5mm) ab178228 Multi-normal human tissues, FDA, 96 samples, 35 organs/sites from three individuals (1.5mm) Instructions for Use Designed for antibody cross reactivity analysis and IHC or ISH based protein or

More information

VEGF Polyclonal Antibody Catalog Number PA Product data sheet

VEGF Polyclonal Antibody Catalog Number PA Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 VEGF Polyclonal Antibody Catalog Number PA5-16754 Product data sheet Details Size

More information

National level ICD 9-3 digit Nuts II european shortlist Croatia 1999/2000 From WHO ICD-10, 4 digit. 1999/2000 From WHO ICD-10, 4 digit

National level ICD 9-3 digit Nuts II european shortlist Croatia 1999/2000 From WHO ICD-10, 4 digit. 1999/2000 From WHO ICD-10, 4 digit Gleb Denissov Reference Period Transmission to Eurostat Data Albania 1999/2000 From WHO ICD-9, 3 digit Bulgaria 1999/2000 National level from WHO Nuts II level by e-mail National level ICD 9-3 digit Nuts

More information

Cancer in New Mexico 2014

Cancer in New Mexico 2014 Cancer in New Mexico 2014 Please contact us! Phone: 505-272-5541 E-Mail: info@nmtr.unm.edu http://som.unm.edu/nmtr/ TABLE OF CONTENTS Introduction... 1 New Cases of Cancer: Estimated Number of New Cancer

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

THROMBOSIS PRODUCT HIGHLIGHTS

THROMBOSIS PRODUCT HIGHLIGHTS PRODUCT HIGHLIGHTS AESKU.DIAGNOSTICS has extensive experience and know-how in the Anti-Phospholipid Syndrome (APS) field and offers the most comprehensive panel of anti-phospholipid tests, employing highly

More information