Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies
|
|
- Amie Logan
- 5 years ago
- Views:
Transcription
1 Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands
2 Molecular versus conventional diagnostics Histological analysis RNA: Gene expression analysis DNA: Mutation analysis
3 Colon cancer subtypes: identified through gene expression
4 Targeted agents: dramatic, but short-lived responses Lung cancer/gefitinib Melanoma /Vemurafenib Progression Free Survival Progression Free Survival Maemondo et al., N Engl J Med 2010 Chapman et al., N Engl J Med 2011
5 Endless two-way combinations of cancer drugs 1,000 x1, = 499,000 combinations Test each combination in 1,000 patients: 499,000,000 patients needed
6 Differential response of BRAF inhibition in BRAF mutant melanoma versus colon cancer 90% 80% 81% 70% 60% 50% 40% 30% 20% 10% 0% Melanoma 5,20% Colon cancer N Engl J Med : Kopetz et al., ASCO 2010
7 Is feedback regulation responsible for the resistance of CRC cells to BRAF inhibitors?
8 BRAF V600E mutant CRC cell lines are also less responsive to PLX4032 than melanomas having the same mutation Short-term cell viability assay Long-term colony formation assay CRC Melanoma
9 Synthetic lethal shrna screen: Inhibition of which kinase synergizes with PLX in BRAF mutant CRC? infect with shrna kinome library WiDr (BRAFV600E) culture to allow selection control vemurafenib PCR amplify bar codes Deep sequence Quantify shrnas
10 Inhibition of EGFR makes BRAF mutant CRC cells vulnerable to BRAF inhibition Cetuximab EGFR Grb RAS BRAF Mutant MEK ERK
11 Synergistic response of BRAF V600E colon cancer to EGFR and BRAF inhibition BRAF inhibitor EGFR inhibitor 1 BRAF mutant Colon cancer cells +EGFR inhibitor 2 Cetuximab 1.25 mg/ml Gefitinib mm
12 EGFR and BRAF inhibition synergize to suppress BRAF mutant colon cancer growth Human colon cancer growth in mice No drug EGFR inhibitor BRAF inhibitor BRAF+EGFR inhibitor Prahallad et al, Nature 2012
13 Timeline BRAF colon cancer project Publication March 2012 First clinical responses March Start funding research project January 2011 First patient in trial at NKI November
14 BRAF mutant CRC: Design clinical study Courtesy: Jan Schellens, Robin van Geel
15 Initial results from clinical studies in patients Courtesy: Jan Schellens, Robin van Geel
16 Combinations yield durable responses Courtesy: Jan Schellens, Robin van Geel
17 Is the combination of MEK and EGFR inhibitors also effective in KRAS mutant cells? Selumetinib (um) Selumetinib(μM) H358 H2030 H2122 NSCLC +Gefitinib (1uM) H23 CRC: SW620(KRAS G12V ) H747 SW480 SW620 CRC Selumetinib (um) SW837 Gefitinib (1uM) NSCLC: H358 (KRAS G12C )
18 Enrichment Enrichment 100 RNAi screen for enhancers of MEK inhibitors CRC-SW ,1 0, NSCLC-H358 sherbb ERBB3 activation is mostly dependent on heterodimerization ERBB3 binding partners 10 ERBB family 1 0,1 0,01 sherbb Intensity
19 Targeting EGFR and ERBB2 sensitizes KRAS mutant cells to MEK inhibitor Selumetinib (um) Gefitinib (0.5uM) +Pertuzumab (2.5ug/ml) +Afatinib (0.5uM) +Dacometinib (0.5uM) Gefitinib: EGFR inhibitor H358 (KRAS G12C ) Pertuzumab: ERBB2-targeting monoclonal antibody Also seen in H2030, H2122,SW837, SW480 and SW620 Afatinib: EGFR and ERBB2 inhibitor Dacometinib: EGFR, ERBB2 and ERBB4 inhibitor
20 % Change Tumor Volume % Change Tumor Volume 250% 343% 306% Targeting EGFR and ERBB2 sensitizes KRAS mutant cells to MEK inhibitor in a xenograft model VEHICLE AFATINIB VEHICLE AFATINIB TRAMETINIB 50 TRAMETINIB 100 TRA + AFA 0 TRA + AFA Days since treatment start 0-50 H2122 xenografts
21 Ongoing combination trials based on our synthetic lethality screens NCT : LGX818 and Cetuximab or LGX818, BYL719, and Cetuximab in BRAF mutant metastatic CRC NCT : Dabrafenib plus Trametinib plus Panitumumab in BRAF mutant CRC NCT : Vemurafenib and Panitumumab in BRAF mutant Metastatic CRC NCT : Dacomitinib Plus PD in advanced KRAS mutant cancers First responder in clinic: 2 months after publication!
22 Relative EGFR expression EGFR level determines response to BRAF inhibitor Melanoma Colon cancer 2500 p-egfr EGFR HSP Melanoma Colon cancer TCGA database Could melanoma develop resistance to BRAF or MEK inhibitors through acquired expression of EGFR?
23 BRAF mutant melanomas upregulate EGFR during the development of drug resistance Pre- vemurafenib Post- vemurafenib Patient #1 NKI Patient #2 NKI Total: 6/16 patients became EGFR positive Patient #3 IGR EGFR IHC in Brown
24 EGFR expression confers BRAF inhibitor resistance in melanoma EGFR HSP90 Also seen in SK-MEL-28 cells
25 % Change tumor volume (Mean ± SEM) EGFR expression impairs BRAF(V600E) melanoma Proliferation through Oncogene-Induced-Senescence A375-Ctrl. EGF (ng/ml) A375-Ctrl. and A375-EGFR xenografts Empty-Vehicle A375-Ctrl. EGFR-Vehicle A375-EGFR 200 A375-EGFR Days since treatment start EGFR RB p27 p21 A375-Ctrl. A375-EGFR HSP90 SA-β-Gal staining in Blue
26 FACS-assisted shrna genetic screen for determinants of vemurafenib resistance and EGFR expression DAPI DAPI Chromatin regulator shrna library A375 Untreated control 0.5μM Vemurafenib selection (3 weeks) - Chr Library - Vemurafenib EGFR lo w 85.4% EGFR high 0.1% + Chr Library - Vemurafenib EGFR lo w 82.9% EGFR high 0.1% EGFR high Sort EGFR hgh cells - Chr Library + Vemurafenib EGFR low EGFR high 73.5% 0.1% + Chr Library + Vemurafenib EGFR low EGFR high 43.5% 18.1% EGFR Enriched shrna EGFR Deepsequencing SOX10
27 Relative mrna level SOX10 suppression induces EGFR expression and confers vemurafenib resistance 5,0 4,0 EGFR SOX10 HSP90 A375 Vemurafenib (μm) 3,0 2,0 1,0 0,0 SOX10 EGFR Control Ctrl. shsox10-1 shsox10-2 shsox10-1 shsox10-2 A375 A375 b-gal staining in Blue
28 EGFR induction by SOX10 suppression is reversible Polyclonal shsox10 cell population Ctrl. shsox vemurafenib 7 Time (day) - vemurafenib 14 EGFR A375
29 Relative mrna level Relative mrna level Inverse relation between EGFR and SOX10 in paired biopsies of BRAF mutant melanoma Patient #5 Patient #3 pre-treatment post-trametinib pre-treatment post-dabrafenib EGFR IHC in Red EGFR IHC in Brown SOX10 Pre-treatment Post-trametinib SOX10 Pre-treatment Post-dabrafenib Pre-treatment Post-trametinib 0 Pre-treatment Post-dabrafenib
30 The drug holiday effect explained through changes in RAS-BRAF-MEK signaling RTK-1 RTK-1 RTK-2 RTK-1 RTK-2 RTK-1 RAS RAS RAS RAS Drug BRAF* Drug BRAF* BRAF* Drug BRAF* MEK MEK MEK MEK Drug response Drug resistant Senescence Drug Proliferation response Drug resistance development Drug holiday Re-treat after drug holiday
31 Cancer genome analyses Functional genetic analyses Alterations in pathways Cross talk between pathways Precision medicine
32 Acknowledgements The people involved: Chong Sun Liqin Wang Sidong Huang Anirudh Prahallad Prashanth Kumar Wipawadee Grernrum Roderick Beijersbergen Our funding sources: Collaborators: Jan Schellens (NKI) Robin van Geel (NKI) Caroline Robert (IGR) John Haanen (NKI) Jelle Wesseling (NKI) Federica Di Nicolantonio (IRCC) Alberto Bardelli (IRCC)
Targets & therapies for colorectal cancer
Targets & therapies for colorectal cancer Jan Schellens Werkgroep "MOLECULAIRE DIAGNOSTIEK IN DE PATHOLOGIE 31-01-2014 Current treatment options for advanced colorectal cancer (CRC) First line: - CAPOX
More informationSupplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationNew therapeutic strategies for BRAF mutant colorectal cancers
Review Article New therapeutic strategies for BRAF mutant colorectal cancers Ryan B. Corcoran 1,2 1 Massachusetts General Hospital Cancer Center, Boston, MA 02129, USA; 2 Department of Medicine, Harvard
More informationNSCLC 2 nd and further line therapies. Egbert F. Smit MD PhD. Dept. Thoracic Oncology, Netherlands Cancer Institute
NSCLC 2 nd and further line therapies Egbert F. Smit MD PhD. Dept. Thoracic Oncology, Netherlands Cancer Institute e.smit@nki.nl ESMO Guidelines 2016: Treatment of Stage IV nonsquamous NSCLC at progression
More informationKinome Profiling: The Potential in ER-Negative Patients. Charles M. Perou, Ph.D. Departments of Genetics and Pathology
Kinome Profiling: The Potential in ER-Negative Patients Charles M. Perou, Ph.D. Departments of Genetics and Pathology Lineberger Comprehensive Cancer Center University of North Carolina Chapel Hill, North
More informationMolecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
More informationBRAF: dal melanoma alla HCL
ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica BRAF: dal
More information7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview
Emerging mutations as predictive biomarkers in lung cancer: Overview Kirtee Raparia, MD Assistant Professor of Pathology Cancer Related Deaths: United States Men Lung and bronchus 28% Prostate 10% Colon
More informationTherapeutic Options for Patients with BRAF-mutant Metastatic Colorectal Cancer
Therapeutic Options for Patients with BRAF-mutant Metastatic Colorectal Cancer Axel Grothey, M.D., Professor of Oncology, Clinical and Translational Science Division of Medical Oncology Mayo Clinic, Rochester,
More informationLung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17
Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD Mount Carrigain 2/4/17 Histology Adenocarcinoma: Mixed subtype, acinar, papillary, solid, micropapillary, lepidic
More informationCorporate Medical Policy
Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer
More informationPrecision Genetic Testing in Cancer Treatment and Prognosis
Precision Genetic Testing in Cancer Treatment and Prognosis Deborah Cragun, PhD, MS, CGC Genetic Counseling Graduate Program Director University of South Florida Case #1 Diana is a 47 year old cancer patient
More informationDevelopment of Rational Drug Combinations for Oncology Indications - An Industry Perspective
Development of Rational Drug Combinations for Oncology Indications An Industry Perspective Stuart Lutzker, MDPhD Vice President Oncology Early Development Genentech Inc 1 Conventional Oncology Drug Development
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationAWARD NUMBER: W81XWH TITLE: An in Vivo shrna-drug Screen to Identify Novel Targeted Therapy Combinations for KRAS Mutant Cancers
AWARD NUMBER: W81XWH-12-1-0420 TITLE: An in Vivo shrna-drug Screen to Identify Novel Targeted Therapy Combinations for KRAS Mutant Cancers PRINCIPAL INVESTIGATOR: Ryan B. Corcoran, M.D., Ph.D. CONTRACTING
More informationColorectal Cancer in the Coming Years: What Can We Expect?
Colorectal Cancer in the Coming Years: What Can We Expect? Clara Montagut, MD, PhD Hospital Universitari del Mar, Barcelona, Spain Memorial Sloan Kettering Cancer Center, New York, United States What Are
More informationOverexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma
Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share
More informationAACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationGENETIC TESTING FOR TARGETED THERAPY FOR NON-SMALL CELL LUNG CANCER (NSCLC)
CANCER (NSCLC) Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and drugs are
More informationDeSigN: connecting gene expression with therapeutics for drug repurposing and development. Bernard lee GIW 2016, Shanghai 8 October 2016
DeSigN: connecting gene expression with therapeutics for drug repurposing and development Bernard lee GIW 2016, Shanghai 8 October 2016 1 Motivation Average cost: USD 1.8 to 2.6 billion ~2% Attrition rate
More informationNature Medicine: doi: /nm.3559
Supplementary Note 1. A sample alteration report. Each alteration nominated by PHIAL is curated to answer specific fields that are intended to guide physician interpretation. Gene Alteration Patient ID
More informationCONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA
AD Award Number: W81XWH-12-1-0420 TITLE: An in vivo shrna-drug screen to identify novel targeted therapy combinations for KRAS mutant cancers PRINCIPAL INVESTIGATOR: Ryan B. Corcoran, MD PhD CONTRACTING
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
More informationDr. Andres Wiernik. Lung Cancer
Dr. Andres Wiernik Lung Cancer Lung Cancer Facts - Demographics World Incidence: 1 8 million / year World Mortality: 1 6 million / year 5-year survival rates vary from 4 17% depending on stage and regional
More informationUpdate on Targeted Therapy in Melanoma
Update on Targeted Therapy in Melanoma Seville June 2013 James Larkin FRCP PhD London UK Overview What are the targets in melanoma? BRAF / KIT / NRAS / GNAQ / MEK DNA / microtubules CTLA4 / PD1 / PDL1
More informationMETASTATIC COLORECTAL CANCER: TUMOR MUTATIONAL ANALYSIS AND ITS IMPACT ON CHEMOTHERAPY SUMA SATTI, MD
METASTATIC COLORECTAL CANCER: TUMOR MUTATIONAL ANALYSIS AND ITS IMPACT ON CHEMOTHERAPY SUMA SATTI, MD INTRODUCTION Second leading cause of cancer related death in the United States. 136,830 cases in 2014
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationImplementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges
Implementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges Frédérique Nowak - 21 october 2015 "Putting Science into Standards event:
More informationLeucine Deprivation Reveals a Targetable Liability
Cancer Cell, 19 Supplemental Information Defective Regulation of Autophagy upon Leucine Deprivation Reveals a Targetable Liability of Human Melanoma Cells In Vitro and In Vivo Joon-Ho Sheen, Roberto Zoncu,
More informationDr C K Kwan. Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK
HA Convention 2013 Dr C K Kwan MBChB, FRCR, FHKCR, FHKAM, MPM, CPI, MAppMgt(Hlth) Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK To personalize cancer
More informationCorporate Medical Policy
Corporate Medical Policy BRAF Gene Variant Testing to Select Melanoma or Glioma Patients File Name: Origination: Last CAP Review: Next CAP Review: Last Review: braf_gene_variant_testing_to_select_melanoma_or_glioma_patients_for_targeted_
More informationNew Developments in the Treatment of Colorectal Cancer. Jonathan Loree, MD, MS, FRCPC Department of Medical Oncology BC Cancer Vancouver Centre
New Developments in the Treatment of Colorectal Cancer Jonathan Loree, MD, MS, FRCPC Department of Medical Oncology BC Cancer Vancouver Centre Personalized Medicine Currently already part of oncology:
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationTargeting the ERBB family in cancer: couples therapy
OPINION Targeting the ERBB family in cancer: couples therapy Niall Tebbutt, Mikkel W. Pedersen and Terrance G. Johns Abstract The ERBB family of receptor tyrosine kinases has a central role in the tumorigenesis
More informationMelanoma: From Chemotherapy to Targeted Therapy and Immunotherapy. What every patient needs to know. James Larkin
Melanoma: From Chemotherapy to Targeted Therapy and Immunotherapy What every patient needs to know James Larkin Melanoma Therapy 1846-2017 Surgery 1846 Cytotoxic Chemotherapy 1946 Checkpoint Inhibitors
More informationCLINICAL UPDATE ON K-RAS
CLINICAL UPDATE ON K-RAS TARGETED THERAPY IN GASTROINTESTINAL CANCERS S. PA N T, 1 J. H U B B A R D, 2 E. M A RT I N E L L I, 3 A N D T. B E K A I I - S A A B 4 SELECTED HIGHLIGHTS 1 Department of Investigational
More informationMEDICAL POLICY. SUBJECT: GENOTYPING - RAS MUTATION ANALYSIS IN METASTATIC COLORECTAL CANCER (KRAS/NRAS) POLICY NUMBER: CATEGORY: Laboratory
MEDICAL POLICY Clinical criteria used to make utilization review decisions are based on credible scientific evidence published in peer reviewed medical literature generally recognized by the medical community.
More informationWNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors
Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,
More informationThe selective ERK inhibitor BVD-523 is active in models of MAPK pathway-dependent cancers, including those with intrinsic and acquired drug resistance
The selective ERK inhibitor BVD-523 is active in models of MAPK pathway-dependent cancers, including those with intrinsic and acquired drug resistance Ursula Germann 1, Brinley Furey 2, Jeff Roix 3, William
More informationNew Systemic Therapies in Advanced Melanoma
New Systemic Therapies in Advanced Melanoma Sanjay Rao, MD FRCPC Medical Oncologist (BCCA-CSI) Clinical Assistant Professor, UBC Faculty of Medicine SON Fall Update October 22, 2016 Disclosures Equity
More informationCorporate Medical Policy
Corporate Medical Policy BRAF Gene Mutation Testing to Select Melanoma or Glioma Patients File Name: Origination: Last CAP Review: Next CAP Review: Last Review: braf_gene_mutation_testing_to_select_melanoma_or_glioma_patients_for_targeted_
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationIdentification of BRAF mutations in melanoma lesions with the Roche z480 instrument
Identification of BRAF mutations in melanoma lesions with the Roche z480 instrument Márta Széll IAP, Siófok May 14, 2012 Multifactorial skin diseses: much more frequent then genodermatoses exhibit familial
More informationInnovations in Immunotherapy - Melanoma. Systemic Therapies October 27, 2018 Charles L. Bane, MD
Innovations in Immunotherapy - Melanoma Systemic Therapies October 27, 2018 Charles L. Bane, MD Melanoma Prognosis Survival at 10 years Stage I: 90% Stage II: 60% Stage III: 40% Stage IV: 10% 2 Indications
More informationColorectal Cancer in 2017: From Biology to the Clinics. Rodrigo Dienstmann
Colorectal Cancer in 2017: From Biology to the Clinics Rodrigo Dienstmann MOLECULAR CLASSIFICATION Tumor cell Immune cell Tumor microenvironment Stromal cell MOLECULAR CLASSIFICATION Biomarker Tumor cell
More informationRationale and results from. BRAFi and immunotherapy
Rationale and results from emerging combinations of BRAFi and immunotherapy Antoni Ribas, M.D. rofessor of Medicine rofessor of Surgery rofessor of Molecular and Medical harmacology Director, Tumor Immunology
More information1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli
Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy
More informationLiquid biopsies to track clonal evolution and resistance to EGFR inhibition in mcrc
Liquid biopsies to track clonal evolution and resistance to EGFR inhibition in mcrc Alberto Bardelli Candiolo Cancer Center IRCCs University of Torino - Medical School Disclosures Horizon discovery Biocartis
More informationCurrent Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors)
Current Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors) Kael Mikesell, DO McKay-Dee Hospital May 14, 2015 Outline Update to DNA Testing
More informationShould novel molecular therapies replace old knowledge of clinical tumor biology?
Should novel molecular therapies replace old knowledge of clinical tumor biology? Danai Daliani, M.D. Director, 1 st Oncology Clinic Euroclinic of Athens Cancer Treatments Localized disease Surgery XRT
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationI. Diagnosis of the cancer type in CUP
Latest Research: USA I. Diagnosis of the cancer type in CUP II. Outcomes of site-specific therapy of the cancer type in CUP a. Prospective clinical trial b. Retrospective clinical trials 1 Latest Research:
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationFunctional genomics reveal that the serine synthesis pathway is essential in breast cancer
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer Results Presented by Stacey Lin Lloyd Lab http://www.amsbio.com/expression-ready-lentiviral-particles.aspx Overview
More informationPersonalized Medicine: Lung Biopsy and Tumor
Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationINIBITORE di BRAF nel MELANOMA
INIBITORE di BRAF nel MELANOMA Paola Agnese Cassandrini Negrar,29 novembre 2016 BRAF is a serine/threonine protein kinasi encoded on chromosome 7q34 that activates the MAP kinase/erksegnaling pathway
More informationSelecting the right patients for the right trials.
Selecting the right patients for the right trials. Paul Waring Professor of Pathology University of Melbourne June 21, 2011 RCPA Genetics short course Drug development challenges. Current model of drug
More informationMolecular Targets in Lung Cancer
Molecular Targets in Lung Cancer Robert Ramirez, DO, FACP Thoracic and Neuroendocrine Oncology November 18 th, 2016 Disclosures Consulting and speaker fees for Ipsen Pharmaceuticals, AstraZeneca and Merck
More informationNovel Molecularly Targeted Therapies and Biomarkers in Advanced Colorectal Cancer. Objectives
Novel Molecularly Targeted Therapies and Biomarkers in Advanced Colorectal Cancer Michael S. Lee, MD Assistant Professor of Medicine University of North Carolina Objectives Discuss important clinicopathologic
More informationEvolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationFunctional Genomics : PTPRF-Mediated Contact Inhibition in HCC development
Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan Aims To identify genes controlling tumor
More informationRandomized Phase II Study of Irinotecan and Cetuximab with or without Vemurafenib in BRAF Mutant Metastatic Colorectal Cancer
Randomized Phase II Study of Irinotecan and Cetuximab with or without Vemurafenib in BRAF Mutant Metastatic Colorectal Cancer This is a two-arm, randomized phase II trial for patients with BRAF mutant
More informationEts-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs
Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Indian Patent Application No. 1623/DEL/2014 Inventors: Prof. Kulbhushan Tikoo and Jasmine Kaur Department of Pharmacology
More informationBRAF Gene Mutation Testing To Select Melanoma Patients for BRAF Inhibitor Targeted Therapy. Original Policy Date
MP 2.04.66 BRAF Gene Mutation Testing To Select Melanoma Patients for BRAF Inhibitor Targeted Therapy Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date
More informationPushing the boundaries-targeted therapies
Pushing the boundaries-targeted therapies Professor Grant McArthur MB BS PhD Director Melanoma and Skin Cancer VCCC Parkville, Peter MacCallum Cancer Centre Lorenzo Galli Chair of Melanoma & Skin Cancers,
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant
More informationTARGETED THERAPY FOR LUNG CANCER. Patient and Caregiver Guide
TARGETED THERAPY FOR LUNG CANCER Patient and Caregiver Guide TARGETED THERAPY FOR LUNG CANCER Patient and Caregiver Guide TABLE OF CONTENTS Why Targeted Therapy?...2 Lung Cancer Basics...2 Changes in
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationPersonalized Therapies for Lung Cancer. Questions & Answers
Personalized Therapies for Lung Cancer Questions & Answers What are Personalized Therapies for lung cancer? Like people, no two lung cancer tumors are the same. Personalized medicine (also known as precision
More informationThe oncologist s point of view: the promise and challenges of increasing options for targeted therapies in NSCLC
The oncologist s point of view: the promise and challenges of increasing options for targeted therapies in NSCLC Egbert F. Smit Department of Thoracic Oncology, Netherlands Cancer Institute, and Department
More informationBRAF Inhibition in Melanoma
BRAF Inhibition in Melanoma New York City, Mar 22-23, 2013 Bartosz Chmielowski, MD, PhD Assistant Clinical Professor University of California Los Angeles Disclosures Speaker Bureau: BMS, Genentech, Prometheus
More informationIntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
More informationGenomics Up Close And Personal: What Are The Implications For Cancer Nursing? Candy Cooley Head of Education
Genomics Up Close And Personal: What Are The Implications For Cancer Nursing? Candy Cooley Head of Education Aims of this session Understand how genomic information will change your clinical practice Remind
More informationClinical Policy: Cetuximab (Erbitux) Reference Number: PA.CP.PHAR.317
Clinical Policy: (Erbitux) Reference Number: PA.CP.PHAR.317 Effective Date: 01/18 Last Review Date: 11/17 Coding Implications Revision Log Description The intent of the criteria is to ensure that patients
More informationPERSONALISED COMBINATORIAL APPROACHES TO CLOSING DOWN ALL THE KEY ONCOGENIC DRIVERS THE AVERA TEAM
PERSONALISED COMBINATORIAL APPROACHES TO CLOSING DOWN ALL THE KEY ONCOGENIC DRIVERS THE AVERA TEAM OUR TEAM IS ADMINISTERING SEQUENCE-BASED DOUBLE AND TRIPLE THERAPIES NOW Coexpression of patterns of MYC
More informationStrandAdvantage Tissue-Specific Cancer Genomic Tests. Empowering Crucial First-Line Therapy Decisions for Your Patient
StrandAdvantage Tissue-Specific Cancer Genomic Tests Empowering Crucial First-Line Therapy Decisions for Your Patient Harness the power of precision medicine with StrandAdvantage Precision medicine in
More informationBig data vs. the individual liver from a regulatory perspective
Big data vs. the individual liver from a regulatory perspective Robert Schuck, Pharm.D., Ph.D. Genomics and Targeted Therapy Office of Clinical Pharmacology Center for Drug Evaluation and Research Food
More informationK-Ras signalling in NSCLC
Targeting the Ras-Raf-Mek-Erk pathway Egbert F. Smit MD PhD Dept. Pulmonary Diseases Vrije Universiteit VU Medical Centre Amsterdam, The Netherlands K-Ras signalling in NSCLC Sun et al. Nature Rev. Cancer
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature23291 Supplementary discussion part 1 Our model suggests that, in tumours that express Class 3 BRAF mutants and activated RAS, both BRAF MUT /RAF WT heterodimers and WT RAF dimers are
More informationNIH Public Access Author Manuscript Cancer Discov. Author manuscript; available in PMC 2013 March 1.
NIH Public Access Author Manuscript Published in final edited form as: Cancer Discov. 2012 March ; 2(3): 227 235. doi:10.1158/2159-8290.cd-11-0341. EGFR-mediated re-activation of MAPK signaling contributes
More informationDesign of Clinical Trials with Molecularly Targeted Therapies. Gilberto Schwartsmann
Design of Clinical Trials with Molecularly Targeted Therapies Gilberto Schwartsmann What are the basics of clinical trial design? Presented By Jordan Berlin at 2016 ASCO Annual Meeting Advances in molecular
More informationMED12 Controls the Response to Multiple Cancer Drugs through Regulation of TGF-b Receptor Signaling
Controls the Response to Multiple Cancer Drugs through Regulation of TGF-b Receptor Signaling Sidong Huang, 1 Michael Hölzel, 1,9 Theo Knijnenburg, 1 Andreas Schlicker, 1 Paul Roepman, 3,4 Ultan McDermott,
More informationClinical Biomarker in Kidney Cancer. Maria Nirvana Formiga, M.D., Ph.D.
Clinical Biomarker in Kidney Cancer Maria Nirvana Formiga, M.D., Ph.D. Disclosures I am on the Speaker s Bureau with Pfizer and Bayer Clinical trials of BMS and Pfizer Kidney Cancer 70% new cases in developed
More informationTargeted Therapeutics for the Treatment of Cancer
Targeted Therapeutics for the Treatment of Cancer Company overview Three promising targeted anti-cancer programs Irreversible pan-erbb inhibitor EGFR/HER2/HER4 inhibitor PARP inhibitor Strategy Focus on
More informationThe mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge
The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly
More informationSupplementary Online Content
Supplementary Online Content Kris MG, Johnson BE, Berry LD, et al. Using Multiplexed Assays of Oncogenic Drivers in Lung Cancers to Select Targeted Drugs. JAMA. doi:10.1001/jama.2014.3741 etable 1. Trials
More informationColon Cancer ASCO Poster Review
Rome, February 11 th 2017 AIOM POST ASCO GI Review Colon Cancer ASCO Poster Review Lisa Salvatore UOC Oncologia Policlinico GB Rossi Azienda Ospedaliero Universitaria Integrata di Verona Me Before Me After
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationthis mutation. However, VEM was not effective. The PDOX model thus helped identify
/, Vol. 7, No. 44 Vemurafenib-resistant BRAF-V600E-mutated melanoma is regressed by MEK-targeting drug trametinib, but not cobimetinib in a patient-derived orthotopic xenograft (PDOX) mouse model Kei Kawaguchi
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More information