This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References
|
|
|
- Andra Riley
- 5 years ago
- Views:
Transcription
1 Structure of the catalytic core of p300 and implications for chromatin targeting and HAT regulation Manuela Delvecchio, Jonathan Gaucher, Carmen Aguilar-Gurrieri, Esther Ortega, Daniel Panne This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References
2 Supplementary Fig.1 Biochemical characterization. (a) Mass spectrometry analysis using electrospray ionization (ESI) of the p300 'core' before, and after (b) deacetylation by SIRT2. Inset shows a Western blot of p300 deacetylation by SIRT2. Levels of acetylation were detected by western blot using an anti acetyllysine antibody. Incubation times in hours (h) are indicated above the gel. After overnight (o/n) incubation, SIRT2 was able to completely deacetylate the p300 'core'. (c) HAT activity was measured with a variant in which the AIL was replaced with a 5 residue linker ( ). Substrate was a peptide derived from histone H3 (1 20) ARTKQTQRKSTGGKAPRKQL.
3 Supplementary Fig.2 Structural comparisons of PHD and RING domains. (a) Structure of the BPTF PHD domain bound to H3K4 me3. (b) Superimposed structures of p300 PHD (red), Pygo (2VPE, green), BPTF (3qvz, orange), ING2 (2G6Q, blue). The PHD domain is most similar to the PHD domain of BPTF. (c) Structure based sequence alignment of the PHD domain. Zinc ligand positions are shown as red boxes. Residues that make up the aromatic cage are shown as a blue box and labeled I IV. Residues that make specific contacts with the H3K4me2/3 peptide are shown in green. (d) The RING domain is similar to other RING structures. Superimposed structures of p300 RING (green) and Cbl RING domain (red). The p300 RING domain is missing the second Zinc binding site. The sequence insertion in loop L1 is shown. (e) Structure based sequence alignment of the RING domain. Zinc ligand positions as above. Residues that make specific contacts with E2 enzymes are shown in blue. 3MMK: Residues are omitted from the alignment.
4 Supplementary Fig.3 BRP HAT interaction and structural details and interaction interfaces. (a), The BRP module binds to the HAT domain. Pull down experiments with GST BRP against the HAT domain. Input (I), Wash (W) and Bound (B). (b) Isothermal titration calorimetry based binding curves with wild type BRP or a Bromodomain mutant BRP N1132. (c) Stereo view of the RING HAT interface. (d) Crystal packing in the vicinity of the RING domain. The HAT domain (HAT*) of a crystallographically related molecule packs against the RING domain. (e) There are two p300 molecules in the asymmetric crystallographic unit; they overlay well on each other (rmsd 0.9 Å for 564 Cα residues). Coloring as in Figure 1.
5 Supplementary Fig.4 Multiple sequence alignment of p300/cbp orthologs. Human (hp300), mouse (mp300), bovine (bp300) and dog (cp300). Also included are the CBP homologs human (hcbp), mouse (mcbp), rat (rcbp), Drosophila melanogaster (dcbp) and Caenorhabditis elegans (ccbp). Identical residues are shown with a red background and similar residues with red letters. Secondary structure elements of p300 are shown above the amino acid sequences. The Bromodomain (BROMO) is highlighted in yellow, the RING domain in green, the PHD domain in red and the HAT domain in blue. Intramolecular contacts between domains: Residues in the BROMO PHD interface ( ). Residues in the RING HAT interface ( ). Residues in the PHD HAT interface (*). The sequence alignment was performed using ClustalW 1 and the figure generated using ESPript 2.
6 Supplementary Fig.5 Functional analysis of the RING domain and in vivo assays. (a) Superposition of E2 ubiquitin onto the RING domain of p300. The ternary complex of RNF4:UbcH5 ubiquitin (Protein Data Bank entry 4AP4) was superimposed onto the RING domain of p300. Residues of the p300 RING and HAT domains that would sterically clash with UbcH5 or Ubiquitin if the interaction were to follow the mode of the RNF4:UbcH5 ubiquitin complex are colored in red. (b) E3 ligase activity assays. Polyubiquitination assays were done using the indicated p300 constructs and the E2 conjugating enzymes UbcH2, UbcH3, UbcH5a, UbcH5b, UbcH5c, UbcH6, UbcH7, UbcH8, UbcH10 and UbcH13 complex. The result obtained with UbcH5a is shown here. Reactions were incubated for 1 h at 37 C followed by SDS PAGE and immunoblotting. (c-f) H1299 cells were transfected with the indicated expression vectors (c) GFP, (d) GFP BRP, (e) GFP BRP N1132A, (f) GFP Bd. Cells were treated with or without the HDAC inhibitor Trichostatin A (TSA). Ectopically expressed proteins were visualized by GFP and co-detected with an anti-tetraacetyl-histone H4 antibody. Immunofluorescence was performed with anti-ha or anti-h3k56ac antibody. Bar: 10 µm.
7 Supplementary Fig.6 Uncropped images for the blots shown in figure 4 a and b. (a) Anti p300 K1499 acetyl immunoblot of lysates of H1299 cells transfected with the indicated mutants. (b) Loading control of hemagglutinin (HA)-tagged p300, determined by immunoblotting with anti-ha antibody. (c) Anti p53 K373 K382 acetyl (p53 KAc) immunoblot of lysates of H1299 cells, transfected with the indicated p300 mutants and p53. (d) Loading control of Flag-tagged p53 and (e) HA-p300, determined by immunoblotting with anti-flag or anti-ha antibody, respectively.
8 Supplementary Table 1. Structure based mutagenesis and functional analysis Mutation Domain Structural Auto Disease PMID* alteration acetylation WT + Bd Bd RING RING Breast AIL HAT N1132A Bd KAc binding pocket + F1170E RING RING HAT contact + Y1178D RING E2 binding + C1204R RING Zinc ligation +++ Lymphoid Neoplasm I1208D RING E2 binding + 6 E1242R RING RING HAT contact +++ E1242K RING RING HAT contact +++ RTS (CBP) F1244A PHD PHD Bromo contact + 1 H1255A PHD Zinc ligation + I1257A PHD PHD HAT contact + L1260E PHD PHD HAT contact + I1265D PHD PHD HAT contact + F1288E W1593E M1596E PHD or HAT PHD HAT contact + D1399Y HAT HAT L1 loop Colon Cancer G1443E HAT HAT RING contact + 3 H1449Y HAT HAT RING contact + Y1467F HAT HAT CoA contact Lymphoid Neoplasm R1645E HAT HAT RING contact + Malignant Melanoma R1645E R1646E HAT HAT RING contact *PMID: Pubmed Identifier
9 Supplementary Table 2. Interactions in histone peptide arrays with GST BRP Peptide Mod1 Mod2 Mod3 Mod4 N terminus Intensities H K16ac K20ac acetylated H R3me2s K5ac K8ac K12ac free H K5ac K8ac K12ac free H R3me2a K5ac K8ac free H K8ac K12ac K16ac free H R3me2a K5ac K8ac K12ac free H K16ac R19me2a acetylated H2B 1 19 K12ac K15ac free H R24me2s K20ac acetylated H2B 1 19 K5ac K12ac K15ac free H K16ac K20me3 acetylated H2B 1 19 K5ac K15ac free H R3me2s K5ac K8ac free H K5ac K8ac K12ac K16ac free H K16ac K20me2 acetylated H K12ac K16ac K20me2 acetylated H2A 1 19 K13ac free H2B 1 19 S14P K15ac free H S1P R3me2s K5ac K8ac free H2B 1 19 K5ac K12ac S14P K15ac free H K12ac K16ac K20me1 acetylated H S1P R3me2a K5ac K8ac free H2B 1 19 K12ac S14P K15ac free H K12ac K16ac acetylated H K12ac K16ac K20me3 acetylated H S1P R3me2a K5ac free H K16ac K20me1 acetylated H K12ac K16ac K20ac acetylated H2B 1 19 K5ac S14P K15ac free H2A 1 19 K5ac free H K20ac acetylated H K12ac K16ac free H2A 1 19 S1P K9ac K13ac free H2B 1 19 K5ac K12ac free H2B 1 19 K15ac free H R19me2s K20ac acetylated H K8ac K16ac free H K4ac R8me2s K9ac free H R24me2a K20ac acetylated H S1P R3me2s K5ac free H2A 1 19 K5ac K9ac K13ac free H2B 1 19 K12ac free H T11P K14ac free H K5ac K8ac free H K16ac R17me2a acetylated H2A 1 19 S1P K5ac K13ac free H K12ac acetylated H2A 1 19 S1P K5ac K9ac K13ac free H K14ac R17me2a K18ac acetylated H R19me2a K20ac acetylated H R3me2a K5ac free H R2me2a K4ac K9ac free H K36ac acetylated H K8ac K12ac free H K14ac K18ac acetylated H K16ac R19me2s acetylated H K12ac free H S10P K14ac free H K5ac free H K9ac K14ac free H R2me2a K4ac R8me2a K9ac free H R2me2s K4ac R8me2a K9ac free H R3me2s K5ac free H2A 1 19 S1P K5ac K9ac free H R17me2s K18ac acetylated H S1P K5ac free H K8ac free H K14ac R17me2s K18ac acetylated H R2me2s K4ac R8me2s K9me3 free H2A 1 19 S1P K5ac free H2A 1 19 K5ac K13ac free H2A 1 19 K9ac K13ac free H2A 1 19 K5ac K9ac free H K16ac acetylated H K16ac R17me2s acetylated H R26me2a K27ac acetylated H R3me2s K8ac free H2A 1 19 S1P K13ac free H R3me2a K8ac free H K4ac R8me2a K9me3 free H R2me2s K4ac R8me2s K9ac free H R17Citr K18ac acetylated H R17me2a K18ac acetylated 0.074
10 H K4ac R8me2s K9me3 free H2A 1 19 K9ac free H R26me2s K27ac acetylated H R2me2a K4me3 K9ac free H R2me2s K4ac R8me2a K9me2 free H K18ac acetylated H R2me2a K4ac R8me2s K9ac free H K4ac R8me2a K9ac free H K9me2 K14ac free H K27ac acetylated Supplementary References 1. Thompson, J.D., Higgins, D.G. & Gibson, T.J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, (1994). 2. Gouet, P., Robert, X. & Courcelle, E. ESPript/ENDscript: Extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Res. 31, (2003).
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.
Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Cbl ubiquitin ligase: Lord of the RINGs
Cbl ubiquitin ligase: Lord of the RINGs Not just quite interesting - really interesting! A cell must be able to degrade proteins when their activity is no longer required. Many eukaryotic proteins are
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site.
Supplementary Figure 1 Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site. (a) Gel filtration profiles of purified 5 TMD samples at 100 nm, heated beforehand for
Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
KDM2A. Reactions. containing. Reactions
Supplementary Figure 1 KDM2A catalyses only lysine demethylation.. MALDI-TOF MS of demethylation of the shown variant histone peptides as catalysed by recombinant KDM2A. Reactions containing enzyme are
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Eukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary Information for Structural basis for the inhibition of Polo-like kinase 1
Supplementary Information for Structural basis for inhibition of Polo-like kinase 1 Jun Xu, Chen Shen, Tao Wang & Junmin Quan Correspondence authors: Tao Wang, taowang@pkusz.edu.cn; Junmin Quan, quanjm@szpku.edu.cn
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 The UBL and RING1 interface remains associated in the complex structures of Parkin and pub. a) Asymmetric Unit of crystal structure of UBLR0RBR and pub complex showing UBL (green),
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Nature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
The Role of Protein Domains in Cell Signaling
The Role of Protein Domains in Cell Signaling Growth Factors RTK Ras Shc PLCPLC-γ P P P P P P GDP Ras GTP PTB CH P Sos Raf SH2 SH2 PI(3)K SH3 SH3 MEK Grb2 MAPK Phosphotyrosine binding domains: PTB and
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
crossmark Ca V subunits interact with the voltage-gated calcium channel
crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Excerpt from J. Mol. Biol. (2002) 320, :
Excerpt from J. Mol. Biol. (2002) 320, 1095 1108: Crystal Structure of the Ternary Complex of the Catalytic Domain of Human Phenylalanine Hydroxylase with Tetrahydrobiopterin and 3-(2-Thienyl)-L-alanine,
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/4/e1500980/dc1 Supplementary Materials for The crystal structure of human dopamine -hydroxylase at 2.9 Å resolution Trine V. Vendelboe, Pernille Harris, Yuguang
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
SUPPLEMENTAL INFORMATION. Evolving Spindlin1 Small Molecule Inhibitors Using Protein Microarrays
SUPPLEMETAL IFRMATI Evolving Spindlin1 Small Molecule Inhibitors Using Protein Microarrays arkhyun Bae 1, Monica Viviano 2, Xiaonan Su 3, Jie Lu 4, Donghang Cheng 1, Cari Sagum 1, Sabrina Castellano 2,6,
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
Histone acetyltransferase CBP-related H3K23 acetylation contributes to courtship learning in Drosophila
Li et al. BMC Developmental Biology (2018) 18:20 https://doi.org/10.1186/s12861-018-0179-z RESEARCH ARTICLE Open Access Histone acetyltransferase CBP-related H3K23 acetylation contributes to courtship
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
Supporting Information
Supporting Information McCullough et al. 10.1073/pnas.0801567105 A α10 α8 α9 N α7 α6 α5 C β2 β1 α4 α3 α2 α1 C B N C Fig. S1. ALIX Bro1 in complex with the C-terminal CHMP4A helix. (A) Ribbon diagram showing
supplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
Supplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
ab E3 Ligase Auto- Ubiquitilylation Assay Kit
ab139469 E3 Ligase Auto- Ubiquitilylation Assay Kit Instructions for Use For testing ubiquitin E3 ligase activity through assessment of their ability to undergo auto-ubiquitinylation This product is for
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
Data Sheet. Fluorogenic HDAC 8 Assay Kit Catalog #: 50068
Data Sheet Fluorogenic HDAC 8 Assay Kit Catalog #: 50068 DESCRIPTION: The Fluorogenic HDAC 8 Assay Kit is a complete assay system designed to measure histone deacetylase (HDAC) 8 activity for screening
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3073 LATS2 Binding ability to SIAH2 Degradation by SIAH2 1-160 161-402 403-480 -/ 481-666 1-666 - - 667-1088 -/ 1-0 Supplementary Figure 1 Schematic drawing of LATS2 deletion mutants and
Table S1. X-ray data collection and refinement statistics
Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) 0.97950 Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3,
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
Supplementary Information
Supplementary Information Archaeal Elp3 catalyzes trna wobble uridine modification at C5 via a radical mechanism Kiruthika Selvadurai, Pei Wang, Joseph Seimetz & Raven H Huang* Department of Biochemistry,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. Schematic of Ras biochemical coupled assay.
EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)
EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.aal4326/dc1 Supplementary Materials for Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution Huaizong Shen, Qiang Zhou, Xiaojing
Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)
Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5
Nature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
Data are contained in multiple tabs in Excel spreadsheets and in CSV files.
Contents Overview Curves Methods Measuring enzymatic activity (figure 2) Enzyme characterisation (Figure S1, S2) Enzyme kinetics (Table 3) Effect of ph on activity (figure 3B) Effect of metals and inhibitors
Nature Structural & Molecular Biology: doi: /nsmb.1933
The structural basis of open channel block in a prokaryotic pentameric ligand-gated ion channel Ricarda J. C. Hilf, Carlo Bertozzi, Iwan Zimmermann, Alwin Reiter, Dirk Trauner and Raimund Dutzler a GLIC
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Molecular Medicine: Gleevec and Chronic Myelogenous Leukemia. Dec 14 & 19, 2006 Prof. Erin O Shea Prof. Dan Kahne
Molecular Medicine: Gleevec and Chronic Myelogenous Leukemia Dec 14 & 19, 2006 Prof. Erin Shea Prof. Dan Kahne 1 Cancer, Kinases and Gleevec: 1. What is CML? a. Blood cell maturation b. Philadelphia Chromosome
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
List of Figures. List of Tables
Supporting Information for: Signaling Domain of Sonic Hedgehog as Cannibalistic Calcium-Regulated Zinc-Peptidase Rocio Rebollido-Rios 1, Shyam Bandari 3, Christoph Wilms 1, Stanislav Jakuschev 1, Andrea
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature07422 SUPPLEMENTARY INFRMATIN K S(P) R S I M Q(L4) R M 7 6 Sp Q I K R 5 4 3 2 1 L(L0) L L S E 0 +1 +2 +3 Figure S1a Difference electron density (mfo DFc) for the peptide (Qpeptide),
Supplementary Figure S1. Appearacne of new acetyl groups in acetylated lysines using 2,3-13 C 6 pyruvate as a tracer instead of labeled glucose.
Supplementary Figure S1. Appearacne of new acetyl groups in acetylated lysines using 2,3-13 C 6 pyruvate as a tracer instead of labeled glucose. (a) Relative levels of both new acetylation and all acetylation
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Protein methylation CH 3
Protein methylation CH 3 methionine S-adenosylmethionine (SAM or adomet) Methyl group of the methionine is activated by the + charge of the adjacent sulfur atom. SAM S-adenosylhomocysteine homocysteine
Phenylketonuria (PKU) Structure of Phenylalanine Hydroxylase. Biol 405 Molecular Medicine
Phenylketonuria (PKU) Structure of Phenylalanine Hydroxylase Biol 405 Molecular Medicine 1998 Crystal structure of phenylalanine hydroxylase solved. The polypeptide consists of three regions: Regulatory
Structure of the measles virus hemagglutinin bound to the CD46 receptor. César Santiago, María L. Celma, Thilo Stehle and José M.
Supporting Figures and Table for Structure of the measles virus hemagglutinin bound to the CD46 receptor César Santiago, María L. Celma, Thilo Stehle and José M. Casasnovas This PDF file includes: Supplementary
Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*
Supplementary Information for Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling Elissaveta Petrova 1,5, Jessica Rios-Esteves 1,2, Ouathek Ouerfelli 3, J. Fraser Glickman 4, and Marilyn
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Workshop on Analysis and prediction of contacts in proteins
Workshop on Analysis and prediction of contacts in proteins 1.09.09 Eran Eyal 1, Vladimir Potapov 2, Ronen Levy 3, Vladimir Sobolev 3 and Marvin Edelman 3 1 Sheba Medical Center, Ramat Gan, Israel; Departments
Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically
Supplementary Figures Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically synthesized polyubiquitin chains of different length. a, Differential scanning calorimetry traces
Supplemental Information. An Atlas of b-glucuronidases. in the Human Intestinal Microbiome
Structure, Volume 2 Supplemental Information An Atlas of b-glucuronidases in the Human Intestinal Microbiome Rebecca M. Pollet, Emma H. D'Agostino, William G. Walton, Yongmei Xu, Michael S. Little, Kristen
33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA