Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Transcription

1 Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer Meda4 specific 5 inner primer EST (547bp) _at Meda4 specific 3 inner primer Meda4 specific 3 inner primer 3 RACE adaptor 3 RACE inner primer 3 RACE outer primer 5 -Meda4 inner race (~1.8Kb) 3 -Meda4 inner race (~1.1Kb) B: C: human MEDA-4 humanmeda-4 ORF (909bp)

2 Supplemental Fig1: Meda-4 cloning in mouse and human adipose tissue. (A) Meda-4 full length cdna was cloned from mouse adipose tissue by 5 RACE and 3 RACE with gene specific primers derived from Affymetrix probe ID _at 5 RACE and 3 RACE PCR product was sequenced and Meda-4 full length cdna was assembled. Mouse MEDA-4 gene, spanning 19.9KB (indicated with solid arrow above the diagram), mapped to chromosome 5G3. It contains five exons (I--V) and four introns (a-d). The dashed arrows below the diagram indicate the size of Meda-4 cdna bp. The box indicates the size of coding region ORF-912bp. (B) Human MEDA-4 is located on chromosome 13 at 13q12. (C) Human MEDA-4 ORF was also cloned from human adipose tissue by PCR using primers including the predicted start and stop codons.

3 Supplemental Figure2 A: B: Species Gene Protein mrna Mouse Rik NP NM Rat RGD XP XM Human C13orf33 NP NM Chimpanzee LOC XP XM Cow MGC NP NM Supplemental Figure 2: species conservation of MEDA-4. (A) Sequence conservation of MEDA-4 protein across several mammalian species. The sequence of mouse and human MEDA- 4 proteins are as deduced from our current cloning work on adipose tissue. Human MEDA-4 shares 99%, 91%, 91%, and 90% identity with chimpanzee, rat, mouse and cow proteins. (B) The accession numbers are shown.

4 Supplemental Table 1: List of primers For RACE For Subclone 5 race inner primer-f a 5 race outer primer-f Meda4-3'race inner primer G.S.-F Meda4-3'race outer primer G.S-F. Human MEDA-4 ORF-F(BglII) Mouse Meda-4 ORF-F (BglII) shrna-meda4- F(BglII) shrna- CONTROL-F (BglII) cgcggatccgaacactgcgtttgctgg ctttgatg gctgatggcgatgaatgaacactg gcctggtgcctgtaattcta cagggaaactaagccattacca taatagatgtggtgtgaggaccgacg ac atattcagatctatggccactgcagcgt gcga gatccccagaagacagatagagcaa gttcaagagacttgctctatctgtcttctt tttta gatccccttgcttgtaccgtgcgtgctt caagagagcacgcacggtacaagca attttta 5'race inner primer Meda-4--G.S.R b 5'race outer primer Meda-4--G.S.R 3 race inner primer-r 3 race outer primer-r Human- MEDA-4 ORF-R(AgeI) Mouse Meda-4 ORF-R(SalI) shrna-meda4- R(HindIII) shrna- CONTROL-R (HindIII) gtgcaatgatgcaggtttgtt tgccttcttatgagtataggtgcaa cgcggatccgaattaatacgactca ctatagg gcgagcacagaattaatacgact agctaccggtgataaattggttggg tgtct tagcgtcgacgataagttggctgga tgtctct agcttaaaaaagaagacagataga gcaagtctcttgaacttgctctatctg tcttctggg agcttaaaaattgcttgtaccgtgc gtgctctcttgaagcacgcacggta caagcaaggg For PCR and Q- PCR Pparγ2 -F ctcctgttgacccagagcat Ppar γ2-r aatgcgagtggtcttccatc Pref-1-F tccatgaaagagctcaacaaga Pref-1-R tctcggggaagatgatattgac Mouse Meda-4-F gtgccaatcaaccagtgaca Moue Meda-4-R gccctgatgtccagtgtacc (in Probe) (in Probe) Human MEDA- aggacgtacgcgtttcttgt Human MEDA-4-R gaattactgagcccgaacca 4-F c/ebp-α-f agcaacgagtaccgggtacg c/ebp-α-r tgtttggctttatctcggctc Pparγ -F ctcctgttgacccagagcat Pparγ-R aatgcgagtggtcttccatc c/ebp-δ-f ctatacctcagaccccgaca c/ebp-δ-r atagcttctctcgcagtcca Human GAPDH- gagtccactggcgtcttca Human GAPDH-R ggggtgctaagcagttggt F Mouse Gapdh-F gatgacatcaagaaggtggtga Mouse Gapdh-R tgctgtagccgtattcattgtc Mouse βactin-f ccagatcatgtttgagaccttc Mouse βactin-f aggatcttcatgaggtagtctg Adiponectin-F ggaacttgtgcaggttggat Adiponectin-R gcttctccaggctctccttt Plin1-F agacctacaacagcaccaaaga Plin1-R gatcttttctggagggtattga Acox1-F tgacttccatcaagtggtggc Acox1-R atgtaacccgtagcactcccct Lpl -F agctggtgggaaatgatgtg Lpl -R actgggggcttctgcatact Glut-4-F tcggctctgacgatggggaa Glut-4-R gccacggagagagcccagag Tnfα-F caaaccaccaagtggaggag Tnfα-R gtgggtgaggagcacgtagt Hsl-F cctactgctgggctgtcaa Hsl-R ccatctggcaccctcact ap2-f catgaaagaagtgggagtgggc ap2- R gaccggatggtgaccaaatc FAS-F cacagatgatgacaggagatgg FAS-R tcggagtgaggctgggttgat

5 Supplemental Table 2A: Ontology cluster of FORKO MAT gene dysregulation Ontology cluster Number of transcript P value Cell cycle process E -11 Cell differentiation E -10 Cell activation E -10 Apoptosis E -7 Cell proliferation E -7 Cytokine production E -6 Lipid binding E -5 Inflammatory response E -4 Lipid metabolism process E -4 Fat cell differentiation E -3

6 Supplemental Table 2B: Dysregulation of Adipogenesis Genes in FORKO MAT Gene list Fold change P value 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 Abhydrolase domain containing Acetyl-Coenzyme A acyltransferase 1A Acetyl-Coenzyme A acyltransferase 1B Acyl-CoA synthetase long-chain family member Acyl-Coenzyme A dehydrogenase family, member 11 Acyl-Coenzyme A oxidase 1, palmitoyl Aldehyde dehydrogenase family 1, subfamily A Carnitine acetyltransferase CCAAT/enhancer binding protein, alpha CD Enoyl-Coenzyme A, hydratase/3-hydroxyacyl coenzyme A dehydrogenase Early B cell factor Adipocyte fatty acid binding protein 2 (Fatty acid binding protein 4, adipocyte) Fatty acid desaturase Growth hormone receptor Lipase, hormone sensitive Lipin Paraoxonase Patatin-like phospholipase domain containing Peroxisomal biogenesis factor 11 alpha Peroxisomal biogenesis factor Peroxisome proliferative activated receptor, gamma, coactivator 1 alpha Peroxisome proliferator activated receptor alpha Peroxisome proliferator activated receptor gamma Phospholipase A1 member A Solute carrier family 24 (fatty acid transporter), member 1 Diacylglycerol kinase zeta Diacylglycerol kinase alpla Ceramide kinase

7 Supplemental Table 2: Microarray analysis identified genes dysregulated >3 fold, P<0.05, as compared with WT littermates. A: Using DAVID Gene Functional Classification Tool ( to cluster genes into functional groups. B: lists of known adipogenesis and lipid metabolism related genes dysregulated>3 fold, P<0.05 in FORKO.

8 Supplemental Table 3: Predicted MEDA-4 protein domains Domain N-glycosylation camp and cgmp dependent protein kinase phosphorylation Protein kinase C phosphorylation Position 189: NLSF; 212: NSTV; 223: NLTS 231:KKET;248:RRSS;255:RKFS 123: TKK; 163:SYR; 214:TVK; 234:TIK; 253:SDR; 260:TSR; 274:SPR Casein kinase II phosphorylation 18: SSGE; 123: TKKD; 227: TNPE; 251: SFSD, 264: SIDD; 278: SVTE; 291: SLLE Tyrosine kinase phosphorylation 92: KRYVELTNY N-myristoylation 209 GLSNST Prosite Motif search (prosite.expasy.org) predicted 6 different protein domains of potential post-translational modifications.