Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
|
|
- Alfred Burns
- 5 years ago
- Views:
Transcription
1 Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds (30d) of NTBC withdrawal were stained with anti-fah antibody (A) or H&E (B). Healthy donor-derived cells are less vacuolated, stain positively for Fah and more glycogen granules causing a darker pigmentation after H&E staining. Magnification: 125x. Supplementary Figure 2 Ontology-based distribution of gene categories between -enriched and depleted populations of untreated or DDC-treated mouse liver. The most relevant gene categories observed to be differentially expressed in pairwise comparisons are indicated, as are the numbers of probes used for GO and Kegg analyses.
2 Gene Identity 5' primer 3' primer CK19/KRT19 Cytokeratin 19 GGACCCTCCCGAGATTACAACCA GCCAGCTCCTCCTTCAGGCTCT CFTR Cystic Fibrosis TCTCAGCCTTCTGTGGCCTTGG TCCGGGTCATTTTCAGCTCCAC Transmembrane Receptor CAII Carbonic anhydrase II ACCGGATGGATTGGCTGTTTTG AAGTTAGCAAAGGCCGCACGCT DPPIV/CD26 Dipeptidyl peptidase IV GGCCCTGCGTGCTACTTCCTGGCTCG ACGTCCTGCGCGGCTGCTCTGC Alb Albumin GCAGATGACAGGGCGGAACTTG AAAATCAGCAGCAATGGCAGGC HNF4a Hepatocyte nuclear factor 4a CGGGCTGGCATGAAGAAGGAAG TGGGAGAGGTGATCTGCTGGGA TAT Tyrosine aminotransferase CGTGGTCAACAACCCGTCCAAT ATTGCCTTTCAGCCACTGCCAA Des Desmin GAGAAACCAGCCCCGAGCAAAG AGCCTCGCTGACAACCTCTCCA SOX9 Sry-family homeobox 9 TGCCCATGCCCGTGCGCGTCAA CGCTCCGCCTCCTCCACGAAGGGTCT FOXJ1 Forkhead box J1 CCGCCATGCAGACCCCACCTGGCA AGGCCCCACTGAGCAGGCGCTCT GAPDH GAPDH AAGGTCGGTGTGAACGGATTTGG CGTTGAATTTGCCGTGAGTGGAG Actb Beta actin TTCTTTGCAGCTCCTTCGTT ATGGAGGGGAATACAGCCC Supplementary Table 1 qrt-pcr primers. Except where noted (asterisks), each amplicon spans a >2kb intron. Where possible, one primer lies on an intron-exon boundary to further minimize amplification of contaminating genomic DNA. Cycle threshold values were recorded as baseline corrected curve-fitted values and reported as normalized values relative to housekeeping gene GAPDH.
3 Dorrell et al. A murine liver Page 3 Elevated in fraction Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Complement and coagulation cascades E E E-17 KEGG_PATHWAY Drug metabolism E E E-13 KEGG_PATHWAY Metabolism of xenobiotics by cytochrome P E E E-08 KEGG_PATHWAY Retinol metabolism E E E-08 KEGG_PATHWAY Tryptophan metabolism E E E-04 KEGG_PATHWAY Drug metabolism E E E-03 KEGG_PATHWAY Fatty acid metabolism E E E-03 KEGG_PATHWAY Primary bile acid biosynthesis E E E-03 KEGG_PATHWAY Glycine, serine and threonine metabolism E E E-03 KEGG_PATHWAY Arginine and proline metabolism E E E-03 KEGG_PATHWAY Ascorbate and aldarate metabolism E E E-02 KEGG_PATHWAY Steroid hormone biosynthesis E E E-02 KEGG_PATHWAY Histidine metabolism E E E-02 KEGG_PATHWAY Valine, leucine and isoleucine degradation E E E-02 Reduced in fraction KEGG_PATHWAY Pathways in cancer E E E-07 KEGG_PATHWAY Tight junction E E E-06 KEGG_PATHWAY MAPK signaling pathway E E E-05 KEGG_PATHWAY Focal adhesion E E E-04 KEGG_PATHWAY Adherens junction E E E-04 KEGG_PATHWAY Arrhythmogenic right ventricular E E E-02 cardiomyopathy (ARVC) KEGG_PATHWAY Colorectal cancer E E E-02 KEGG_PATHWAY Hypertrophic cardiomyopathy (HCM) E E E-01 KEGG_PATHWAY Prostate cancer E E E-01 Supplementary Table 2 Gene ontology comparisons in untreated tissue: Progenitor-enriched vs. depleted.
4 Dorrell et al. A murine liver Page 4 Elevated in fraction Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Drug metabolism E E E-26 KEGG_PATHWAY Metabolism of xenobiotics by E E E-19 cytochrome P450 KEGG_PATHWAY Retinol metabolism E E E-18 KEGG_PATHWAY Complement and coagulation E E E-18 cascades KEGG_PATHWAY Tryptophan metabolism E E E-06 KEGG_PATHWAY Drug metabolism E E E-05 KEGG_PATHWAY Steroid hormone biosynthesis E E E-05 KEGG_PATHWAY Primary bile acid biosynthesis E E E-05 KEGG_PATHWAY Glycine, serine and threonine E E E-05 metabolism KEGG_PATHWAY PPAR signaling pathway E E E-04 KEGG_PATHWAY ECM-receptor interaction E E E-03 KEGG_PATHWAY Starch and sucrose metabolism E E E-03 KEGG_PATHWAY Linoleic acid metabolism E E E-03 KEGG_PATHWAY Valine, leucine and isoleucine E E E-03 degradation KEGG_PATHWAY Pentose and glucuronate E E E-02 interconversions KEGG_PATHWAY Arginine and proline metabolism E E E-02 KEGG_PATHWAY Arachidonic acid metabolism E E E-01 GOTERM_MF_FAT electron carrier activity E E E-17 GOTERM_MF_FAT heme binding E E E-16 GOTERM_MF_FAT tetrapyrrole binding E E E-15 GOTERM_MF_FAT oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, E E E-14
5 Dorrell et al. A murine liver Page 5 reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen GOTERM_MF_FAT iron ion binding E E E-14 GOTERM_MF_FAT aromatase activity E E E-12 GOTERM_MF_FAT vitamin binding E E E-10 GOTERM_MF_FAT cofactor binding E E E-10 GOTERM_MF_FAT carbohydrate binding E E E-09 GOTERM_MF_FAT pattern binding E E E-08 GOTERM_MF_FAT polysaccharide binding E E E-08 GOTERM_MF_FAT glycosaminoglycan binding E E E-07 GOTERM_MF_FAT vitamin B6 binding E E E-07 GOTERM_MF_FAT pyridoxal phosphate binding E E E-07 GOTERM_MF_FAT extracellular matrix structural E E E-04 constituent GOTERM_MF_FAT endopeptidase inhibitor activity E E E-04 GOTERM_MF_FAT peptidase inhibitor activity E E E-04 GOTERM_MF_FAT heparin binding E E E-04 GOTERM_MF_FAT enzyme inhibitor activity E E E-04 GOTERM_MF_FAT growth factor binding E E E-04 GOTERM_MF_FAT platelet-derived growth factor binding E E E-03 GOTERM_MF_FAT serine-type endopeptidase inhibitor E E E-03 activity GOTERM_MF_FAT coenzyme binding E E E-02 GOTERM_MF_FAT transferase activity, transferring E E E-02 nitrogenous groups GOTERM_MF_FAT 3',5'-cyclic-nucleotide E E E-02 phosphodiesterase activity GOTERM_MF_FAT cyclic-nucleotide phosphodiesterase activity E E E-02
6 Dorrell et al. A murine liver Page 6 GOTERM_BP_FAT oxidation reduction E E E-33 GOTERM_BP_FAT response to wounding E E E-19 GOTERM_BP_FAT acute inflammatory response E E E-13 GOTERM_BP_FAT blood coagulation E E E-12 GOTERM_BP_FAT coagulation E E E-12 GOTERM_BP_FAT hemostasis E E E-12 GOTERM_BP_FAT inflammatory response E E E-11 GOTERM_BP_FAT organic acid catabolic process E E E-11 GOTERM_BP_FAT carboxylic acid catabolic process E E E-11 GOTERM_BP_FAT defense response E E E-10 GOTERM_BP_FAT blood vessel development E E E-10 GOTERM_BP_FAT vasculature development E E E-09 GOTERM_BP_FAT steroid metabolic process E E E-09 GOTERM_BP_FAT regulation of body fluid levels E E E-09 GOTERM_BP_FAT wound healing E E E-09 GOTERM_BP_FAT cell adhesion E E E-08 GOTERM_BP_FAT biological adhesion E E E-08 GOTERM_BP_FAT activation of plasma proteins involved E E E-07 in acute inflammatory response GOTERM_BP_FAT complement activation E E E-07 GOTERM_BP_FAT immune response E E E-07 GOTERM_BP_FAT protein maturation by peptide bond E E E-07 cleavage GOTERM_BP_FAT cellular amino acid catabolic process E E E-06 GOTERM_BP_FAT blood vessel morphogenesis E E E-06 GOTERM_BP_FAT lipid transport E E E-06 GOTERM_BP_FAT complement activation, classical E E E-06 pathway GOTERM_BP_FAT organic ether metabolic process E E E-05 GOTERM_BP_FAT vitamin metabolic process E E E-05
7 Dorrell et al. A murine liver Page 7 GOTERM_BP_FAT cofactor metabolic process E E E-05 GOTERM_BP_FAT regulation of coagulation E E E-05 GOTERM_BP_FAT amine catabolic process E E E-05 GOTERM_BP_FAT neutral lipid metabolic process E E E-05 GOTERM_BP_FAT heterocycle catabolic process E E E-05 GOTERM_BP_FAT protein processing E E E-05 GOTERM_BP_FAT lipid localization E E E-05 GOTERM_BP_FAT acylglycerol metabolic process E E E-05 GOTERM_BP_FAT fatty acid metabolic process E E E-05 GOTERM_BP_FAT acute-phase response E E E-05 GOTERM_BP_FAT humoral immune response E E E-04 GOTERM_BP_FAT humoral immune response mediated E E E-04 by circulating immunoglobulin GOTERM_BP_FAT angiogenesis E E E-04 GOTERM_BP_FAT extracellular matrix organization E E E-04 GOTERM_BP_FAT glycerol ether metabolic process E E E-04 GOTERM_BP_FAT triglyceride metabolic process E E E-04 GOTERM_BP_FAT protein maturation E E E-04 GOTERM_BP_FAT response to endogenous stimulus E E E-04 GOTERM_BP_FAT positive regulation of response to E E E-04 stimulus GOTERM_BP_FAT response to hormone stimulus E E E-04 GOTERM_BP_FAT cholesterol metabolic process E E E-04 GOTERM_BP_FAT response to extracellular stimulus E E E-04 GOTERM_BP_FAT B cell mediated immunity E E E-04 GOTERM_BP_FAT fat-soluble vitamin metabolic process E E E-04 GOTERM_BP_FAT regulation of blood coagulation E E E-04 GOTERM_BP_FAT positive regulation of immune system E E E-04 process GOTERM_BP_FAT extracellular structure organization E E E-04
8 Dorrell et al. A murine liver Page 8 GOTERM_BP_FAT regulation of response to external E E E-04 stimulus GOTERM_BP_FAT activation of immune response E E E-03 GOTERM_BP_FAT aromatic compound catabolic process E E E-03 GOTERM_BP_FAT immune effector process E E E-03 GOTERM_BP_FAT immunoglobulin mediated immune E E E-03 response GOTERM_BP_FAT cellular amino acid derivative E E E-03 metabolic process GOTERM_BP_FAT positive regulation of immune E E E-03 response GOTERM_BP_FAT sterol metabolic process E E E-03 GOTERM_BP_FAT cellular amide metabolic process E E E-03 GOTERM_BP_FAT amine biosynthetic process E E E-03 GOTERM_BP_FAT secondary metabolic process E E E-03 GOTERM_BP_FAT coenzyme metabolic process E E E-03 GOTERM_BP_FAT lymphocyte mediated immunity E E E-03 GOTERM_BP_FAT vascular endothelial growth factor E E E-02 receptor signaling pathway GOTERM_BP_FAT regulation of locomotion E E E-02 GOTERM_BP_FAT adaptive immune response based on E E E-02 somatic recombination of immune receptors built from immunoglobulin superfamily domains GOTERM_BP_FAT adaptive immune response E E E-02 GOTERM_BP_FAT response to corticosteroid stimulus E E E-02 GOTERM_BP_FAT regulation of cell migration E E E-02 GOTERM_BP_FAT response to glucocorticoid stimulus E E E-02 GOTERM_BP_FAT regulation of cell motion E E E-02 GOTERM_BP_FAT sulfur metabolic process E E E-02 GOTERM_BP_FAT chemotaxis E E E-02
9 Dorrell et al. A murine liver Page 9 GOTERM_BP_FAT taxis E E E-02 GOTERM_BP_FAT cell-substrate adhesion E E E-02 GOTERM_BP_FAT cellular hormone metabolic process E E E-02 GOTERM_BP_FAT blood circulation E E E-02 GOTERM_BP_FAT circulatory system process E E E-02 GOTERM_BP_FAT carboxylic acid biosynthetic process E E E-02 GOTERM_BP_FAT organic acid biosynthetic process E E E-02 GOTERM_BP_FAT collagen fibril organization E E E-02 GOTERM_BP_FAT innate immune response E E E-02 GOTERM_BP_FAT response to nutrient levels E E E-02 GOTERM_BP_FAT response to cytokine stimulus E E E-02 GOTERM_BP_FAT response to peptide hormone stimulus E E E-02 GOTERM_BP_FAT cellular amino acid biosynthetic process E E E-01 Reduced in fraction Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Tight junction E E E-04 KEGG_PATHWAY Pathways in cancer E E E-02 GOTERM_MF_FAT ATP binding E E E-03 GOTERM_MF_FAT adenyl ribonucleotide binding E E E-03 GOTERM_MF_FAT ion binding E E E-03 GOTERM_MF_FAT calcium ion binding E E E-02 GOTERM_MF_FAT protein tyrosine kinase activity E E E-02 GOTERM_MF_FAT adenyl nucleotide binding E E E-02 GOTERM_MF_FAT cytoskeletal protein binding E E E-02 GOTERM_MF_FAT nucleoside binding E E E-02 GOTERM_MF_FAT purine nucleoside binding E E E-02 GOTERM_MF_FAT protein kinase activity E E E-02
10 Dorrell et al. A murine liver Page 10 GOTERM_MF_FAT cation binding E E E-02 GOTERM_MF_FAT nucleotide binding E E E-02 GOTERM_MF_FAT actin binding E E E-02 GOTERM_MF_FAT metal ion binding E E E-02 GOTERM_BP_FAT epithelium development E E E-10 GOTERM_BP_FAT cilium assembly E E E-06 GOTERM_BP_FAT cell projection assembly E E E-06 GOTERM_BP_FAT cilium morphogenesis E E E-05 GOTERM_BP_FAT tissue morphogenesis E E E-04 GOTERM_BP_FAT tube development E E E-04 GOTERM_BP_FAT morphogenesis of an epithelium E E E-04 GOTERM_BP_FAT cell projection organization E E E-04 GOTERM_BP_FAT tube morphogenesis E E E-03 GOTERM_BP_FAT negative regulation of cell E E E-03 proliferation GOTERM_BP_FAT cell adhesion E E E-03 GOTERM_BP_FAT biological adhesion E E E-03 GOTERM_BP_FAT urogenital system development E E E-03 GOTERM_BP_FAT kidney development E E E-02 GOTERM_BP_FAT epithelial cell differentiation E E E-02 GOTERM_BP_FAT positive regulation of transcription E E E-02 GOTERM_BP_FAT embryonic development ending in E E E-02 birth or egg hatching GOTERM_BP_FAT cell morphogenesis E E E-02 GOTERM_BP_FAT neural tube development E E E-02 GOTERM_BP_FAT cell-cell adhesion E E E-02 GOTERM_BP_FAT regulation of transcription from RNA E E E-02 polymerase II promoter GOTERM_BP_FAT chordate embryonic development E E E-02
11 Dorrell et al. A murine liver Page 11 GOTERM_BP_FAT cell projection morphogenesis E E E-01 GOTERM_BP_FAT phosphorus metabolic process E E E-01 GOTERM_BP_FAT phosphate metabolic process E E E-01 GOTERM_BP_FAT cytoskeleton organization E E E-01 Supplementary Table 3 Gene ontology comparisons in DDC-treated tissue: Progenitor-enriched vs. depleted.
12 Dorrell et al. A murine liver Page 12 Higher in DDC fraction relative to untreated population Category Term Count % P-Value Benjamini FDR KEGG_PATHWAY Systemic lupus erythematosus E E E-03 GOTERM_MF_FAT ATP binding E E E-02 GOTERM_MF_FAT microtubule motor activity E E E-02 GOTERM_MF_FAT adenyl ribonucleotide binding E E E-02 GOTERM_MF_FAT adenyl nucleotide binding E E E-02 GOTERM_MF_FAT purine nucleoside binding E E E-02 GOTERM_MF_FAT nucleoside binding E E E-02 GOTERM_BP_FAT M phase of mitotic cell cycle E E E-16 GOTERM_BP_FAT cell cycle E E E-16 GOTERM_BP_FAT cell division E E E-15 GOTERM_BP_FAT M phase E E E-15 GOTERM_BP_FAT cell cycle process E E E-15 GOTERM_BP_FAT mitosis E E E-14 GOTERM_BP_FAT nuclear division E E E-14 GOTERM_BP_FAT cell cycle phase E E E-14 GOTERM_BP_FAT organelle fission E E E-14 GOTERM_BP_FAT mitotic cell cycle E E E-13 GOTERM_BP_FAT DNA packaging E E E-10 GOTERM_BP_FAT chromatin assembly E E E-08 GOTERM_BP_FAT protein-dna complex assembly E E E-08 GOTERM_BP_FAT nucleosome assembly E E E-07 GOTERM_BP_FAT nucleosome organization E E E-07 GOTERM_BP_FAT chromatin assembly or disassembly E E E-07 GOTERM_BP_FAT chromosome segregation E E E-06 GOTERM_BP_FAT chromosome organization E E E-05
13 Dorrell et al. A murine liver Page 13 GOTERM_BP_FAT cellular macromolecular complex E E E-03 assembly GOTERM_BP_FAT DNA metabolic process E E E-03 GOTERM_BP_FAT cellular macromolecular complex E E E-03 subunit organization GOTERM_BP_FAT macromolecular complex assembly E E E-02 GOTERM_BP_FAT macromolecular complex subunit E E E-02 organization GOTERM_BP_FAT chromatin organization E E E-02 GOTERM_BP_FAT microtubule-based process E E E-01 Lower in DDC fraction relative to untreated progentitor population GOTERM_MF_FAT zinc ion binding E E E-08 GOTERM_MF_FAT transition metal ion binding E E E-06 GOTERM_MF_FAT ion binding E E E-06 GOTERM_MF_FAT metal ion binding E E E-06 GOTERM_MF_FAT cation binding E E E-05 GOTERM_MF_FAT DNA binding E E E-01 GOTERM_BP_FAT regulation of transcription E E E-10 GOTERM_BP_FAT transcription E E E-07 GOTERM_BP_FAT regulation of RNA metabolic E E E-04 process GOTERM_BP_FAT regulation of transcription, DNAdependent E E E-04 Supplementary Table 4 Gene ontology comparisons in Progenitor-enriched fractions: DDC-treated vs. untreated.
Identification of Tissue-Specific Protein-Coding and Noncoding. Transcripts across 14 Human Tissues Using RNA-seq
Identification of Tissue-Specific Protein-Coding and Noncoding Transcripts across 14 Human Tissues Using RNA-seq Jinhang Zhu 1, Geng Chen 1, Sibo Zhu 1,2, Suqing Li 3, Zhuo Wen 3, Bin Li 1, Yuanting Zheng
More informationSupplementary figure legends
Supplementary figure legends Fig. S1. Lineweaver-Burk plot of putrescine uptake by YeeF. An overnight culture of SK629 was inoculated in 100-mL LBG medium in 500-mL Erlenmeyer flasks. The medium was supplemented
More informationSupplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
More informationChapter 2 Part 3: Organic and Inorganic Compounds
Chapter 2 Part 3: Organic and Inorganic Compounds Objectives: 1) List the major groups of inorganic chemicals common in cells. 2) Describe the functions of various types of inorganic chemicals in cells.
More informationPublished on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
More informationLIX1 APOD RRM2 FAIM2 MGST1 UHRF1 PPIA BEX1
C2orf80 1 C2orf80 A2M ANXA1 APOD ARL4A BEX1 C1S C3 CD44 CHI3L1 CHI3L2 CLU DPYD DSCAM EMP3 FN1 GBP1 GEM GLIPR1 GRIA2 IDH1 LIX1 MAP2 MDK MGST1 MIR3917 NAMPT PCMTD2 PPIA PTN PTPRZ1 S100B SCG3 SERPINA3 TCF12
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationBIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
More informationNBCE Mock Board Questions Biochemistry
1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation
More informationFour Classes of Biological Macromolecules. Biological Macromolecules. Lipids
Biological Macromolecules Much larger than other par4cles found in cells Made up of smaller subunits Found in all cells Great diversity of func4ons Four Classes of Biological Macromolecules Lipids Polysaccharides
More informationSystems biology approaches and pathway tools for investigating cardiovascular disease
Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk
More informationThe Structure and Function of Biomolecules
The Structure and Function of Biomolecules The student is expected to: 9A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic
More informationActivity: Biologically Important Molecules
Activity: Biologically Important Molecules AP Biology Introduction We have already seen in our study of biochemistry that the molecules that comprise living things are carbon-based, and that they are thought
More information1.4. Lipids - Advanced
1.4. Lipids - Advanced www.ck12.org In humans, triglycerides are a mechanism for storing unused calories, and their high concentration in blood correlates with the consumption of excess starches and other
More informationTable S4A- GOBP functional annotation of celecoxib-modulated genes common between CO
Table S4A- GOBP functional annotation of celecoxib-modulated genes common between CO Terms ListHits ListTotal PopulationHits cell proliferation 44 228 1156 cell cycle 34 228 806 DNA replication and chromosome
More informationLesson Overview. Carbon Compounds. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview 2.3 The Chemistry of Carbon What elements does carbon bond with to make up life s molecules? Carbon can bond with many elements, including Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen
More informationAMINO ACIDS NON-ESSENTIAL ESSENTIAL
Edith Frederika Introduction A major component of food is PROTEIN The protein ingested as part of our diet are not the same protein required by the body Only 40 to 50 gr of protein is required by a normal
More informationBiology. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall
Biology 1 of 37 2 of 37 The Chemistry of Carbon The Chemistry of Carbon Organic chemistry is the study of all compounds that contain bonds between carbon atoms. 3 of 37 Macromolecules Macromolecules Macromolecules
More informationObjective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
More informationB i o c h e m i s t r y N o t e s
14 P a g e Carbon Hydrogen Nitrogen Oxygen Phosphorus Sulfur ~Major ~Found in all ~Found in most ~Found in all component of all organic organic molecules. molecules. ~Major structural atom in all organic
More informationMacromolecules Cut & Paste
Macromolecules Cut & Paste Adapted from http://mrswords.weebly.com/uploads/1/5/2/4/15244382/ch_6-3_life_molecules_cut-out_lab.pdf INTRODUCTION Many of the molecules in living cells are so large that they
More informationMetabolomic Data Analysis with MetaboAnalystR
Metabolomic Data Analysis with MetaboAnalystR Name: guest623839008349489450 February 7, 2018 1 Background Understanding the functional importance of metabolites in untargeted metabolomics is limited due
More informationCarbon Compounds. Lesson Overview. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview Carbon Compounds Lesson Overview 2.3 THINK ABOUT IT In the early 1800s, many chemists called the compounds created by organisms organic, believing they were fundamentally different from
More informationFatty acids and phospholipids
PYS 4xx Intro 2 1 PYS 4xx Intro 2 - Molecular building blocks We now describe in more detail the nomenclature and composition of several classes of compounds of relevance to the cell, including: membrane
More informationShort polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer
HO 1 2 3 H HO H Short polymer Dehydration removes a water molecule, forming a new bond Unlinked monomer H 2 O HO 1 2 3 4 H Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3
More informationMacromolecules. Honors Biology
Macromolecules onors Biology 1 The building materials of the body are known as macromolecules because they can be very large There are four types of macromolecules: 1. Proteins 2. Nucleic acids 3. arbohydrates
More informationBiology. Lectures winter term st year of Pharmacy study
Biology Lectures winter term 2008 1 st year of Pharmacy study 3 rd Lecture Chemical composition of living matter chemical basis of life. Atoms, molecules, organic compounds carbohydrates, lipids, proteins,
More informationProteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
More informationMacromolecules. 3. There are several levels of protein structure, the most complex of which is A) primary B) secondary C) tertiary D) quaternary
Macromolecules 1. If you remove all of the functional groups from an organic molecule so that it has only carbon and hydrogen atoms, the molecule become a molecule. A) carbohydrate B) carbonyl C) carboxyl
More informationBiology Unit 2 Elements & Macromolecules in Organisms Date/Hour
Biology Unit 2 Name Elements & Macromolecules in rganisms Date/our Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body
More informationCarbon. Isomers. The Chemical Building Blocks of Life
The Chemical Building Blocks of Life Carbon Chapter 3 Framework of biological molecules consists primarily of carbon bonded to Carbon O, N, S, P or H Can form up to 4 covalent bonds Hydrocarbons molecule
More informationAnatomy & Physiology I. Macromolecules
Anatomy & Physiology I Macromolecules Many molecules in the human body are very large, consisting of hundreds or even thousands of atoms. These are called macromolecules. Four types of macromolecules are
More informationMost life processes are a series of chemical reactions influenced by environmental and genetic factors.
Biochemistry II Most life processes are a series of chemical reactions influenced by environmental and genetic factors. Metabolism the sum of all biochemical processes 2 Metabolic Processes Anabolism-
More informationElements & Macromolecules in Organisms
Name: Period: Date: Elements & Macromolecules in Organisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight.
More information2 3 Carbon Compounds (Macromolecules)
2 3 Carbon Compounds (Macromolecules) Slide 1 of 37 Organic Chemistry Organic chemistry is the study of all compounds that contain bonds between carbon atoms. Slide 2 of 37 Carbon Living organisms are
More informationREACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
More informationBiological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationBiologic Oxidation BIOMEDICAL IMPORTAN
Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron
More informationElements & Macromolecules in Organisms
Elements & Macromolecules in rganisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight. All compounds can be
More informationCells. Variation and Function of Cells
Cells Variation and Function of Cells Plasma Membrane= the skin of a cell, it protects and nourishes the cell while communicating with other cells at the same time. Lipid means fat and they are hydrophobic
More informationCh. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma
Chapt. 45 Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma Inheritance of X-linked gene for Factor VIII hemophilia A Explain the
More informationBiology 12 - Biochemistry Practice Exam
Biology 12 - Biochemistry Practice Exam Name: Water: 1. The bond between water molecules is a (n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
More informationBIOLOGICAL MOLECULES REVIEW-UNIT 1 1. The factor being tested in an experiment is the A. data. B. variable. C. conclusion. D. observation. 2.
BIOLOGICAL MOLECULES REVIEW-UNIT 1 1. The factor being tested in an experiment is the A. data. B. variable. C. conclusion. D. observation. 2. A possible explanation for an event that occurs in nature is
More information9/16/15. Properties of Water. Benefits of Water. More properties of water
Properties of Water Solid/Liquid Density Water is densest at 4⁰C Ice floats Allows life under the ice Hydrogen bond Ice Hydrogen bonds are stable Liquid water Hydrogen bonds break and re-form Benefits
More informationOrganic Molecules. 8/27/2004 Mr. Davenport 1
Organic Molecules 8/27/2004 Mr. Davenport 1 Carbohydrates Commonly called sugars and starches Consist of C, H, O with H:O ration 2:1 Usually classified as to sugar units Monosaccharide are single sugar
More informationE.coli Core Model: Metabolic Core
1 E.coli Core Model: Metabolic Core 2 LEARNING OBJECTIVES Each student should be able to: Describe the glycolysis pathway in the core model. Describe the TCA cycle in the core model. Explain gluconeogenesis.
More informationBRIEF CONTENTS COPYRIGHTED MATERIAL III METABOLIC AND DEVELOPMENTAL INTEGRATION COMPARTMENTS CELL REPRODUCTION PLANT ENVIRONMENT AND AGRICULTURE
BRIEF CONTENTS I COMPARTMENTS 1 Membrane Structure and Membranous Organelles 2 2 The Cell Wall 45 3 Membrane Transport 111 4 Protein Sorting and Vesicle Traffic 151 5 The Cytoskeleton 191 II CELL REPRODUCTION
More informationCP Biology: Basic Biochemistry
CP Biology: Basic Biochemistry Organic Chemistry Organic chemistry is the study of carbon compounds. Organic compounds are compounds composed primarily of a carbon skeleton. All living things are composed
More informationBiological Chemistry. Is biochemistry fun? - Find it out!
Biological Chemistry Is biochemistry fun? - Find it out! 1. Key concepts Outline 2. Condensation and Hydrolysis Reactions 3. Carbohydrates 4. Lipids 5. Proteins 6. Nucleic Acids Key Concepts: 1. Organic
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationFrom Atoms to Cells: Fundamental Building Blocks. Models of atoms. A chemical connection
From Atoms to Cells: A chemical connection Fundamental Building Blocks Matter - all materials that occupy space & have mass Matter is composed of atoms Atom simplest form of matter not divisible into simpler
More informationBiological Molecules. Carbohydrates, Proteins, Lipids, and Nucleic Acids
Biological Molecules Carbohydrates, Proteins, Lipids, and Nucleic Acids Organic Molecules Always contain Carbon (C) and Hydrogen (H) Carbon is missing four electrons Capable of forming 4 covalent bonds
More informationWater: 1. The bond between water molecules is a(n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond
Biology 12 - Biochemistry Practice Exam KEY Water: 1. The bond between water molecules is a(n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
More information2.2 Cell Construction
2.2 Cell Construction Elemental composition of typical bacterial cell C 50%, O 20%, N 14%, H 8%, P 3%, S 1%, and others (K +, Na +, Ca 2+, Mg 2+, Cl -, vitamin) Molecular building blocks Lipids Carbohydrates
More informationNutrients. Chapter 25 Nutrition, Metabolism, Temperature Regulation
Chapter 25 Nutrition, Metabolism, Temperature Regulation 25-1 Nutrients Chemicals used by body to produce energy, provide building blocks or function in other chemical reactions Classes Carbohydrates,
More informationStudent name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis?
1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? 2. (4 pts) What is the terminal electron acceptor
More informationThe building blocks of life.
The building blocks of life. The 4 Major Organic Biomolecules The large molecules (biomolecules OR polymers) are formed when smaller building blocks (monomers) bond covalently. via anabolism Small molecules
More informationChapter 3. Biological Molecules Great and Small
Chapter 3 Biological Molecules Great and Small Chapter Goal: Understanding how cells use small building blocks to build larger molecules and how some of those molecules then fold into 3-D shapes Key Questions
More informationBachelor Nutrition Science Seminar Nutritional Biochemistry (Module BE2.3) Topics
Nutritional Biochemistry (Module BE2.3) Prof. Dr. Stefan Lorkowski 1 Bachelor Nutrition Science Seminar Nutritional Biochemistry (Module BE2.3) Topics Biosynthesis of amino acids 1. Amino acids: general
More informationPHAR3316 Pharmacy biochemistry Exam #2 Fall 2010 KEY
1. How many protons is(are) lost when the amino acid Asparagine is titrated from its fully protonated state to a fully deprotonated state? A. 0 B. 1 * C. 2 D. 3 E. none Correct Answer: C (this question
More informationComparative analysis revealed dosage sensitivity and regulatory patterns of lncrna in prostate cancer
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Comparative analysis revealed dosage sensitivity and regulatory patterns of lncrna
More informationCarbohydrates. Building a carbohydrate:
Carbohydrates Monomer: Monosaccharide (simple s) Example: glucose, fructose Disaccharide: 2 monosaccharides joined together Example: sucrose (glucose + fructose) olymer: olysaccharide (starch) Example:
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Practice Quiz 1 AP Bio Sept 2016 Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The element present in all organic molecules is A) hydrogen.
More informationThe Carbon Atom (cont.)
Organic Molecules Organic Chemistry The chemistry of the living world. Organic Molecule a molecule containing carbon and hydrogen Carbon has 4 electrons in its outer shell and can share electrons with
More informationMolecule - two or more atoms held together by covalent bonds. Ex. = water, H O
ORGANIC CHEMISTRY NOTES Why study carbon? ORGANIC CHEMISTRY NOTES Why study carbon? * All of life is built on carbon * Cells are made up of about 72% water 3% salts (NaCl, and K) 25% carbon compounds which
More information2.3 Carbon-Based Molecules. KEY CONCEPT Carbon-based molecules are the foundation of life.
KEY CONCEPT Carbon-based molecules are the foundation of life. Carbon atoms have unique bonding properties. Carbon forms covalent bonds with up to four other atoms, including other carbon atoms. Carbon-based
More informationName: Date: Block: Biology 12
Name: Date: Block: Biology 12 Provincial Exam Review: Cell Processes and Applications January 2003 Use the following diagram to answer questions 1 and 2. 1. Which labelled organelle produces most of the
More informationMolecular building blocks
2.22 Cell Construction Elemental l composition of ftypical lbacterial cell C 50%, O 20%, N 14%, H 8%, P 3%, S 1%, and others (K +, Na +, Ca 2+, Mg 2+, Cl -, vitamin) Molecular building blocks Lipids Carbohydrates
More informationElements & Macromolecules in Organisms
Elements & Macromolecules in rganisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight. All compounds can be
More informationFor questions 1-4, match the carbohydrate with its size/functional group name:
Chemistry 11 Fall 2013 Examination #5 PRACTICE 1 ANSWERS For the first portion of this exam, select the best answer choice for the questions below and mark the answers on your scantron. Then answer the
More informationBiomolecules. Unit 3
Biomolecules Unit 3 Atoms Elements Compounds Periodic Table What are biomolecules? Monomers vs Polymers Carbohydrates Lipids Proteins Nucleic Acids Minerals Vitamins Enzymes Triglycerides Chemical Reactions
More informationBioenergetics. Chapter 3. Objectives. Objectives. Introduction. Photosynthesis. Energy Forms
Objectives Chapter 3 Bioenergetics Discuss the function of cell membrane, nucleus, & mitochondria Define: endergonic, exergonic, coupled reactions & bioenergetics Describe how enzymes work Discuss nutrients
More informationTest Review Worksheet 1 Name: Per:
Test Review Worksheet 1 Name: Per: 1. Put the following in order according to blood flow through the body, starting with the lungs: Lungs, right atrium, left atrium, right ventricle, left ventricle, aorta,
More informationUnit 3: Chemistry of Life Mr. Nagel Meade High School
Unit 3: Chemistry of Life Mr. Nagel Meade High School IB Syllabus Statements 3.2.1 Distinguish between organic and inorganic compounds. 3.2.2 Identify amino acids, glucose, ribose and fatty acids from
More information1.3.1 Function of Food. Why do we need food?
1.3.1 Function of Food Why do we need food? Need to know The Function of Food Three reasons for requiring food 2 Food is needed for: 1.Energy 2.Growth of new cells and Repair of existing cells, tissues,
More informationOrganic Compounds: Carbohydrates
Organic Compounds: Carbohydrates Carbohydrates include sugars and starches Contain the elements C,H,O (H & O ratio like water, 2 H s to 1O), ex. glucose C 6 H 12 O 6 Word means hydrated carbon Classified
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationChapter 3. Table of Contents. Section 1 Carbon Compounds. Section 2 Molecules of Life. Biochemistry
Biochemistry Table of Contents Section 1 Carbon Compounds Section 2 Molecules of Life Section 1 Carbon Compounds Objectives Distinguish between organic and inorganic compounds. Explain the importance of
More informationCells and Tissues. Lesson 2.1: Molecules of Life Lesson 2.2: Cells Lesson 2.3: Tissues
2 Cells and Tissues Lesson 2.1: Molecules of Life Lesson 2.2: Cells Lesson 2.3: Tissues Chapter 2: Cells and Tissues Lesson 2.1 Molecules of Life Molecules of Life carbohydrates proteins lipids nucleic
More informationThe Structure and Function of Macromolecules
The Structure and Function of Macromolecules I. Polymers What is a polymer? Poly = many; mer = part. A polymer is a large molecule consisting of many smaller sub-units bonded together. What is a monomer?
More informationMacro molecule = is all the reactions that take place in cells, the sum of all chemical reactions that occur within a living organism Anabolism:
Macromolecule Macro molecule = molecule that is built up from smaller units The smaller single subunits that make up macromolecules are known as Joining two or more single units together form a M is all
More informationBiomolecules Amino Acids & Protein Chemistry
Biochemistry Department Date: 17/9/ 2017 Biomolecules Amino Acids & Protein Chemistry Prof.Dr./ FAYDA Elazazy Professor of Biochemistry and Molecular Biology Intended Learning Outcomes ILOs By the end
More informationThe Chemical Level of Organization
2 The Chemical Level of Organization PowerPoint Lecture Presentations prepared by Jason LaPres Lone Star College North Harris Table 2-1 Principal Elements in the Human Body Table 2-1 Principal Elements
More informationMacromolecules Chapter 2.3
Macromolecules Chapter 2.3 E.Q. What are the 4 main macromolecues found in living things and what are their functions? Carbon-Based Molecules Why is carbon called the building block of life? Carbon atoms
More informationBiology Teach Yourself Series Topic 3: Chemical Nature of the Cell
Biology Teach Yourself Series Topic 3: Chemical Nature of the Cell A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2013 Page 1 of 19 Contents
More informationBiomolecules. Presented by Amelia McCutcheon
Biomolecules Presented by Amelia McCutcheon Fats Carbohydrates Proteins Vitamins Fats Also known as lipids Fats are solids (high mel=ng point) ils are liquids (low mel=ng point) Mainly consist of Carbon
More informationAmino Acid Metabolism
Amino Acid Metabolism Last Week Most of the Animal Kingdom = Lazy - Most higher organisms in the animal kindom don t bother to make all of the amino acids. - Instead, we eat things that make the essential
More informationSupplementary Information. Deciphering the Venomic Transcriptome of Killer- Wasp Vespa velutina
Supplementary Information Deciphering the Venomic Transcriptome of Killer- Wasp Vespa velutina Zhirui Liu, Shuanggang Chen, You Zhou, Cuihong Xie, Bifeng Zhu, Huming Zhu, Shupeng Liu, Wei Wang, Hongzhuan
More informationWhat are the molecules of life?
Molecules of Life What are the molecules of life? Organic Compounds Complex Carbohydrates Lipids Proteins Nucleic Acids Organic Compounds Carbon- hydrogen based molecules From Structure to Function Ø Carbon
More informationSupporting Information
Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department
More informationCHAPTER 2- BIOCHEMISTRY I. WATER (VERY IMPORTANT TO LIVING ORGANISMS) A. POLAR COMPOUND- 10/4/ H O KENNEDY BIOLOGY 1AB
CHAPTER 2- BIOCHEMISTRY KENNEDY BIOLOGY 1AB I. WATER (VERY IMPORTANT TO LIVING ORGANISMS) WATER S UNIQUE PROPERTIES MAKE IT ESSENTIAL FOR ALL LIFE FUNCTIONS IT IS POLAR, AND HAS BOTH ADHESIVE AND COHESIVE
More informationThe Structure and Function of Macromolecules
The Structure and Function of Macromolecules Macromolecules are polymers Polymer long molecule consisting of many similar building blocks. Monomer the small building block molecules. Carbohydrates, proteins
More information2. Which of the following is NOT true about carbohydrates
Chemistry 11 Fall 2011 Examination #5 For the first portion of this exam, select the best answer choice for the questions below and mark the answers on your scantron. Then answer the free response questions
More informationMacromolecules Structure and Function
Macromolecules Structure and Function Within cells, small organic molecules (monomers) are joined together to form larger molecules (polymers). Macromolecules are large molecules composed of thousands
More informationLecture 11 - Biosynthesis of Amino Acids
Lecture 11 - Biosynthesis of Amino Acids Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire 1 Introduction Biosynthetic pathways for amino acids, nucleotides and lipids
More informationFor questions 1-4, match the carbohydrate with its size/functional group name:
Chemistry 11 Fall 2013 Examination #5 PRACTICE 1 For the first portion of this exam, select the best answer choice for the questions below and mark the answers on your scantron. Then answer the free response
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationBiomolecule: Carbohydrate
Biomolecule: Carbohydrate This biomolecule is composed of three basic elements (carbon, hydrogen, and oxygen) in a 1:2:1 ratio. The most basic carbohydrates are simple sugars, or monosaccharides. Simple
More information