Table S1. Primers used in RT-PCR analysis of proteins identified by 2-DE. Gene Forward Reverse Product size (bp) AATTGTGCCTGCTGGAACATA
|
|
|
- Rafe Sharp
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary file Table S1. Primers used in RT-PCR analysis of proteins identified by 2-DE Gene Forward Reverse Product size (bp) 16S rrna CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG 103 ptha GAGGCGATACTCTTACTGTTGATG TGGTGCTTTTGGTACTGGACG 128 ecfa1 TGTTGGTGCTACTGTAGGTGA ACCCGTTGCTTCTGTCCTC 116 LBA0908 TGAAACCCTAAAAGGTGGCG CTCTTTTTTTGCTCATCCCTCC 149 LBA0745 CAGGTAAGACTGAAAGCTGGTAT AATTGTGCCTGCTGGAACATA 182 G G ptha: phosphotransferase system enzyme II; ecfa1: ABC ECF transporter, ATP-binding protein; LBA0908: fumarate reductase flavoprotein; LBA0745: mannose-6-phosphate isomerase
2 Table S2.The growth characteristics of L.acidophilus CICC22162 in stamrs or glumrs Medium Fitted curves of growth curves R² The maximum specific growth rate stamrs y = x x glumrs y = x x Table S3. Energy Components Contributing to Binding Free Energies in stachyose-laecfs Contributio n 21 st (Mode I) 24 th (Mode II) 26 th (Mode III) 28 th (Mode IV) E ele E vdw E gas G GB G sol-np,gb G sol,gb G ele,gb G bind,gb All energies are in kcal mol-1.
3 Table S4. Energy Components Contributing to Binding Free Energies in various ECF transporters Ligand Stachyose Vitamin B9 Vitamin B2 biotin Vitamin B1 Receptor LaEcf_mode21 LdEcf TmRibU LlBio Y LlThiT E ele E vdw E gas G GB G sol-np,gb G sol,gb G ele,gb G bind,gb All energies are in kcal mol-1.
4 Figure S1. Two-dimensional gel electrophoresis profile of proteins from L. acidophilus CICC in stamrs (A) or glumrs (B). Figure S2. Peptide mass fingerprint spectrum of proteins identified from reference 2D-gel (ph 3 10) of L. acidophilus grown on stamrs or glumrs medium. Protein identifications were confirmed with a Mascot score of 80 for peptide mass fingerprint. Spot 4 ATP-dependent helicase Spot 5: trna uridine 5-carboxymethylaminomethyl modification enzyme GidA
5 Spot 6: exodeoxyribonuclease Spot 7 hypothetical protein Sgly_3199 Spot 8 lysin Spot 9 phosphotransferase system enzyme II (PTS)
6 Spot 13 fumarate reductase flavoprotein Spot 15 mannose-6-phosphate isomerase The MS/MS fragmentation of mannose-6-phosphate isomerase. Single peptide based protein identifications by MS/MS analysis were confirmed with a Mascot score of 79.
7 Figure S3. Structure features of ECF and MSM transporters (A) The ECF transporter in cartoon representation (LaEcfS in yellow, LaEcfT in magenta, LaEcfA1 in red and LaEcfA2 in silver), and the MSM transporter in cartoon representation (LaMsmG in yellow, LaMsmF in magenta, the LaMsmK dimer in green and orange) (B) System setup for MD simulations. The ECF transporter was inserted in the POPC membrane and solvated in the water solvent. (C) The number of basic residues of LaEcfS and LaEcfT binding to the lipids along simulations.
8 Figure S4. The number of lipids binding to LaEcfS/T along simulations Figure S5. Binding modes of docked stachyose by SwissDock (A) Superposition of 250 docking hints, colored by their scores. (B) Representations of the four binding modes that were identified. These modes correspond to different spatial orientations of stachyose in complex with LaEcfS (magenta).
9 Figure S6. A close view of interactions in the stachyose-laecfs and vitaminb9-ldecfs complexes. Residues on EcfS responsible for its binding to stachyose (A) and vitamin B9 (B). The per-residue interaction spectrum of the residues of EcfS with stachyose (C) and vitamin B9 (D) according to MM-GBSA free energy decomposition analysis. Figure S7. Representations of the substrate-load ECF extracted from the X-ray structures. The pocket volumes from these EcfS structures were calculated by CastP.
10
SUPPORTING INFORMATION. Lysine Carbonylation is a Previously Unrecognized Contributor. to Peroxidase Activation of Cytochrome c by Chloramine-T
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 SUPPORTING INFORMATION Lysine Carbonylation is a Previously Unrecognized Contributor to
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
Table S1. X-ray data collection and refinement statistics
Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) 0.97950 Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3,
Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site.
Supplementary Figure 1 Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site. (a) Gel filtration profiles of purified 5 TMD samples at 100 nm, heated beforehand for
in-silico Design of Nanoparticles for Transdermal Drug Delivery Application
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 in-silico Design of Nanoparticles for Transdermal Drug Delivery Application Rakesh Gupta and Beena
(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.
Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three
Adaptable Lipid Matrix Promotes Protein Protein Association in Membranes
Supporting information Adaptable Lipid Matrix Promotes Protein Protein Association in Membranes Andrey S. Kuznetsov, Anton A. Polyansky,, Markus Fleck, Pavel E. Volynsky, and Roman G. Efremov *,, M. M.
Supplementary Information
Supplementary Information Archaeal Elp3 catalyzes trna wobble uridine modification at C5 via a radical mechanism Kiruthika Selvadurai, Pei Wang, Joseph Seimetz & Raven H Huang* Department of Biochemistry,
Chapter 23 Enzymes 1
Chapter 23 Enzymes 1 Enzymes Ribbon diagram of cytochrome c oxidase, the enzyme that directly uses oxygen during respiration. 2 Enzyme Catalysis Enzyme: A biological catalyst. With the exception of some
Molecular Graphics Perspective of Protein Structure and Function
Molecular Graphics Perspective of Protein Structure and Function VMD Highlights > 20,000 registered Users Platforms: Unix (16 builds) Windows MacOS X Display of large biomolecules and simulation trajectories
Mass Spectrometry. - Introduction - Ion sources & sample introduction - Mass analyzers - Basics of biomolecule MS - Applications
- Introduction - Ion sources & sample introduction - Mass analyzers - Basics of biomolecule MS - Applications Adapted from Mass Spectrometry in Biotechnology Gary Siuzdak,, Academic Press 1996 1 Introduction
Mass Spectrometry. Mass spectrometer MALDI-TOF ESI/MS/MS. Basic components. Ionization source Mass analyzer Detector
Mass Spectrometry MALDI-TOF ESI/MS/MS Mass spectrometer Basic components Ionization source Mass analyzer Detector 1 Principles of Mass Spectrometry Proteins are separated by mass to charge ratio (limit
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/3/eaaq0762/dc1 Supplementary Materials for Structures of monomeric and oligomeric forms of the Toxoplasma gondii perforin-like protein 1 Tao Ni, Sophie I. Williams,
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Tivadar Orban, Beata Jastrzebska, Sayan Gupta, Benlian Wang, Masaru Miyagi, Mark R. Chance, and Krzysztof Palczewski
Structure, Volume Supplemental Information Conformational Dynamics of Activation for the Pentameric Complex of Dimeric G Protein-Coupled Receptor and Heterotrimeric G Protein Tivadar Orban, Beata Jastrzebska,
SDS-Assisted Protein Transport Through Solid-State Nanopores
Supplementary Information for: SDS-Assisted Protein Transport Through Solid-State Nanopores Laura Restrepo-Pérez 1, Shalini John 2, Aleksei Aksimentiev 2 *, Chirlmin Joo 1 *, Cees Dekker 1 * 1 Department
Insights into the Giardia intestinalis Enolase and Human Plasminogen interaction
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Supplementary Information Insights into the Giardia intestinalis Enolase and Human
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10913 Supplementary Figure 1 2F o -F c electron density maps of cognate and near-cognate trna Leu 2 in the A site of the 70S ribosome. The maps are contoured at 1.2 sigma and some of
Midterm 1 Last, First
Midterm 1 BIS 105 Prof. T. Murphy April 23, 2014 There should be 6 pages in this exam. Exam instructions (1) Please write your name on the top of every page of the exam (2) Show all work for full credit
Heat Shock Proteins in Targeted Cancer Chemotherapy
Heat Shock Proteins in Targeted Cancer Chemotherapy Aykut ÖZGÜR 1 and Yusuf TUTAR 2,* 1 Gaziosmanpaşa University, Faculty of Natural Sciences and Engineering, Department of Bioengineering, Tokat, Turkey
The mechanism of patellamide macrocyclization revealed by study of the Prochloron sp PatG macrocyclase domain
The mechanism of patellamide macrocyclization revealed by study of the Prochloron sp PatG macrocyclase domain Jesko Koehnke 1,2, Andrew Bent 1,2, Wael E. Houssen 2,3,4, David Zollman 1, Falk Morawitz 1,
Supplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor
Molecules 216, 21, 846; doi:1.339/molecules217846 S1 of S14 Supplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor Ram B. Khattri, Daniel
SUPPLEMENTARY INFORMATION. Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity
SUPPLEMENTARY INFORMATION Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity Christopher Woods 1, Maturos Malaisree 1, Ben Long 2, Simon McIntosh-Smith
Changes to Biochemistry (4th ed.), 2nd Printing
Changes to Biochemistry (4th ed.), 2nd Printing 1. p. vi, line 7. Change: hydrophobic to hydrophilic. Make the same change on the back cover. 2. p. xx, at the end of the Chap. 17 portion. Add the line:
Supplementary Table 1. Data collection and refinement statistics (molecular replacement).
Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Data set statistics HLA A*0201- ALWGPDPAAA PPI TCR PPI TCR/A2- ALWGPDPAAA PPI TCR/A2- ALWGPDPAAA Space Group P2
Modeling holo-acp:dh and holo-acp:kr complexes of modular polyketide synthases: a docking and molecular dynamics study
Anand and Mohanty BMC Structural Biology 2012, 12:10 RESEARCH ARTICLE Open Access Modeling holo-acp:dh and holo-acp:kr complexes of modular polyketide synthases: a docking and molecular dynamics study
Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for
Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.
Lecture 3. Tandem MS & Protein Sequencing
Lecture 3 Tandem MS & Protein Sequencing Nancy Allbritton, M.D., Ph.D. Department of Physiology & Biophysics 824-9137 (office) nlallbri@uci.edu Office- Rm D349 Medical Science D Bldg. Tandem MS Steps:
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
SUPPORTING INFORMATION
SUPPORTING INFORMATION Phosphine-Mediated Disulfide Metathesis in Aqueous Media Rémi Caraballo, Morakot Sakulsombat, and Olof Ramström* KTH - Royal Institute of Technology, Department of Chemistry Teknikringen
Protein Identification and Phosphorylation Site Determination by de novo sequencing using PepFrag TM MALDI-Sequencing kit
Application Note Tel: +82-54-223-2463 Fax : +82-54-223-2460 http://www.genomine.com venture ldg 306 Pohang techno park Pohang, kyungbuk, Korea(ROK) Protein Identification and Phosphorylation Site Determination
Page Location Correction Correction made in this printing 7 Third paragraph
The following corrections have been made in various reprints of the Lehninger Principles of Biochemistry, 3e. Turn to page ii of your text to determine which printing you have. For example, if your book
This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References
Structure of the catalytic core of p300 and implications for chromatin targeting and HAT regulation Manuela Delvecchio, Jonathan Gaucher, Carmen Aguilar-Gurrieri, Esther Ortega, Daniel Panne This PDF file
SUPPORTING INFORMATION FOR. A Computational Approach to Enzyme Design: Using Docking and MM- GBSA Scoring
SUPPRTING INFRMATIN FR A Computational Approach to Enzyme Design: Predicting ω- Aminotransferase Catalytic Activity Using Docking and MM- GBSA Scoring Sarah Sirin, 1 Rajesh Kumar, 2 Carlos Martinez, 2
ATP-independent reversal of a membrane protein aggregate by a chloroplast SRP
ATP-independent reversal of a membrane protein aggregate by a chloroplast SRP Peera Jaru-Ampornpan 1, Kuang Shen 1,3, Vinh Q. Lam 1,3, Mona Ali 2, Sebastian Doniach 2, Tony Z. Jia 1, Shu-ou Shan 1 Supplementary
Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9
Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9 Kristine E. Yoder, a * and Ralf Bundschuh b a Department of Molecular Virology, Immunology and Medical Genetics, Center
Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146
Abstract The 2008 ABRF Proteomics Research Group Study offers participants the chance to participate in an anonymous study to identify qualitative differences between two protein preparations. We used
Supporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 018 Supporting Information Modulating Interactions between Ligand-Coated Nanoparticles and Phase-Separated
Table S1: Kinetic parameters of drug and substrate binding to wild type and HIV-1 protease variants. Data adapted from Ref. 6 in main text.
Dynamical Network of HIV-1 Protease Mutants Reveals the Mechanism of Drug Resistance and Unhindered Activity Rajeswari Appadurai and Sanjib Senapati* BJM School of Biosciences and Department of Biotechnology,
N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis
JOURNAL OF PROTEOMICS 74 (2011) 431 441 available at www.sciencedirect.com www.elsevier.com/locate/jprot N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis Masahiro Kamita
7.014 Problem Set 2 Solutions
7.014 Problem Set 2 Solutions Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in at the box outside 68-120 by 11:45 Friday, February
Structural vs. nonstructural proteins
Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.5 % SDS-PAGE gel under reducing and non-reducing conditions.
2. (12 pts) Given the following metabolic pathway (as it occurs in the cell):
Answer Sheet 1 (Gold) 1. (1 pt) Write your exam ID (A) in the blank at the upper right of your answer sheet. 2. (12 pts) Given the following metabolic pathway (as it occurs in the cell): a. Would you expect
Nature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila Ayako Kohyama-Koganeya, 1,2 Takuji Nabetani, 1 Masayuki Miura, 2,3 Yoshio Hirabayashi
Problem-solving Test: The Mechanism of Protein Synthesis
Q 2009 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Vol. 37, No. 1, pp. 58 62, 2009 Problem-based Learning Problem-solving Test: The Mechanism
Supporting information
Supporting information Figure legends Supplementary Table 1. Specific product ions obtained from fragmentation of lithium adducts in the positive ion mode comparing the different positional isomers of
Introduction to Proteomics 1.0
Introduction to Proteomics 1.0 CMSP Workshop Pratik Jagtap Managing Director, CMSP Objectives Why are we here? For participants: Learn basics of MS-based proteomics Learn what s necessary for success using
Nature Methods: doi: /nmeth.3177
Supplementary Figure 1 Characterization of LysargiNase, trypsin and LysN missed cleavages. (a) Proportion of peptides identified in LysargiNase and trypsin digests of MDA-MB-231 cell lysates carrying 0,
Danish Research Institute of Translational Neuroscience DANDRITE, Nordic-EMBL Partnership
Supplementary Information for Tuning of the Na,K-ATPase by the beta subunit Florian Hilbers 1,2,3, Wojciech Kopec 4, Toke Jost Isaksen 3,5, Thomas Hellesøe Holm 3,5, Karin Lykke- Hartmann 3,5,6, Poul Nissen
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/9/e1600292/dc1 Supplementary Materials for Native phasing of x-ray free-electron laser data for a G protein coupled receptor Alexander Batyuk, Lorenzo Galli,
Christoph Zuth, Alexander L. Vogel, Sara Ockenfeld, Regina Huesmann and Thorsten Hoffmann * S-1. Supporting Information for:
Supporting Information for: Ultra-High-Resolution Mass Spectrometry in Real-Time: Atmospheric Pressure Chemical Ionization Orbitrap Mass Spectrometry (APCI- Orbitrap-MS) of Atmospheric Organic Aerosol
G = Energy of activation
Biochemistry I, CHEM 4400 Exam 2 10:00 Fall 2015 Dr. Stone Name rate forward = k forward [reactants] rate reverse = k reverse [products] K eq = [products]/[reactants] ΔG = ΔH - TΔS ΔG = ΔG + RT ln Q Q
Supplementary Material
Supplementary Material Materials and methods Enzyme assay The enzymatic activity of -glucosidase toward salicin was measured with the Miller method (Miller, 1959) using glucose as the standard. A total
Chapter 3. Structure of Enzymes. Enzyme Engineering
Chapter 3. Structure of Enzymes Enzyme Engineering 3.1 Introduction With purified protein, Determining M r of the protein Determining composition of amino acids and the primary structure Determining the
The N-terminal loop of IRAK-4 death domain regulates ordered assembly of the Myddosome signalling scaffold
The N-terminal loop of IRAK-4 death domain regulates ordered assembly of the Myddosome signalling scaffold Anthony C.G. Dossang * 1, Precious G. Motshwene * 1, Yang Yang* 1, Martyn F. Symmons*, Clare E.
Supporting Information
Supporting Information Mechanism of inactivation of -aminobutyric acid aminotransferase by (1S,3S)-3-amino-4-difluoromethylenyl-1- cyclopentanoic acid (CPP-115) Hyunbeom Lee, 1, Emma H. Doud, 1,2 Rui Wu,
Final Report. Identification of Residue Mutations that Increase the Binding Affinity of LSTc to HA RBD. Wendy Fong ( 方美珍 ) CNIC; Beijing, China
Final Report Identification of Residue Mutations that Increase the Binding Affinity of LSTc to HA RBD Wendy Fong ( 方美珍 ) CNIC; Beijing, China Influenza s Viral Life Cycle 1. HA on virus binds to sialic
Chemistry 5.07 Problem Set 5 (redox cofactors and oxidation reactions; carbohydrate chemistry, and introduction to metabolism)
Chemistry 5.07 Problem Set 5 (redox cofactors and oxidation reactions; carbohydrate chemistry, and introduction to metabolism) Problem 1 Succinate dehydrogenase (SDH) is a heterotetramer enzyme complex
C. K. Manju, Jyoti Sarita Mohanty, Depanjan Sarkar, Sudhakar Chennu and Thalappil Pradeep a *
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry C. This journal is The Royal Society of Chemistry 2018 Electronic supplementary information (ESI): Towards atomically precise
PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System
Application Note LC/MS PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System Purpose This application note describes an automated workflow
Supplementary Figure 1. Localization of face patches (a) Sagittal slice showing the location of fmri-identified face patches in one monkey targeted
Supplementary Figure 1. Localization of face patches (a) Sagittal slice showing the location of fmri-identified face patches in one monkey targeted for recording; dark black line indicates electrode. Stereotactic
Pocket Guide. Version 4.1: Fracture reduction and deformity correction software
Pocket Guide www.spatialframe.com Version 4.1: Fracture reduction and deformity correction software Shoulder bolt Master tab Strut 5 Strut 1 Strut 6 Strut 4 Strut 2 Strut 3 ID band Figure 1 Frame assembly
Rapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition
Rapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition Evelyn Goh Waters Pacific, Singapore APPLICATION BENEFITS This method allows for the simultaneous analysis of 12 water-soluble
BIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction
Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction Amir Barati Farimani, Mohammad Heiranian, Narayana R. Aluru 1 Department
SUPPLEMENTARY INFORMATION FOR. (R)-Profens Are Substrate-Selective Inhibitors of Endocannabinoid Oxygenation. by COX-2
SUPPLEMENTARY INFORMATION FOR (R)-Profens Are Substrate-Selective Inhibitors of Endocannabinoid Oxygenation by COX-2 Kelsey C. Duggan, Daniel J. Hermanson, Joel Musee, Jeffery J. Prusakiewicz, Jami L.
BIOCHEMISTRY 460 FIRST HOUR EXAMINATION FORM A (yellow) ANSWER KEY February 11, 2008
WRITE YOUR AND I.D. NUMBER LEGIBLY ON EVERY PAGE PAGES WILL BE SEPARATED FOR GRADING! CHECK TO BE SURE YOU HAVE 6 PAGES, (print): ANSWERS INCLUDING COVER PAGE. I swear/affirm that I have neither given
Quantification with Proteome Discoverer. Bernard Delanghe
Quantification with Proteome Discoverer Bernard Delanghe Overview: Which approach to use? Proteome Discoverer Quantification Method What When to use Metabolic labeling SILAC Cell culture systems Small
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/4/e1500980/dc1 Supplementary Materials for The crystal structure of human dopamine -hydroxylase at 2.9 Å resolution Trine V. Vendelboe, Pernille Harris, Yuguang
Break Desired Compound into 3 Smaller Ones
Break Desired Compound into 3 Smaller nes A B C Indole ydrazine Phenol When creating a covalent link between model compounds move the charge on the deleted into the carbon to maintain integer charge (i.e.
Electron Transfer Chain
Molecular Biochemistry I Electron Transfer Chain Contents of this page: Electron transfer reactions Electron carriers Respiratory chain Electron Transfer is discussed on p. 555-556, 571-574 and 802-820
EGFR model presentation E L Z A R A K I M A L O V A A L E X S M I T H
EGFR model presentation E L Z A R A K I M A L O V A A L E X S M I T H What are we going to talk about? Phenomena of the Sos-EGF dose response curve (length of run) Talking about dimers when rules are for
Supplementary Material
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 The UBL and RING1 interface remains associated in the complex structures of Parkin and pub. a) Asymmetric Unit of crystal structure of UBLR0RBR and pub complex showing UBL (green),
SUPPORTING INFORMATION. High Throughput Reaction Screening using Desorption Electrospray Ionization Mass Spectrometry
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 SUPPORTING INFORMATION High Throughput Reaction Screening using Desorption Electrospray
BS11 Midterm 2 (1999)
Question 1. 12 points. A. (4 pts) Briefly explain the difference in melting points between trans-oleic acid (18:1, 9)(44.5C) and cis-oleic acid (18:1, 9) (13.4C). The cis double bond puts a kink or bend
Fig.S1 ESI-MS spectrum of reaction of ApA and THPTb after 16 h.
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Experiment Cleavage of dinucleotides Dinucleotides (ApA, CpC, GpG, UpU) were purchased from
Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g.
Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g., casein more interestingly, in most other cases, it is a transient
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
obtained for the simulations of the E2 conformation of SERCA in a pure POPC lipid bilayer (blue) and in a
Supplementary Figure S1. Distribution of atoms along the bilayer normal. Normalized density profiles obtained for the simulations of the E2 conformation of SERCA in a pure POPC lipid bilayer (blue) and
Chemical Surface Transformation 1
Chemical Surface Transformation 1 Chemical reactions at Si H surfaces (inorganic and organic) can generate very thin films (sub nm thickness up to µm): inorganic layer formation by: thermal conversion:
Dr. DerVartanian is ill and will likely not be able to give lectures this week.
Dr. DerVartanian is ill and will likely not be able to give lectures this week. Today s slides will be put on-line today, and are designed to introduce you to glycolysis. You should use these slides, along
Previous Class. Today. Detection of enzymatic intermediates: Protein tyrosine phosphatase mechanism. Protein Kinase Catalytic Properties
Previous Class Detection of enzymatic intermediates: Protein tyrosine phosphatase mechanism Today Protein Kinase Catalytic Properties Protein Phosphorylation Phosphorylation: key protein modification
medical software for trauma and ortopedic surgery planning
medical software for trauma and ortopedic surgery planning SEGMENTATION REDUCTION/RECONSTRUCTION PLANNING CONSTRUCTION AND DESIGN WHAT IS EBS EBS is standalone medical software which is used in healthcare
Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface. Modification Effects on Cellular Uptake,
Electronic Supplementary Material (ESI) for Toxicology Research. This journal is The Royal Society of Chemistry 2014 Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface Modification
The peculiar behavior of Picha in the formation of metallacrown complexes with Cu(II), Ni(II) and Zn(II), in aqueous solution
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 15 Supplementary Information for the paper The peculiar behavior of Picha in the formation
Supplementary Figures
Supplementary Figures Supplementary Figure 1. (a) Uncropped version of Fig. 2a. RM indicates that the translation was done in the absence of rough mcirosomes. (b) LepB construct containing the GGPG-L6RL6-
During the last half century, much effort has been devoted
Membranes serve as allosteric activators of phospholipase A 2, enabling it to extract, bind, and hydrolyze phospholipid substrates Varnavas D. Mouchlis a,b,1, Denis Bucher b, J. Andrew McCammon a,b,c,1,
Bio 366: Biological Chemistry II Final Exam, 100 points
Bio 366: Biological Chemistry II Final Exam, 100 points READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the back of
CHEM121. Unit 6: Enzymes. Lecture 10. At the end of the lecture, students should be able to:
CHEM121 Unit 6: Enzymes Lecture 10 At the end of the lecture, students should be able to: Define the term enzyme Name and classify enzymes according to the: type of reaction catalyzed type of specificity
Supporting information for the article
Supporting information for the article S1 Exceptional behavior of Ni 2 O 2 species revealed by ESI-MS and MS/MS studies in solution. Application of superatomic core to facilitate new chemical transformations
Catalysis & specificity: Proteins at work
Catalysis & specificity: Proteins at work Introduction Having spent some time looking at the elements of structure of proteins and DNA, as well as their ability to form intermolecular interactions, it
5 Identification of Binding Partners of the Annexin A2 / P11 Complex by Chemical Cross-Linking
5 Identification of Binding Partners of the Annexin A2 / P11 Complex by Chemical Cross-Linking In the quest of the omics sciences for holistic schemes, the identification of binding partners of proteins
Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
Supporting Information. Development of N, S-doped carbon dots as a novel matrix for the. analysis of small molecules by negative ion MALDI-TOF MS
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 16 Supporting Information Development of N, S-doped carbon dots as a novel matrix for the analysis
Data are contained in multiple tabs in Excel spreadsheets and in CSV files.
Contents Overview Curves Methods Measuring enzymatic activity (figure 2) Enzyme characterisation (Figure S1, S2) Enzyme kinetics (Table 3) Effect of ph on activity (figure 3B) Effect of metals and inhibitors