Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia
|
|
|
- Beverley Porter
- 5 years ago
- Views:
Transcription
1 Supplementary Table 1. Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Pathway Enrichment Score (-log10[p value]) p-value genes Glycosaminoglycan degradation Hyal2;Hyal1 Fatty acid elongation in mitochondria Hadha;Echs1 Glycosphingolipid biosynthesis - globoseries St3gal2;B3galt5 Arachidonic acid metabolism Ptgds;Pla2g6;Ptgds2;Ptges Benzoate degradation via CoA ligation Hadha;Echs1 Basal cell carcinoma Fzd5;Fzd9;Wnt5b;Gli2 Hedgehog signaling pathway Bmp8a;Csnk1d;Wnt5b;Gli2 Leukocyte transendothelial migration Plcg2;Cldn3;Thy1;Vav2;Rhoh;Cldn22 Caprolactam degradation Hadha;Echs1 Type II diabetes mellitus Cacna1e;Prkcz;Tnf;Abcc8 Hematopoietic cell lineage Il1a;Il6ra;Tnf;Il11;Cd7 Lysine degradation MGC109340;Ogdhl;Hadha;Echs1 Long-term depression Npr1;Grm5;Pla2g6;Nos2;Itpr2 Primary immunodeficiency E-04 Ikbkg;Zap70;Rfxank;Tap2 ABC transporters - General E-04 Abca1;Tap2;Abcc8;Abcb6 N-Glycan degradation E-04 Aga;RGD ;Neu4 TGF-beta signaling pathway E-04 Crebbp;Smad5;Tgfb1;Bmp8a;Tnf;Rps6kb2 Proteasome E-04 Psmd7;Psmb7;Psmb11;Psmb10;Psmb8 Glycerophospholipid metabolism E-04 Ptdss1;Dgkz;Lcat;Pla2g6;Chkb Biosynthesis of unsaturated fatty acids E-04 Elovl2;Hadha;Elovl5;Gpsn2 PPAR signaling pathway E-04 Angptl4;Slc27a6;Fabp6;Pparg;Cpt1b;Slc27a1
2 Tryptophan metabolism E-04 Aanat;Ogdhl;Hadha;Echs1;Mettl6 Complement and coagulation cascades E-04 F5;C8g;Masp1;F10;Serpinf2;C4b Tight junction E-04 Llgl1;Pard6b;Myh7b;Cldn3;Prkcz;Src;Rras;Cldn22 Gap junction E-04 Csnk1d;Npr1;Tubb3;Grm5;Src;Itpr2;Tuba3a Androgen and estrogen metabolism E-05 Hsd17b1;Sult2b1;Ugt1a2;Ugt1a1;Mettl6 Cytokine-cytokine receptor interaction E-06 Il1a;LOC500598;Il6ra;Cx3cr1;Tgfb1;Tnfsf13;Tnfrsf1a;Bmp8a;Cd27;Tnf;Lta;Il11;Ccl11 MAPK signaling pathway E-07 Il1a;Cacna1e;Ikbkg;Fgfr3;Tgfb1;Tnfrsf1a;Dusp1;Tnf;Pla2g6;Map4k3;Rras;Flnb;Cacna1i; Cacnb2;Map3k4;Srf Calcium signaling pathway E-12 Cacna1e;Plcg2;Tbxa2r;Ptger1;Adrb2;P2rx7;Ntsr1;Ryr2;Adra1d;Htr5a;Tnnc2;Drd5;Grm5; Nos2;Adora2a;Itpr2; Chrm1;Gna15;Cacna1i Neuroactive ligand-receptor interaction E-15 Grin2b;Tbxa2r;Prlh;Ptger1;Adrb2;P2rx7;Pth2r;Mc3r;Ntsr1;Tspo;Galr2;Oxt;Oprl1;Adra1d; Hrh4;Htr5a;Drd5; Aplnr;Grm5;Avp;Adora2a;Crhr2;Chrm1;Grp;Mas1;Ucn2
3 Supplementary Table 2. Pathways of changes in hypomethylation in F1 offspring exposed to intrauterine hyperglycemia Pathway Enrichment Score (-log10[p value]) p-value gene Adipocytokine signaling pathway E-04 Camkk2;Pck1;Rxrb;Adipoq;Tnf;Prkag3;Nfkbib;Mapk10 Glycerophospholipid metabolism E-04 Dgkb;Pemt;Cdipt;Agpat1;Lcat;Phospho1;Ppap2c Glycosphingolipid biosynthesis - lactoseries E-04 B3gnt4;St3gal6;Fut7;Fut1;B4galt2 Type II diabetes mellitus E-04 Prkce;Prkcz;Adipoq;Tnf;Slc2a2;Prkcd;Mapk10 Insulin signaling pathway E-04 Pck1;Gys2;Ppp1r3b;Bad;Shc2;Inpp5d;Prkcz;Rps6kb2;Shc1;Prkar2a;Prkag3;Mapk10 TGF-beta signaling pathway E-04 Rbl2;Tgfb2;Ltbp1;Rps6kb2;Tnf;Tgfb1;Smad1;Id4;Bmp8a GnRH signaling pathway E-04 Mmp14;Adcy4;Mmp2;Gnas;Map2k6;Mapk12;Prkcb;Prkcd;Itpr3;Mapk10 Citrate cycle (TCA cycle) E-04 Idh3a;Pck1;Idh2;Pdha1;Idh3g;Sdhb VEGF signaling pathway E-04 Bad;Ppp3r2;Shc2;Mapk12;Mapkapk2;Nfatc4;Prkcb;Rac2;Ptk2 Leukocyte transendothelial migration E-05 Icam1;Mmp2;Mapk12;Ocln;Prkcb;Itgb2;Cldn9;Actn1;Rap1a;Rac2;Ptk2;Pecam1 Taste transduction E-05 Adcy4;Tas2r134;Gnas;Scnn1a;Itpr3;Tas2r126;Kcnb1 Hedgehog signaling pathway E-05 Csnk1g3;Csnk1g2;Sufu;Gli2;Wnt8a;Bmp8a;Wnt7b;Btrc Natural killer cell mediated cytotoxicity E-05 Icam1;Slc39a7;Cd244;Ppp3r2;Shc2;Nfatc4;Prkcb;Itgb2;Shc1;Tnf;Tnfrsf10b;Rac2;Ifngr2;Ifna4 Purine metabolism E-05 Hprt1;Paics;Polr2h;Polr2hl;Nme3;Nt5e;Adcy4;Pde9a;Polr2i;Polr2c;Pde2a;Polr1c;Pde8b;Xdh Cell adhesion molecules (CAMs) E-05 Cdh15;Icam1;Mag;Ctla4;Pvrl3;Slc39a7;Madcam1;LOC288521;Cntn1;L1cam;Ocln;Itgb2;Cldn9; Cd8a;Pecam1 Toll-like receptor signaling pathway E-06 Map3k7;Tlr5;Cxcl9;Tlr2;Cd14;Map2k6;Mapk12;Tnf;Irak4;Myd88;Mapk10;Ifna4 Hematopoietic cell lineage E-06 Tpo;Epo;Fcer2;Cd14;Anpep;Gp1bb;Csf3;Tnf;Cd8a;Cd37;Kit PPAR signaling pathway E-06 Pck1;Rxrb;Acox2;Olr1;Cyp7a1;Ucp1;Adipoq;Acaa1;RGD ;Fads2;Aqp7
4 Wnt signaling pathway E-06 Map3k7;Ctbp1;Tbl1xr1;Apc2;Ppp3r2;Nfatc4;Prkcb;Wnt8a;Axin2;Ppp2r5b;Rac2;Prickle1; Wnt7b;Csnk2b;Mapk10;Btrc Focal adhesion E-06 Flt4;Bcl2;Pdgfa;Egf;Bad;Mylk2;Shc2;Itga7;Itga11;Prkcb;Shc1;Ibsp;Actn1;Rap1a;Rac2; Itga10;Ptk2;Mapk10;Lamc3 Jak-STAT signaling pathway E-07 Tpo;Epo;Prlr;Il21;Csf3;Spred2;Osm;Il9;Cntfr;Clcf1;Stat5a;Prl;Il24;Ifngr2;Irf9;Il10rb;Ifna4 Tight junction E-08 Prkce;Prkch;Myh7b;LOC304000;Rab3b;Myh6;Tjp2;Myh3;Prkcz;Ocln;Prkcb; Rab13;Cttn;Cldn9;Actn1;Prkcd;Csnk2b Regulation of actin cytoskeleton E-09 Was;Bdkrb2;Pdgfa;Apc2;F2r;Egf;Chrm2;Cd14;Mylk2;Bdkrb1;Itga7;Itga11; Itgad;Fgf21;Arhgef6;Itgb2;Gsn;Ssh3;Actn1;Wasf2;Rac2;Fgf16;Itga10;Ptk2 Axon guidance E-09 Dpysl2;Efna5;Efnb3;Sema6c;Sema3f;Efna4;Ppp3r2;L1cam;Epha2;Nfatc4; Plxnb3;Ephb3;Cdk5;Epha3;Robo1;Epha1;Rac2;Sema4f;Ptk2 Complement and coagulation cascades E-12 C4b;Bdkrb2;F10;Serping1;F2r;Bdkrb1;Serpinc1;F3;Fgb;Cfi;F8;Kng1;C1qa;C1qb;C4bpa; Serpina5;C2 MAPK signaling pathway E-12 Map3k7;Tgfb2;Mapk6;Ecsit;Pdgfa;Cacng5;Cacna1i;Egf;Cd14;Map2k6;Rasa2;Ppp3r2;Mapk12; Mapkapk2;Rps6ka1;Cacnb4;Nfatc4;Stk3;Prkcb;Fgf21;Cacng8;Rasgrp3;Ptpn5;Tnf;Tgfb1;Rap1a; Cacng1;Rac2;Ptpn7;Fgf16;Ntf4;Mapk10 Calcium signaling pathway E-14 Adra1a;Grpr;Bdkrb2;Atp2b3;Tnnc1;Adcy4;Cacna1i;Vdac3;F2r;Gnas;Chrm2;Ptgfr; Avpr1b;Mylk2;Ppp3r2;Ptger1;Bdkrb1; Nos1;Slc8a2;Prkcb;Plce1;Lhcgr;Adrb1;Drd1a;Htr6;Ltb4r2;P2rx1;Trhr2;Itpr3 Cytokine-cytokine receptor interaction E-17 Tpo;Flt4;Epo;Cx3cl1;Relt;Tgfb2;Cxcl9;Prlr;Ccl26;Il8rb;Pdgfa;Il18r1;Egf;Ccl17;Tnfrsf25; Il21;Csf3;Osm; Il9;Ltbr;Cntfr;Clcf1;Tnf;Lta;Tgfb1;Ccl4;LOC301289; Bmp8a;Kit;Tnfrsf21;Prl;Tnfrsf10b;Il24;Ifngr2;Il10rb;Ccr6;Ifna4 Olfactory transduction E-20 Olr1401;Olr1768;Olr139;Olr1454;Olr62;Olr140;Olr107;Olr1592;Olr495;Olr288;Olr859;Olr1335; Olr144;Olr837;Olr462;Olr1092;Olr45;Olr78;Olr1456;Olr1702;Olr1765;Olr1644;Olr156;Olr1612; Olr1387;
5 Neuroactive ligand-receptor interaction E-25 Olr840;Olr856;Olr1645; Olr84;Olr1l;Olr303;Olr857;Olr1432;Olr425;Olr1686;Olr321;Olr875;Olr43;Olr69;Olr448; Olr1091;Olr4;Olr836;Olr1744;Olr153;Olr154;Olr1090;Olr1344;Olr434;Olr1568;Olr1413; Olr838;Olr113;Olr300;Olr307;Olr1309;Olr142;Olr1657;Olr1337; Olr149;Olr483;Olr130;Olr1595;Olr1334;Olr1096;Olr1106;Olr1198;Olr1306;Olr148; Olr1111;Olr168;Olr1093 Gpr83;Adra1a;Glp1r;Grpr;Galr1;Ppyr1;P2ry14;Prlr;Fshr;Bdkrb2;Ptgir;Nmur1;Grp; F2r;Ltb4r;Chrm2;Ptgfr;Tac4; Avpr1b;Grm2;Ptger1;Bdkrb1;Hcrt;Gpr156;Mtnr1a;Gpr35;Gabrg2;Lhcgr;Adrb1; Ppy;Grik5;S1pr4;Uts2;Ucn2;Drd3; Taar1;Drd1a;Glp2r;Ucn2;P2ry13;Kiss1r;Htr6;Ltb4r2;Hcrtr1;Sstr3;Prl;P2rx1; Trhr2;Tac2;P2ry4;Cnr2
6 Supplementary Figure 1 A Hypermethylation B Hypomethylation Tnf Prkcd Prkcz Camkk2 Prkcz Mapk10 tnf Abcc8 Rxrb Prkag3 Pck1 Cacna1e Adipoq Slc2a Log ratio Log ratio Prkce
Systems biology approaches and pathway tools for investigating cardiovascular disease
Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
K-means Clustering of a subset of five datasets that were identified as. TNBC by IHC. Since TNBCs are not identified by GE in the clinical setting, we
Supplemental Results K-means Clustering of a subset of five datasets that were identified as TNBC by IHC. Since TNBCs are not identified by GE in the clinical setting, we performed a similar GE analysis
Identification of Tissue-Specific Protein-Coding and Noncoding. Transcripts across 14 Human Tissues Using RNA-seq
Identification of Tissue-Specific Protein-Coding and Noncoding Transcripts across 14 Human Tissues Using RNA-seq Jinhang Zhu 1, Geng Chen 1, Sibo Zhu 1,2, Suqing Li 3, Zhuo Wen 3, Bin Li 1, Yuanting Zheng
Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
Supplementary figures
Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second
Signal transduction camp signaling pathway ko Signal transduction MAPK signaling pathway ko
Table S2 - Summary of the KEGG pathway annotation results for the P transcriptome. Pathway Hierarchy1 Pathway Hierarchy2 KEGG Pathway Pathway ID Gene Metabolism Amino acid metabolism Lysine degradation
fasting blood glucose [mg/dl]
![fasting blood glucose [mg/dl]](/thumbs/80/82129652.jpg "fasting blood glucose [mg/dl]")
SUPPLEMENTL MTERIL Supplemental Figure I body weight [g] 5 5 5 fasting blood glucose [mg/dl] 5 5 5 C total cholesterol [mg/dl] 8 6 4 WT Has -/- Supplemental Figure I: Has-deficient mice exhibited no apparent
Metabolomic Data Analysis with MetaboAnalystR
Metabolomic Data Analysis with MetaboAnalystR Name: guest623839008349489450 February 7, 2018 1 Background Understanding the functional importance of metabolites in untargeted metabolomics is limited due
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
Supplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips. by corresponding DMLs.
Supplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips by corresponding DMLs. Supplementary Table 1. Enriched biological pathways identified between 19 RA and 5 OA in
# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway
Supplementary Table 9. Pathways and biological processes associated with transcripts specific to SEB in both the pre- and post- RASP leukocytes (transcripts included in the Reactome Function Interaction
Chapter 5 Control of Cells by Chemical Messengers
Chapter 5 Control of Cells by Chemical Messengers = How hormones and other signals work Intercellular Communication = Intercellular Signal Transmission Chemical communication Electrical communication Intercellular
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
Pathway Map Reference Guide
Pathway Map Reference Guide Focus Attention-grabber Your Pathway The most popular cell signaling pathways Sample & Assay Technologies Table of contents AKT Signaling 4 camp Signaling 5 Cellular Apoptosis
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Cell Communication. Cell Communication. Cell Communication. Cell Communication. Cell Communication. Chapter 9. Communication between cells requires:
Chapter 9 Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the receptor binds -may be on the plasma membrane or within the cell 2 There are four
Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective
BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
Cell Communication and Cell Signaling
Cell Communication and Cell Signaling Why is cell signaling important? Why is cell signaling important? Allows cells to communicate and coordinate functions/activities of the organism Usually involves
Chapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed
Intercellular indirect communication
Intercellular indirect communication transmission of chemical signals: sending cell signal transmitting tissue hormone medium receiving cell hormone intercellular fluid blood neurocrine neurotransmitter
Supporting Information
Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department
PCxN: The pathway co-activity map: a resource for the unification of functional biology
PCxN: The pathway co-activity map: a resource for the unification of functional biology Sheffield Institute for Translational Neurosciences Center for Integrative Genome Translation GENOME INFORMATICS
Antigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
T cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.
!! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Lecture Outline. Hormones & Chemical Signaling. Communication Basics: Overview. Communication Basics: Methods. Four methods of cell communication
Lecture Outline Hormones & Chemical Signaling Communication Basics Communication Overview Communication Methods Signal pathways Regulation (modulation) of signal pathways Homeostasis... again Endocrine
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Canonical Pathway E-value Ratio mediated Signaling 4.90E BB Signaling in T Lymphocytes 2.57E Actin Cytoskeleton Signaling
Canonical Pathway E-value Ratio 14-3-3-mediated Signaling 4.90E-06 0.70 4-1BB Signaling in T Lymphocytes 2.57E-03 0.68 Actin Cytoskeleton Signaling 1.78E-09 0.65 Actin Nucleation by ARP-WASP Complex 1.29E-05
How Will New Therapies Affect HCC Development?
How Will New Therapies Affect HCC Development? July 6, 2018 Scott Friedman, M.D. Fishberg Professor of Medicine Dean for Therapeutic Discovery Chief, Division of Liver Diseases Icahn School of Medicine
Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01
Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. For multiple choice questions,
Brain Development III
Brain Development III Neural Development In the developing nervous system there must be: 1. The formation of different regions of the brain. 2. The ability of a neuron to differentiate. 3. The ability
INFLAMMATION & REPAIR
INFLAMMATION & REPAIR Lecture 7 Chemical Mediators of Inflammation Winter 2013 Chelsea Martin Special thanks to Drs. Hanna and Forzan Course Outline i. Inflammation: Introduction and generalities (lecture
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
ONCOLOGY REPORTS 29: , 2013
1902 Gene expression profiling and molecular pathway analysis for the identification of early-stage lung adenocarcinoma patients at risk for early recurrence HISASHI SAJI 1, MASAHIRO TSUBOI 1, YOSHIHISA
General Pathology 2015
JPC miniboard General Pathology 2015 Candidate #: 1. 26. 2. 27. 3. 28. 4. 29. 5. 30. 6. 31. 7. 32. 8. 33. 9. 34. 10. 35. 11. 36. 12. 37. 13. 38. 14. 39. 15. 40. 16. 41. 17. 42. 18. 43. 19. 44. 20. 45.
DAX1, testes development role 7, 8 DFFRY, spermatogenesis role 49 DMRT genes, male sex differentiation role 15
Subject Index N-Acetylcysteine, sperm quality effects 71 Ambiguous genitalia, origins 1, 2 Anti-Müllerian hormone function 13 receptors 13 Sertoli cell secretion 10, 38 Apoptosis assays in testes 73, 74
2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
Comparison of gene expression profiles and related pathways in chronic thromboembolic pulmonary hypertension
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 33: 277-300, 2014 Comparison of gene expression profiles and related pathways in chronic thromboembolic pulmonary hypertension SONG GU *, PIXIONG SU *, JUN YAN,
Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-120.
Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-0. Thomas J Velenosi, Anzel Hennop, David A Feere, Alvin Tieu, Andrew S Kucey, Polydoros Kyriacou, Laura E McCuaig,
Ch. 6: Communication, Integration & Homeostasis
Developed by John Gallagher, MS, DVM Ch. 6: Communication, Integration & Homeostasis Goals Describe cell to cell communication Electrical or Chemical only Explain signal transduction Review homeostasis
TCR, MHC and coreceptors
Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed
Supplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis
Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,
Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
silent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
T cell Receptor. Chapter 9. Comparison of TCR αβ T cells
Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain
Basic tumor nomenclature
Jonas Nilsson jonas.a.nilsson@surgery.gu.se Sahlgrenska Cancer Center Bilder gjorda av Per Holmfeldt och Jonas Nilsson Benign tumor Basic tumor nomenclature Malignant tumor = cancer Metastasis Carcinoma:
Cell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
Animal Models to Understand Immunity
Animal Models to Understand Immunity Hussein El Saghire hesaghir@sckcen.be Innate Adaptive immunity Immunity MAPK and NF-kB TLR pathways receptors Fast Slow Non-specific Specific NOD-like receptors T-cell
A decision analysis model for KEGG pathway analysis
Du et al. BMC Bioinformatics (2016) 17:407 DOI 10.1186/s12859-016-1285-1 RESEARCH ARTICLE Open Access A decision analysis model for KEGG pathway analysis Junli Du 1,2, Manlin Li 1, Zhifa Yuan 1, Mancai
CH 03 CELLS: THE LIVING UNITS
CH 03 CELLS: THE LIVING UNITS This chapter provides a review of critical information regarding cells the basic units of structure and function of all living things. CELL THEORY The cell theory resulted
Cellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
Supplementary Figures
Supplementary Figures Figure S1. Urodynamic recording of BOO-induced LUTD patients. (A) DO group. BOO patients with increased detrusor pressure and reduced urine flow during pressure flow in combination
A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.
Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism
T Lymphocyte Activation and Costimulation. FOCiS. Lecture outline
1 T Lymphocyte Activation and Costimulation Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline T cell activation Costimulation, the B7:CD28 family Inhibitory receptors of T cells Targeting costimulators for
LIX1 APOD RRM2 FAIM2 MGST1 UHRF1 PPIA BEX1
C2orf80 1 C2orf80 A2M ANXA1 APOD ARL4A BEX1 C1S C3 CD44 CHI3L1 CHI3L2 CLU DPYD DSCAM EMP3 FN1 GBP1 GEM GLIPR1 GRIA2 IDH1 LIX1 MAP2 MDK MGST1 MIR3917 NAMPT PCMTD2 PPIA PTN PTPRZ1 S100B SCG3 SERPINA3 TCF12
Subject Index. hypothalamic-pituitary-adrenal axis 158. Atherosclerosis, ghrelin role AVP, see Arginine vasopressin.
Subject Index Acromegaly, somatostatin analog therapy dopamine agonist combination therapy 132 efficacy 132, 133 overview 130, 131 receptor subtype response 131, 132 SOM30 studies 131, 132 ACTH, see Adrenocorticotropic
CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.
!! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)
Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal
24 Ayman Mesleh & Leen Alnemrawi Bayan Abusheikha Faisal We were talking last time about receptors for lipid soluble hormones.the general mechanism of receptors for lipid soluble hormones: 1. Receptors
Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
Cell responses to environment-- Signals
Cell responses to environment-- Signals Signal transduction can coordinate: Development Formation of tissues Timing of cell division Direction of cell enlargement Size and shape of organs Responses to
Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo
Integration of Cells into Tissues Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Hospital Lahore 1. How
Basic Immunology. Cytokines, cytokine receptors. Lecture 8th. Timea Berki MD, PhD
Basic Immunology Lecture 8th Cytokines, cytokine receptors Timea Berki MD, PhD 1. By direct cell-cell interactions: through adhesion molecules 2. By low MW regulatory proteins, called cytokines: messengers
Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS
Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS In Physiology Today Cell Communication Homeostatic mechanisms maintain a normal balance of the body s internal environment
Hormones and the Endocrine System Chapter 45. Intercellular communication. Paracrine and Autocrine Signaling. Signaling by local regulators 11/26/2017
Hormones and the Endocrine System Chapter 45 Intercellular communication Endocrine signaling Local regulators Paracrine and autocrine signaling Neuron signaling Synaptic and neuroendocrine signaling Paracrine
The Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
Reading Packet 2- Cells Unit. Chapter 6: A Tour of the Cell 1. What is resolving power?
AP Biology Reading Packet 2- Cells Unit Name Chapter 6: A Tour of the Cell 1. What is resolving power? 2. How is an electron microscope different from a light microscope and what is the difference between
The T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
Immunological Aspects of Parasitic Diseases in Immunocompromised Individuals. Taniawati Supali. Department of Parasitology
Immunological Aspects of Parasitic Diseases in Immunocompromised Individuals Taniawati Supali Department of Parasitology 1 Defense mechanism in human Th17 (? ) Acute Chronic Th1 Th 2 Intracellular Treg
General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center
General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses
Time course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
T Cell Activation, Costimulation and Regulation
1 T Cell Activation, Costimulation and Regulation Abul K. Abbas, MD University of California San Francisco 2 Lecture outline T cell antigen recognition and activation Costimulation, the B7:CD28 family
The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System
The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage
Pathway enrichment analysis of human osteosarcoma U-2 OS bone cells expose to dexamethasone
European Review for Medical and Pharmacological Sciences Pathway enrichment analysis of human osteosarcoma U-2 OS bone cells expose to dexamethasone 2014; 18: 2631-2639 J. CHEN, J. XIA, S.-Q. WANG, Y.-B.
Cellular Communication
(a) Communicating cell junctions. by direct cell-cell contact lasma membranes 1. Direct cell contact. Vesicle-mediated 3. Chemical messengers (b) Cell-cell recognition. Gap junctions between animal cells
Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS
SUPPLEMENTARY MATERIALS Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS Zhiqiang Pang 1, Guoqiang Wang 1, Nan Ran 1, Hongqiang
BCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
INTRACELLULAR SIGNALLING
INTRACELLULAR SIGNALLING R. Benacka,, MD, PhD Department of Pathophysiology Medical faculty, Safarik University 1. Long distance chemo A. Receptors without enzymatic activity c-amp IP3- dependent c-gmp/no
QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]
![QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]](/thumbs/86/94924826.jpg "QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]")
QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY] Learning Objectives: Explain how neurons communicate stimulus intensity Explain how action potentials are conducted along
Adaptive immune responses: T cell-mediated immunity
MICR2209 Adaptive immune responses: T cell-mediated immunity Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will discuss the T-cell mediated immune response, how it is activated,
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Vitreous! Retinal pigment epithelium! and the visual cycle! Retinal degenerations and pigment epithelium!
Vitreous Bruch s membrane Retinal pigment epithelium and the visual cycle Retinal degenerations and pigment epithelium Basic Science course 2017 Swiss Eye Week, Neuchâtel Ch. E. Remé, Zürich Ch.E. Remé
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Receptors Functions and Signal Transduction- L4- L5
Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway
BIOLOGICAL MEMBRANES
BIOLOGICAL MEMBRANES Biological membranes are supramolecular structures composed of lipids and proteins that define cellular content of external environment and can perform some functions. Functions: Compartmentalisation
Arteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
BL 424 Chapter 15: Cell Signaling; Signal Transduction
BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be