Nature Medicine: doi: /nm.4078

Size: px
Start display at page:

Download "Nature Medicine: doi: /nm.4078"

Transcription

1 Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios (n = 2,618) of the 1:1 protein mixture fits a normal distribution, with a mean (µ) of 0.02 and s.d. (σ) of 0.22 (black and red-dashed line, respectively). Proteins were considered as up-regulated upon cetuximab when their H/L SILAC protein ratio lie above two s.d. from the mean (µ + 2σ). (c, d) Gene ontology analysis. Bar-chart (c) representing the results for cellular components classification. The color code of the DAG graphical display (d) reflects the degree of enrichment, based on the calculated adjusted P values (BH correction). 1

2 Supplementary Figure 2. Cetuximab induces immunogenic phagocytosis of hegfr-ct26 cells in the absence of tumor cell death. (a) Western blot and quantification of p-eif2-α expression in hegfr-ct26 cells exposed or not (NT) to FOLFIRI (F), cetuximab (C) or the combination of the two (F+C). (b) Quantification of phagocytosis of hegfr-ct26 (left) and CT26 cells infected with empty p-babe retroviral vector (p-babe-ct26) (right) assessed by flow cytometry. Graph displaying the percentage of DCs positive for DDAO after co-culture with tumor cells. Error bars, s.e.m. of four (hegfr-ct26) or two (p-babe-ct26) independent experiments. *** P < versus NT (one-way ANOVA using Bonferroni post-test). (c) Graph showing the percentage of early (white) or late (black) apoptotic hegfr-ct26 cells. Error bars, s.e.m. of two independent experiments. * P < 0.05, P < 0.01,,*** P < ( * referred to Ann + /7-AAD +, referred to Ann + ) versus NT (two-way ANOVA using Bonferroni post-test). (d) Bar graphs showing the cell growth, reported as fluorescence intensity, measured to the starting point of treatment (t = 0) and after 72 h. Left, hegfr-ct26 cells treated with the indicated concentration of cetuximab. Right, hegfr- CT26 cells treated with cetuximab, FOLFIRI at three different concentrations (irinotecan 30, 60 or 120 µm + 5-FU-calcium levofolinate 10, 20 or 40 µm) alone or in combination with cetuximab (F + C). Data are average values ± s.d. from eight replicates in a representative experiment. (e) HMGB1 release measured in the supernatant of hegfr-ct26 cells. Error bars, s.e.m. of four independent experiments. ** P < versus NT (one-way ANOVA using Bonferroni post-test). 2

3 Supplementary Figure 3. Cetuximab does not trigger ICD of HT-29 cells. (a i) HT-29 cells were treated or not (NT) with FOLFIRI (F), cetuximab (C) or the combination of the two (F + C). (a) Representative cytofluorimetric plots of three independent experiments displaying cell viability analysed by annexin V/7-AAD staining. (b) Graph showing the percentage of cells in early (white) and late (black) apoptosis. Error bars, s.e.m. of two independent experiments. P < 0.05, P < 0.01, *** P < ( * referred to Ann + /7-AAD +, referred to Ann + ) versus NT (two-way ANOVA using Bonferroni post-test). (c) Western blot and quantification of p-eif2-α expression. (d) Representative immunofluorescence images showing CRT translocation (green), phalloidin (red) and DAPI (blue). Scale bar: 50 µm. (e) Representative histogram of three independent flow cytometry experiments 3

4 showing CRT translocation to the cell surface. (f) Representative immunofluorescence images showing the intracellular expression of CRT and ERp57 (red) in HT-29 cells, phalloidin (green) and DAPI (blue). Scale bar: 50 µm. (g) Representative transmitted light images showing the absence of interaction between F + C treated HT-29 cells and DCs. Scale bar: 50 µm. (h) Representative confocal images showing untreated (NT) or F + C treated HT-29 cells (red) co-cultured with DCs (green). Scale bar: 50 µm. (i) Graph displaying the percentage of DCs positive for DDAO after coculture with HT-29 cells. Error bars, s.e.m. of three independent experiments. 4

5 Supplementary Figure 4. Cetuximab, or panitumumab, in combination with FOLFIRI or oxaliplatin, induce phagocytosis of DiFi, but not of HT-29 cells by DCs. (a, b) DiFi and HT-29 cells were treated or not (NT) with FOLFIRI (F), cetuximab (C), oxaliplatin (OXP) or the combination of the two (F + C or OXP + C). (a) Cell viability of DiFi (top) and HT-29 (bottom) was analysed by annexin V/7-AAD staining. Graph showing the percentage of cells in early (white) and late (black) apoptosis. Error bars, s.e.m. of three independent experiments. * P < 0.05, P < 0.01, P < ( * referred to Ann + /7-AAD +, referred to Ann + ) versus NT (two-way ANOVA using Bonferroni post-test). (b) Quantification of phagocytosis assessed by flow cytometry. Graphs displaying the percentage of DCs positive for DDAO after co-culture with DiFi (top) or HT-29 (bottom) cells. Error bars, s.e.m. of two independent experiments. ** P < 0.01, *** P < versus NT (one-way ANOVA using Bonferroni post-test). (c) Representative histogram of two independent flow cytometry experiments showing the binding of cetuximab (0.1 ng/ml) and panitumumab (0.1 ng/ml) to EGFR of DiFi (top) and HT-29 (bottom) cells. Cells were stained also with isotype control (higg). (d) Quantification of phagocytosis assessed by flow cytometry. Graphs displaying the percentage of DCs positive for DDAO after co-culture with DiFi (top) or HT-29 (bottom) exposed or not (NT) to panitumumab (P), FOLFIRI in combination with cetuximab (F + C) or panitumumab (F + P). Error bars, s.e.m of three replicates. * P < 0.05, ** P < 0.01 versus NT (one-way ANOVA using Bonferroni post-test). 5

6 Supplementary Figure 5. Phagocytosis of different human CRC cell lines (raw data of Table 1). (a) Quantification of phagocytosis of SK-CO-1, HCT116, Lim1215 KRAS G12D treated or not (NT) with FOLFIRI (F), cetuximab (C) or the combination of the two (F + C) co-cultured with DCs, assessed by flow cytometry. Error bars, s.e.m. of two (SK-CO-1) or three (HCT116, Lim1215 KRAS G12D ) independent experiments. * P < 0.05 versus NT (one-way ANOVA using Bonferroni post-test). ** P < 0.01 versus NT (unpaired Student s t-test). (b) Quantification of phagocytosis of OXCO-2, Caco-2, COLO-205, RKO, NCI-H508 cells treated or not (NT) with FOLFIRI (F), cetuximab (C) or the combination of the two (F+C) co-cultured with DCs, assessed by flow cytometry. Error bars, s.e.m. of three replicates (OXCO-2, COLO205, NCI-H508) or of two independent experiments (Caco-2, RKO). * P < 0.05 versus NT (unpaired Student s t-test). 6

7 Supplementary Figure 6. PLX4032 treatment fosters phagocytosis of OXCO-1 and HT-29 cells. (a) OXCO-1 cells (BRAF V600E ) were exposed or not (NT) to F + C or EGF, in the absence or in the presence of PLX4032 (PLX, 3 µm) and trametinib (Tram) alone or in combination (PLX + Tram). Left, quantification of phagocytosis assessed by flow cytometry. Data normalized to the percentage of DDAO positive DCs co-cultured with untreated tumor cells. Error bars, s.e.m. of three independent experiments. *** P < versus NT (one-way ANOVA with Bonferroni post-test). Right, western blot showing the modulation of EGFR pathway. (b) Quantification of phagocytosis of HT-29 cells treated or not (NT) with F+C, in the absence or in the presence of PLX4032 (PLX, 3 µm) and trametinib (Tram) alone or in combination (PLX + Tram), assessed by flow cytometry. Each data set normalized to the percentage of DDAO positive DCs co-cultured with their respective controls. Error bars, s.e.m. of two independent experiments. * P < 0.05 (one-way ANOVA with Bonferroni post-test). (c) Lim1215 WT cells were exposed or not (NT) to F+C or EGF, in the absence or in the presence of PLX4032 (PLX, 3µM) + trametinib (PLX + Tram). Left, quantification of phagocytosis assessed by flow cytometry. Data normalized to the percentage of DDAO positive DCs co-cultured with untreated tumor cells. Error bars, s.e.m. of two independent experiments. * P < 0.05, ** P < 0.01 versus NT (one-way ANOVA with Bonferroni post-test). Right, western blot showing the modulation of EGFR pathway. 7

8 Supplementary Figure 7. UPR activation in Lim1215 WT and Lim1215 BRAF V600E cells. (a, b) Lim1215 WT and Lim1215 BRAF V600E were treated or not (NT) with FOLFIRI (F), cetuximab (C) or the combination (F + C). (a) Western blot and quantification of p-eif2-α expression. Error bars, s.e.m. of three independent experiments. * P < 0.05 versus NT (one-way ANOVA using Bonferroni post-test). (b) Quantification of DDIT3 (CHOP) and HSPA5 (BiP) mrna expression. Data expressed as fold change compared to untreated Lim1215 WT. Error bars, s.d. of two independent experiments each one performed in duplicate. *** P < versus NT Lim1215 WT, P < versus NT Lim1215 BRAF V600E (one-way ANOVA using Bonferroni post-test). (c) Quantification of BAK1 and BAX mrna expression in Lim1215 WT exposed or not (NT) to F, C or F + C and in Lim1215 BRAF V600E cells treated or not (NT) with F, C or F + C in the presence of 4µ8c in combination or not with trametinib (Tram). Data expressed as fold change compared to untreated Lim1215 WT. Error bars, s.d. of two independent experiments each one performed in duplicate. *** P < versus NT Lim1215 WT (one-way ANOVA using Bonferroni post-test). 8

9 Supplementary Figure 8. Thapsigargin by promoting UPR and high levels of XBP1s inhibits F + C induced phagocytosis of both Lim1215 WT and DiFi cells. (a, b) Lim1215 WT cells were treated or not with F, C or F+C in the presence or not of thapsigargin. (a) Quantification of ATF4, DDIT3 (CHOP), HSPA5 (BiP) and XBP1s mrna expression. Data expressed as fold change compared to untreated Lim1215 WT. Error bars, s.d. of two independent experiments each one performed in duplicate. ** P < 0.01, *** P < versus NT Lim1215 WT (one-way ANOVA using Bonferroni post-test). (b) Left, quantification of phagocytosis assessed by flow cytometry. Data normalized to the percentage of DDAO positive DCs co-cultured with thapsigargin treated tumor cells. Error bars, s.e.m. of one representative experiment (one-way ANOVA with Bonferroni post-test). Right, western blot showing the modulation of XBP1s, PUMA and P-ERK1/2. (c) DiFi cells were treated or not (NT) with F + C in the presence or absence of thapsigargin. Left, quantification of phagocytosis assessed by flow cytometry. Data normalized to the percentage of DDAO positive DCs co-cultured with untreated or thapsigargin treated tumor cells. Error bars, s.e.m. of two independent experiments; *** P < versus NT (one-way ANOVA with Bonferroni post-test). Right, western blot showing the modulation of XBP1s, PUMA and P-ERK1/2. 9

10 Supplementary Table 1 and 2. SILAC. MaxQuant software generates an output table named proteingroup.txt where all proteins identified and quantified, with corresponding SILAC protein ratios are listed. A summary of it is reported in.excel format after the following filters are applied (Supplementary Table 1): proteins are retained if they contain at least two peptides, at least one of which unique (peptide > 1, unique > 0) and if they have at least two ratio counts (RC > 1). For each protein, the corresponding Protein name, Gene name, Ratio H/L and Ratio H/L count are reported. The 75 up-regulated proteins are ranked based on decreasing SILAC ratio H/L (Supplementary Table 2). The linear and log 2 -transformed values of the H/L ratio are reported for each protein entry. HMGB1 NT F C F + C DiFi KRAS WT BRAF WT BRAF mut Lim OXCO Caco HT COLO RKO* NCI-H508* KRAS mut KRAS G12V SK-CO KRAS G13D HCT KRAS G12D Lim1215 (KRAS G12D ) Supplementary Table 3. HMGB1 release in treated human CRC cells. Human CRC cell lines with different mutation in KRAS, BRAF and PIK3CA (*) genes were treated or not (NT) with FOLFIRI (F), cetuximab (C) or the combination of the two (F + C). HMGB1 release analysed by ELISA in the supernatant after 48 h of treatment: ( ) indicates HMGB1 < 3 ng/ml; (+) 3 < HMGB1 < 30 ng/ml; (++) 30 < HMGB1 < 150 ng/ml, (+++) 150 < HMGB1 < 450 ng/ml, (++++) HMGB1 > 450 ng/ml). 10

11 XBP1s ATF4 DDIT3 HSPA5 BBC3 BAX BAK1 GAPDH 5'-CTGAGTCCGAATCAGGTGCAG-3' 5'-ATCCATGGGGAGATGTTCTGG-3' 5'-GTTCTCCAGCGACAAGGCTA-3' 5'-ATCCTCCTTGCTGTTGTTGG-3' 5'-AGAACCAGGAAACGGAAACAGA-3' 5'-TCTCCTTCATGCGCTGCTTT-3' 5'-TGTTCAACCAATTATCAGCAAACTC-3' 5'-TTCTGCTGTATCCTCTTCACCAGT-3' 5'-ACCTCAACGCACAGTACGAG-3' 5'-CCCATGATGAGATTGTACAGGA-3' 5'-TGGAGCTGCAGAGGATGATTG-3' 5'-GAAGTTGCCGTCAGAAAACATG-3' 5'-ATGGTCACCTTACCTCTGCAA-3' 5'-TCATAGCGTCGGTTGATGTCG-3' 5'-ATCAGCAATGCCTCCTGCAC-3' 5'-TGGCATGGACTGTGGTCATG-3' Supplementary Table 4. Human primers used in qpcr assays. 11

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

More information

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1. A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture

More information

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Daniele Santini University Campus Bio-Medico Rome, Italy

Daniele Santini University Campus Bio-Medico Rome, Italy Daniele Santini University Campus Bio-Medico Rome, Italy Anti EGFR therapy and colorectal cancer Cetuximab or Panitumumab Adapted from Ciardiello F. and Tortora G. NEJM 2008;358:1160-74 Who will benefit

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Generation of cetuximab-resistant cells and analysis of singlecell clones. Cetuximab-sensitive cells (LIM1215 and OXCO-2) were chronically treated with cetuximab

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Cancer Stem Cells from Colorectal Cancer Cell Lines. Walter Bodmer Weatherall Institute of Molecular Medicine Oxford University

Cancer Stem Cells from Colorectal Cancer Cell Lines. Walter Bodmer Weatherall Institute of Molecular Medicine Oxford University Cancer Stem Cells from Colorectal Cancer Cell Lines Walter Bodmer Weatherall Institute of Molecular Medicine Oxford University Fully differentiated cells: columnar goblet enteroendocrine Myofibroblasts

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

Phenotype Determines Nanoparticle Uptake by Human

Phenotype Determines Nanoparticle Uptake by Human Phenotype Determines Nanoparticle Uptake by Human Macrophages from Liver and Blood Sonya A. MacParland a,b,, Kim M. Tsoi c,d,, Ben Ouyang c, Xue-Zhong Ma a, Justin Manuel a, Ali Fawaz b, Mario A. Ostrowski

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Nature Structural & Molecular Biology: doi: /nsmb.3218

Nature Structural & Molecular Biology: doi: /nsmb.3218 Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas

More information

Nature Protocols: doi: /nprot Supplementary Figure 1

Nature Protocols: doi: /nprot Supplementary Figure 1 Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Loss of protein association causes cardiolipin degradation in Barth syndrome

Loss of protein association causes cardiolipin degradation in Barth syndrome SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas

More information

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information