Histone H3K4 and K36 Methylation, Chd1 and Rpd3S Oppose the Functions of Saccharomyces cerevisiae Spt4 Spt5 in Transcription
|
|
|
- Constance Ford
- 5 years ago
- Views:
Transcription
1 Supporting Information Histone H3K4 and K36 Methylation, Chd1 and Rpd3S Oppose the Functions of Saccharomyces cerevisiae Spt4 Spt5 in Transcription Tiffani Kiyoko Quan and Grant Ashley Hartzog Copyright 2010 by the Genetics Society of America DOI: /genetics
2 2 SI T. K. Quan and G. A. Hartzog Supplemental Figure 1 (-540 to -299) (479 to 746) TEF2 (1377bp) 4 fold enrichment over intergenic chr V untagged RTF1 rtf1 rtf1 1 FIGURE S1.--Rtf1 recruits Chd1 to chromatin. To determine if Rtf1-Chd1 binding is required for normal association of Chd1 with chromatin, strains carrying HA1-tagged Chd1 and the indicated rtf1 mutations were subjected to anti-ha1 ChIP. Association of Chd1 with the FIGURE S1. Rtf1 recruits Chd1 to chromatin. To determine if Rtf1-Chd1 binding is required for normal association of Chd1 with promoter chromatin, or strains transcribed carrying region HA1-tagged of TEF2 Chd1 was and then indicated determined rtf1 mutations by QPCR. were The subjected data to are anti-ha1 presented ChIP. Association and of Chd1 analyzed with the as described promoter or as transcribed in Figure region 5. of TEF2 was then determined by QPCR. The data are presented and analyzed as described in Figure 5.
3 T. K. Quan and G. A. Hartzog 3 SI TABLE S1 Yeast strains Strain Mat Genotype Alias/Source GHY92 a his4-912δ lys2-128δ leu2δ1 ura3-52 spt5-242 GHY279 α his3δ200 lys2-128δ ura3-52 leu2δ1 chd1δ::his3 trp1δ63 GHY305 a his3δ200 lys2-128δ ura3-52 leu2δ1 chd1δ::his3 spt5-242 GHY374 a his4-912δ lys2-128δ leu2δ1 spt5-242 GHY510 a his3δ200 lys2-128δ ura3-52 spt5-242 GHY513 a his3δ200 lys2-128δ leu2δ1 spt5-242 GHY536 α his3δ200 ura3-52 chd1δ::his3 GHY766 α his4-912δ lys2-128δ leu2(δ1 or Δ::PET56) ura3-52 gcn5δ::leu2 GHY773 a his3δ200 lys2-128δ ura3-52 leu2δ1 HA1 3-CHD1 GHY827 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 spt5-242 GHY840 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 (hht1-hhf1)δ::leu2 (hht2- hhf2)δ::his3 [pdm9] GHY843 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 spt5-242 (hht1-hhf1)δ::leu2 (hht2- hhf2)δ::his3 [pdm9] GHY985 α his3δ200 lys2-128δ ura3-52 trp1δ63 spt3-202 FY1288/Fred Winston GHY1121 a his4-912δ lys2-128δ leu2δ1 ura3-52 trp1δ63 rtf1δ101::leu2 KY522/Karen Arndt GHY1468 α his4-912δ lys2-128δ leu2δ1 trp1δ63 ura3-52 set1δ::kanmx MB1476/Mary Bryk GHY1487 α his4-912δ lys2-128δ leu2δ1 ura3-52 suc2δ(-1900/-390) rad6δ::ura3 FY623/Fred Winston GHY1489 α his4-912δ lys2-128δ leu2δ1 trp1δ63 ura3-52 set2δ::kanmx4 MBY1478/Mary Bryk GHY1516 α his4-912δ lys2-128δ leu2δ(0 or 1) ura3δ0 dot1δ::kanmx GHY1517 a his3δ1 leu2δ(0 or 1) dot1δ::kanmx spt5-242 GHY1521 a his4-912δ lys2-128δ ura3-52 trp1δ63 leu2δ1 spt5-242 set2δ::kanmx GHY1523 a his4-912δ lys2-128δ ura3-52 trp1δ63 leu2δ1 spt5-242 set1δ::kanmx GHY1527 α his4-912δ lys2-128δ ura3-52 leu2δ1 spt5-242 rad6δ::ura3 suc2δuas(-1900/- 390) GHY1540 α his4-912δ lys2-128δ ura3(δ0 or -52) leu2δ(0 or 1) spt5-242 set2δ::kanmx GHY1578 a his3δ1 leu2δ0 ura3δ0 isw2δ::kanmx GHY1661 α his3δ200 lys2-128δ leu2δ1 ura3-52 HA1 3-CHD1 trp1δ63 (hht1-hhf1)δ::leu2 (hht2-hhf2)δ::his3 [pdm9] GHY1662 a his3δ200 lys2-128δ leu2δ1 ura3-52 HA1 3-CHD1 set1δ::nat GHY1663 α his3δ200 lys2-128δ leu2δ1 ura3-52 HA1 3-CHD1 set2δ::kanmx4 GHY1687 α his4-912δ lys2-128δ leu2δ1 ura3-52 trp1δ63 spt5-242 rtf1δ101::leu2 GHY1696 α his4-912δ leu2δ1 ura3-52 spt7δ::leu2 FY964/Fred Winston
4 4 SI T. K. Quan and G. A. Hartzog GHY1774 a his3δ1 ura3δ0 leu2δ0 isw1δ0::nat GHY1786 a his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 rtf1δ101::leu2 HA1 3-CHD1 GHY1855 a his3δ1 leu2δ0 ura3δ0 isw1δ::nat isw2δ::ura3 GHY1876 a his3δ(1 or 200) leu2δ(1 or 0) ura3(-52 or Δ0) chd1δ::his3 isw1δ::nat isw2δ::ura3 GHY1882 α his3δ(1 or 200) leu2δ(1 or 0) ura3(-52 or Δ0) chd1δ::his3 isw2δ::ura3 GHY1883 a his3δ(1 or 200) leu2δ(1 or 0) ura3(-52 or Δ0) chd1δ::his3 isw1δ::nat GHY1918 a his3δ200 lys2-128δ ura3-52 spt5-242 GHY1919 α his3δ200 lys2-128δ ura3-52 spt5-242 dst1δ::hisg-ura3 GHY1920 α his3δ200 lys2-128δ leu2δ1 ura3-52 spt5-242 chd1δ::his3 GHY1921 α his3δ200 lys2-128δ leu2δ1 ura3-52 spt5-242 chd1δ::his3 dst1δ::hisg-ura3 GHY1923 a his3δ200 lys2-128δ ura3-52 dst1δ::hisg-ura3 GHY1924 α his3δ200 lys2-128δ ura3-52 chd1δ::his3 GHY1925 a his3δ200 lys2-128δ leu2δ1 ura3-52 chd1δ::his3 dst1δ::hisg-ura3 GHY1959 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 GHY1961 a his3δ200 lys2-128δ leu2δ1 ura3-52 chd1δ::his3 GHY1964 α his3δ200 lys2-128δ leu2δ1 ura3-52 chd1δ::his3 dst1δ::hisg-ura3 GHY1966 α his3δ200 lys2-128δ leu2δ1 ura3-52 dst1δ::hisg-ura3 GHY1967 α his3δ200 lys2-128δ leu2δ1 ura3-52 spt4δ2::kan GHY1968 a his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 spt4δ2::kan chd1δ::his3 GHY1969 α his3δ200 lys2-128δ leu2δ1 ura3-52 spt4δ2::kan dst1δ::hisg-ura3 GHY1970 α his3δ200 lys2-128δ leu2δ1 ura3-52 spt4δ2::kan dst1δ::hisg-ura3 chd1δ::his3 GHY1971 a his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 spt6-14 GHY1972 α his3δ200 lys2-128δ leu2δ1 ura3-52 spt6-14 chd1δ::his3 GHY1973 a his3δ200 lys2-128δ leu2δ1 ura3-52 spt6-14 dst1δ::hisg-ura3 GHY1974 a his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 spt6-14 chd1δ::his3 dst1δ::hisg- URA3 GHY1975 a his3δ(1 or 200) lys2-128δ leu2δ(0 or 1) ura3(δ0 or -52) eaf3δ0::kanmx6 GHY1977 a his3δ(1 or 200) leu2δ(0 or 1) ura3(δ0 or -52) met15δ0 spt5-242 eaf3δ0::kanmx6 GHY1979 a his3δ(1 or 200) lys2-(128δ or Δ0) leu2δ(0 or 1) ura3δ0 rco1δ0::kanmx6 GHY1981 α his3δ(1 or 200) lys2-128δ leu2δ(0 or 1) spt5-242 rco1δ0::kanmx6 GHY1983 a his3δ200 lys2-128δ ura3-52 rpd3δ0::his3
5 T. K. Quan and G. A. Hartzog 5 SI GHY1985 a his3δ200 lys2-128δ ura3-52 leu2δ1 spt5-242 rpd3δ0::his3 GHY1987 a his4-912δ lys2-128δ leu2δ1 ura3-52 set2δ::kanmx4 dst1δ::hisg-ura3 GHY1988 α his4-912δ lys2-128δ leu2δ1 ura3-52 spt5-242 dst1δ::hisg-ura3 GHY1989 α his4-912δ lys2-128δ leu2δ1 ura3-52 trp1δ63 spt5-242 set2δ::kanmx4 dst1δ::hisg-ura3 GHY1990 α lys2(-128δ or Δ0) leu2δ(1 or 0) ura3(-52 or Δ0) rco1δ0::kanmx6 GHY1991 a his3δ200 lys2-128δ leu2δ(1 or 0) ura3(-52 or Δ0) spt5-242 rco1δ0::kanmx6 GHY1992 a his4-912δ lys2(-128δ or Δ0) leu2δ(1 or 0) ura3(-52 or Δ0) dst1δ::hisg-ura3 rco1δ0::kanmx6 GHY1993 a his3δ200 lys2(-128δ or Δ0) leu2δ(1 or 0) ura3(-52 or Δ0) spt5-242 dst1δ::hisg- URA3 GHY1994 a his3δ200 his4-912δ lys2(-128δ or Δ0) leu2δ(1 or 0) ura3(-52 or Δ0) spt5-242 dst1δ::hisg-ura3 rco1δ0::kanmx6 GHY1995 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 pgal1-flo8-his3::kanmx GHY2001 a his3δ200 lys2-128δ leu2δ(0 or 1) ura3(-52 or Δ0) trp1δ63 set1δ::nat pgal1- FLO8-HIS3::KANMX GHY2003 a his3δ200 lys2-128δ leu2δ(0 or 1) ura3(-52 or Δ0) dot1δ::caura3 pgal1- FLO8-HIS3::KANMX GHY2005 a his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 (hht2-hhf2)δ::nat pgal1-flo8- HIS3::KANMX GHY2006 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63(hht1-hhf1)δ::leu2 pgal1-flo8- HIS3::KANMX GHY2009 a his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 (hht1-hhf1)δ::leu2 (hht2- hhf2)δ::nat pgal1-flo8-his3::kanmx [pdm9] GHY2013 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 chd1δ::ura3 pgal1-flo8- HIS3::KANMX GHY2049 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 set2δ::nat pgal1-flo8- HIS3::KAN GHY2138 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 pgal1-ylr454w::trp1 GHY2139 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 chd1δ::his3 pgal1- YLR454w::TRP1 GHY2140 α his3δ200 lys2-128δ leu2δ1 ura3-52 trp1δ63 spt5-242 pgal1-ylr454w::trp1 GHY2141 α his3(δ200 or +) his4-912δ lys2-128δ leu2δ1 ura3-52 trp1δ63 spt5-242 chd1δ::his3 pgal1-ylr454w::trp1 OY28 α his3δ200 leu2δ1 ura3-52 gcn5δ::his3 IPY37/Ines Pinto OY94 a his4-912δ lys2-128δ leu2δ1 ura3-52 FY120/Fred Winston OY98 α his3δ200 lys2-128δ leu2δ1 trp1δ63 ura3-52 FY603/Fred Winston OY382 α his3δ1 lys2δ0 leu2δ0 ura3δ0 spt8δ::kanmx
6 6 SI T. K. Quan and G. A. Hartzog TABLE S2 Plasmids Plasmid Markers source prm430 hht2δ4-30 HHF2 TRP1 CEN AmpR Michael Grunstein MBB259 hht2-k4a HHF2 TRP1 CEN AmpR Mary Bryk MBB257 hht2-k4r HHF2 TRP1 CEN AmpR Mary Bryk pwz414-f30 hht2-k9q HHF2 TRP1 CEN AmpR Sharon Dent pwz414-f53 hht2-k9r HHF2 TRP1 CEN AmpR Sharon Dent pwz414-f31 hht2-k14q HHF2 TRP1 CEN AmpR Sharon Dent pwz414-f43 hht2-k14r HHF2 TRP1 CEN AmpR Sharon Dent MBB286 hht2-k36r HHF2 TRP1 CEN AmpR Mary Bryk phht2-k4r,k36r hht2-k4r,k36r HHF2 TRP1 CEN AmpR LeAnne Howe pwz414-f13-k79a hht2-k79a HHF2 TRP1 CEN AmpR Kevin Struhl pwz414-f13-k79q hht2-k79q HHF2 TRP1 CEN AmpR Kevin Struhl phht2-k9,14,18,23r hht2-k9r,k14r,k18r,k23r HHF2 TRP1 CEN AmpR LeAnne Howe prs314-flag-htb1-k123r Flag-htb1-K123R TRP1 CEN AmpR Mary Ann Osley pgh269 HA 3-CHD1 URA3 CEN AmpR Hartzoglab ptq5 HA 3-CHD1-ΔCD URA3 CEN AmpR Hartzoglab ptq4 HA 3-CHD1-ΔCD1 URA3 CEN AmpR Hartzoglab ptq3 HA 3-CHD1-ΔCD2 URA3 CEN AmpR Hartzoglab pmg316 HA 3-CHD1-Y316E URA3 CEN AmpR PatrickGrant pkr37 HA 3-rtf1Δ1 TRP1 CEN AmpR KarenArndt ptq10 rtf1δ1 TRP1 CEN AmpR Hartzoglab pls21 5 Δ2 HA 3-rtf1Δ2 TRP1 CEN AmpR KarenArndt pkr27 HA 3-rtf1Δ3 TRP1 CEN AmpR KarenArndt pdm9 HHT1-HHF1 URA3 CEN AmpR FredWinston pjh18 HHT2-HHF2 TRP1 CEN AmpR MaryBryk pls21 5 HA13-RTF1 TRP1 CEN AmpR KarenArndt
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
Requirements of Slm proteins for proper eisosome organization, endocytic trafficking and recycling in the yeast Saccharomyces cerevisiae
Requirements of Slm proteins for proper eisosome organization, endocytic trafficking and recycling in the yeast Saccharomyces cerevisiae CHITRA KAMBLE, SANDHYA JAIN, ERIN MURPHY and KYOUNGTAE KIM* Department
Analysis of a Mutant Histone H3 That Perturbs the Association of Swi/Snf with Chromatin
MOLECULAR AND CELLULAR BIOLOGY, Jan. 2004, p. 561 572 Vol. 24, No. 2 0270-7306/04/$08.00 0 DOI: 10.1128/MCB.24.2.561 572.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Analysis
Supplemental material
THE JOURNAL OF CELL BIOLOGY Supplemental material Gaik et al., http://www.jcb.org/cgi/content/full/jcb.201411003/dc1 Figure S1. -Helically predicted domain of Nup159 are conserved among fungi. Multi-sequence
Spn1 Regulates the Recruitment of Spt6 and the Swi/Snf Complex during Transcriptional Activation by RNA Polymerase II
MOLECULAR AND CELLULAR BIOLOGY, Feb. 2008, p. 1393 1403 Vol. 28, No. 4 0270-7306/08/$08.00 0 doi:10.1128/mcb.01733-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Spn1 Regulates
Supporting Information
Supporting Information Hu et al..73/pnas.3489 SI Materials and Methods Histone Extraction and Western Blot Analysis. Rice histone proteins were extracted from -d-old seedlings. After being washed with
Eukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
SUPPLEMENTARY INFORMATION
Methods Reagents. The Rpl25-FLAG strain (YIT613) and the K0, NS and K12 constructs were kind gifts of T. Inada (Nagoya University, Japan) and have been previously described 1,2. The VHL-CHFP yeast expression
Fold change jhd2δ vs WT
Strand a a a Fold change jhdδ v WT Fold change et1δ v WT Gene name YMR11C. 1.59 MTD1.5 1.57 SOM1.5 1.53 ARG1.5 1.5 YJR79W.5 1.5 BNA. 1.9 YJR15W.5 1.75 DSF1.5 1.5 YGL13C. 1. GON3.9 1.5 FLO1.5 5. SPO75.59.75
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
ubiquitinylation succinylation butyrylation hydroxylation crotonylation
Supplementary Information S1 (table) Overview of histone core-modifications histone, residue/modification H1 H2A methylation acetylation phosphorylation formylation oxidation crotonylation hydroxylation
TORC1 controls degradation of the transcription factor Stp1, a key effector of the SPS amino-acidsensing pathway in Saccharomyces cerevisiae
Research Article 2089 TORC1 controls degradation of the transcription factor Stp1, a key effector of the SPS amino-acidsensing pathway in Saccharomyces cerevisiae Chun-Shik Shin, Sun Young Kim and Won-Ki
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Stelter et al., http://www.jcb.org/cgi/content/full/jcb.201105042/dc1 S1 Figure S1. Dyn2 recruitment to edid-labeled FG domain Nups.
Saccharomyces cerevisiae Gle2/Rae1 is involved in septin organization, essential for cell cycle progression
Yeast Yeast 2017; 34: 459 470. Published online 28 September 2017 in Wiley Online Library (wileyonlinelibrary.com).3249 Research Article Saccharomyces cerevisiae Gle2/Rae1 is involved in septin organization,
Role for ADA/GCN5 Products in Antagonizing Chromatin- Mediated Transcriptional Repression
MOLECULAR AND CELLULAR BIOLOGY, Nov. 1997, p. 6212 6222 Vol. 17, No. 11 0270-7306/97/$04.00 0 Copyright 1997, American Society for Microbiology Role for ADA/GCN5 Products in Antagonizing Chromatin- Mediated
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
The histone H3K36 demethylase Rph1/KDM4 regulates the expression of the photoreactivation gene PHR1
Published online 3 February 2011 Nucleic Acids Research, 2011, Vol. 39, No. 10 4151 4165 doi:10.1093/nar/gkr040 The histone H3K36 demethylase Rph1/KDM4 regulates the expression of the photoreactivation
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
The Role of Protein Domains in Cell Signaling
The Role of Protein Domains in Cell Signaling Growth Factors RTK Ras Shc PLCPLC-γ P P P P P P GDP Ras GTP PTB CH P Sos Raf SH2 SH2 PI(3)K SH3 SH3 MEK Grb2 MAPK Phosphotyrosine binding domains: PTB and
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Haipeng Xing, Yifan Mo, Will Liao, Michael Q. Zhang Clayton Davis and Geoffrey
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
Biotechnology for Biofuels. Open Access RESEARCH. Virginia Schadeweg and Eckhard Boles *
DOI 10.1186/s13068-016-0673-0 Biotechnology for Biofuels RESEARCH Open Access Increasing n butanol production with Saccharomyces cerevisiae by optimizing acetyl CoA synthesis, NADH levels and trans 2 enoyl
Gene expression regulation during cellular differentiation. Dom Helmlinger CRBM 24/10/2017
Gene expression regulation during cellular differentiation Dom Helmlinger CRBM 24/10/2017 Outline 1. Gene expression regulation: why and how? 2. Yeast as model systems. 3. Control of sexual differentiation
Roles of SWI/SNF and HATs throughout the dynamic transcription of a yeast glucose-repressible gene
The EMBO Journal (2004) 23, 127 137 & 2004 European Molecular Biology Organization All Rights Reserved 0261-4189/04 www.embojournal.org Roles of SWI/SNF and HATs throughout the dynamic transcription of
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
Gene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
SUPPLEMENTARY INFORMATION
doi:10.1038/nature23267 Discussion Our findings reveal unique roles for the methylation states of histone H3K9 in RNAi-dependent and - independent heterochromatin formation. Clr4 is the sole S. pombe enzyme
Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
Mannosylinositol phosphorylceramides and ergosterol coordinately maintain cell wall integrity in the yeast Saccharomyces cerevisiae
EDITOR S CHOICE Mannosylinositol phosphorylceramides and ergosterol coordinately maintain cell wall integrity in the yeast Saccharomyces cerevisiae Seiya Tanaka and Motohiro Tani Department of Chemistry,
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene YUELIN ZHANG, WEIHUA FAN, MARK KINKEMA, XIN LI, AND
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
Functional Antagonism between Sas3 and Gcn5 Acetyltransferases and ISWI Chromatin Remodelers
Functional Antagonism between Sas3 and Gcn5 Acetyltransferases and ISWI Chromatin Remodelers Anne Lafon 1,2, Emily Petty 1,2, Lorraine Pillus 1,2 * 1 Division of Biological Sciences, University of California
Synthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver
Dioxin induces Ahr-dependent robust DNA demethylation of the Cypa promoter via Tdg in the mouse liver Hesbon Z. Amenya, Chiharu Tohyama, Seiichiroh Ohsako Laboratory of Environmental Health Sciences, Center
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
MMS21 is a SUMO ligase that is a subunit of the Smc5/6
INVESTIGATION Mms21 SUMO Ligase Activity Promotes Nucleolar Function in Saccharomyces cerevisiae Dong-Hwan Kim,* Bethany Harris,* Fei Wang,* Chris Seidel,* Scott McCroskey,* and Jennifer L. Gerton*,,1
Problem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below.
Problem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below. 5 AUG ACC UGG AAU AAA UGA 3 Use that sequence to answer each of the questions below. a) What is the sequence
Recruitment of HBO1 Histone Acetylase and Blocks
Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin
Investigating The Effects of Glutathione and Other Key Proteins on Iron Homeostasis and Subcellular Redox Balance in Yeast Model Systems
University of South Carolina Scholar Commons Theses and Dissertations 2016 Investigating The Effects of Glutathione and Other Key Proteins on Iron Homeostasis and Subcellular Redox Balance in Yeast Model
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
SCIENTIFIC PROGRAM. 30 th Annual International Asilomar Chromatin & Chromosomes Conference
SCIENTIFIC PROGRAM 30 th Annual International Asilomar Chromatin & Chromosomes Conference December 11-14, 2008 Asilomar Conference Grounds Pacific Grove, CA Organizers: Mike Goldman, San Francisco State
Evaluating α-synuclein s Interaction with Cellular Phospholipids and Potential Toxicity in Yeast Models for Parkinson s Disease
Evaluating α-synuclein s Interaction with Cellular Phospholipids and Potential Toxicity in Yeast Models for Parkinson s Disease Lokesh Kukreja and Shubhik DebBurman Biology Department Lake Forest College
Chromatin Structure & Gene activity part 2
Chromatin Structure & Gene activity part 2 Figure 13.30 Make sure that you understand it. It is good practice for identifying the purpose for various controls. Chromatin remodeling Acetylation helps to
A high-throughput ChIP-Seq for large-scale chromatin studies
Article A high-throughput ChIP-Seq for large-scale chromatin studies Christophe D Chabbert,1, Sophie H Adjalley,1, Bernd Klaus 1, Emilie S Fritsch 1, Ishaan Gupta 1, Vicent Pelechano 1,* & Lars M Steinmetz
Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.
a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]
Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012
Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder
The Pennsylvania State University. The Graduate School. Eberly College of Science THE MANY FACETS OF HISTONE TAILS IN REGULATING TRANSCRIPTION
The Pennsylvania State University The Graduate School Eberly College of Science THE MANY FACETS OF HISTONE TAILS IN REGULATING TRANSCRIPTION A Dissertation in Biochemistry, Microbiology, and Molecular
Distinct roles for Sir2 and RNAi in centromeric heterochromatin nucleation, spreading and maintenance
The EMBO Journal (2013) 32, 1250 1264 www.embojournal.org Distinct roles for Sir2 and RNAi in centromeric heterochromatin nucleation, spreading and maintenance THE EMBO JOURNAL Alessia Buscaino 1, Erwan
STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
Localization of mrnas Encoding Peroxisomal Proteins in the Yeast Saccharomyces cerevisiae
Thesis for the degree Doctor of Philosophy Submitted to the Scientific Council of the Weizmann Institute of Science Rehovot, Israel By Gadi Zipor Localization of mrnas Encoding Peroxisomal Proteins in
University of Groningen. Origin and growth of peroxisomes in yeast Yuan, Wei
University of Groningen Origin and growth of peroxisomes in yeast Yuan, Wei IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
SVF1 regulates cell survival by affecting sphingolipid metabolism in. Saccharomyces cerevisiae
Genetics: Published Articles Ahead of Print, published on October 22, 2006 as 10.1534/genetics.106.064527 SVF1 regulates cell survival by affecting sphingolipid metabolism in Saccharomyces cerevisiae Jennifer
The Role of Cotranscriptional Histone Methylations
The Role of Cotranscriptional Histone Methylations S. BURATOWSKI AND T. KIM Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115 Correspondence:
Statistical Assessment of the Global Regulatory Role of Histone. Acetylation in Saccharomyces cerevisiae. (Support Information)
Statistical Assessment of the Global Regulatory Role of Histone Acetylation in Saccharomyces cerevisiae (Support Information) Authors: Guo-Cheng Yuan, Ping Ma, Wenxuan Zhong and Jun S. Liu Linear Relationship
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li,, Julien Sage, Xiaogang Li J Clin Invest. 2017;127(7):2751-2764. https://doi.org/10.1172/jci90921.
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
Very-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
The Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
SUPPLEMENTARY INFORMATION
DOI: 1.138/NPLANTS.215.17 A polarly localized transporter for efficient manganese uptake in rice Daisei Ueno 1, Akimasa Sasaki 2, Naoki Yamaji 2, Takaaki Miyaji 3, Yumi Fujii 1, Yuma Takemoto 1,2, Sawako
(Graduate school of Engineering, Department of Applied Chemistry & Biotechnology) 福井大学審査学位論文 [ 博士 ( 工学 ]
![(Graduate school of Engineering, Department of Applied Chemistry & Biotechnology) 福井大学審査学位論文 [ 博士 ( 工学 ]](/thumbs/93/113764278.jpg "(Graduate school of Engineering, Department of Applied Chemistry & Biotechnology) 福井大学審査学位論文 [ 博士 ( 工学 ]")
A Dissertation Submitted to the University of Fukui for the Degree of Doctor of Engineering (Graduate school of Engineering, Department of Applied Chemistry & Biotechnology) 福井大学審査学位論文 [ 博士 ( 工学 ] Characterization
Statistical Assessment of the Global Regulatory Role of Histone Acetylation in Saccharomyces cerevisiae
Statistical Assessment of the Global Regulatory Role of Histone Acetylation in Saccharomyces cerevisiae The Harvard community has made this article openly available. Please share how this access benefits
Functional annotation of farm animal genomes: ChIP-seq.
Functional annotation of farm animal genomes: ChIP-seq Richard Crooijmans 2018, PAGXXVI Richard.Crooijmans@wur.nl Why FAANG is important Understanding the genotype to phenotype link This needs: - genomic
Molecular mechanism of the priming by jasmonic acid of specific dehydration stress response genes in Arabidopsis
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in the Biological Sciences Papers in the Biological Sciences 2016 Molecular mechanism of the priming
High Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
Identification of Ftr1 and Zrt1 as iron and zinc micronutrient transceptors for activation of the PKA pathway in Saccharomyces cerevisiae
www.microbialcell.com Research Article Identification of Ftr1 and Zrt1 as iron and zinc micronutrient transceptors for activation of the PKA pathway in Saccharomyces cerevisiae Joep Schothorst 1,2, Griet
SUPPLEMENTARY INFORMATION
with metaphase spindles DOI: 1.1/ncb315 a 23 C 25 C 28 C 3 C Wild type cdc14-3 cdc5-1 cdc5-2 cdc14-3 cdc5-1 cdc14-3 cdc5-2 23 C 25 C 28 C 3 C Wild type cdc14-3 cdc14-3 23 C 25 C 28 C 3 C Wild type cdc5-1
Histone methylation has distinct dynamics from histone acetylation in cell cycle re-entry
MCB Accepts, published online ahead of print on 25 August 214 Mol. Cell. Biol. doi:1.1128/mcb.763-14 Copyright 214, American Society for Microbiology. All Rights Reserved. 1 2 Histone methylation has distinct
USING CENTRAL COMPOSITE DESIGNS - RESPONSE SURFACE METHODOLOGY TO OPTIMIZE INVERATSE ACTIVITY CONDITIONS FOR FRUCTOSE PRODUCTION
Conference proceedings of Biotechnology for Green Solutions and Sustainable Environment: 8-87, 010 USING CENTRAL COMPOSITE DESIGNS - RESPONSE SURFACE METHODOLOGY TO OPTIMIZE INVERATSE ACTIVITY CONDITIONS
The RSC Complex Localizes to Coding Sequences to Regulate Pol II and Histone Occupancy
Article The RSC Complex Localizes to Coding Sequences to Regulate Pol II and Histone Occupancy Marla M. Spain, Suraiya A. Ansari, 2 Rakesh Pathak, Michael J. Palumbo, 2 Randall H. Morse, 2 and Chhabi K.
Supplementary Information
Supplementary Information Precursors of trnas are stabilized by methylguanosine cap structures Takayuki Ohira and Tsutomu Suzuki Department of Chemistry and Biotechnology, Graduate School of Engineering,
Enantioselective synthesis of vicinal (R,R)-diols by yeast butanediol. Running title: Biotechnological applications of yeast Bdh1p.
AEM Accepted Manuscript Posted Online 4 January 2016 Appl. Environ. Microbiol. doi:10.1128/aem.03717-15 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 Enantioselective synthesis
Cover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/20360 holds various files of this Leiden University dissertation. Author: Eijk, Patrick van Title: Nucleotide excision repair in yeast Date: 2012-12-13
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Characterization And Identification Of Novel Regulators Of The Synthesis Of Phospholipids
Wayne State University Wayne State University Dissertations 1-1-2014 Characterization And Identification Of Novel Regulators Of The Synthesis Of Phospholipids Cunqi Ye Wayne State University, Follow this
Human cytomegalovirus (HCMV) belongs to the betaherpesvirus
The Cellular Protein SPT6 Is Required for Efficient Replication of Human Cytomegalovirus Daniel Cygnar, a Stacy Hagemeier, a * Daniel Kronemann, a and Wade A. Bresnahan a,b Department of Microbiology a
Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.
Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental
UNIVERSITY OF PÉCS. Biological and Sportbiological Doctoral School
UNIVERSITY OF PÉCS Biological and Sportbiological Doctoral School An investigation of the external stress induced by mycotoxin citrinin and the internal stress induced by the deletion of the ERG5 gene
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
ACT1 PACT1-RFP PFLO1-YFP
Saccharomyces cerevisiae Saccharomyces cerevisiae, FLO1 POL3 ACT1 P ACT1 -RFP P FLO1 -YFP P ACT1 i.e. SIR4 YJL070C sir4-100 scw11-e261* vps5-s520l, pet127- D650N whi2-r127* HBN1IDS2YJL070C HBN1IDS2
Yeast Rap1 contributes to genomic integrity by activating DNA damage repair genes
The EMBO Journal (008) 7, 575 58 & 008 European Molecular Biology Organization All Rights Reserved 06-89/08 www.embojournal.org Yeast Rap contributes to genomic integrity by activating DNA damage repair
SYNTHETIC LETHALITY AND SYNTHETIC CYTOTOXICITY STRATEGIES FOR SELECTIVE KILLING OF ATM DEFICIENT CELLS. Xuesong Li. B. Sc., Fudan University, 2005
SYNTHETIC LETHALITY AND SYNTHETIC CYTOTOXICITY STRATEGIES FOR SELECTIVE KILLING OF ATM DEFICIENT CELLS by Xuesong Li B. Sc., Fudan University, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
Heintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD,
Heintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD, Crawford, GE, Ren, B (2007) Distinct and predictive chromatin
Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
Supplemental Information. A Regulatory Network. of Drosophila Germline. Stem Cell Self-Renewal
Developmental Cell, Volume 28 Supplemental Information A Regulatory Network of Drosophila Germline Stem Cell Self-Renewal Dong Yan, Ralph A. Neumüller, Michael Buckner, Kathleen Ayers, Hua Li, Yanhui Hu,
Chapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures Campbell Biology: Concepts & Connections, Eighth Edition REECE TAYLOR SIMON DICKEY HOGAN Lecture by Edward J. Zalisko Introduction Well-preserved
MIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
Eukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
pirna pathway targets active LINE1 elements to establish the repressive H3K9me3markingermcells
pirna pathway targets active LINE1 elements to establish the repressive H3K9me3markingermcells Dubravka Pezic, 1,3 Sergei A. Manakov, 1,3 Ravi Sachidanandam, 2 and Alexei A. Aravin 1,4 1 Division of Biology
Gene promoters dictate histone occupancy within genes
The EMBO Journal (3) 3, 645656 www.embojournal.org Gene promoters dictate histone occupancy within genes THE EMBO JOURNAL Roberto Perales,, Benjamin Erickson, Lian Zhang, Hyunmin Kim, Elan Valiquett and
A Targeted Bypass Screen Identifies Ynl187p, Prp42p, Snu71p, and Cbp80p for Stable U1 snrnp/pre-mrna Interaction
MOLECULAR AND CELLULAR BIOLOGY, July 2009, p. 3941 3952 Vol. 29, No. 14 0270-7306/09/$08.00 0 doi:10.1128/mcb.00384-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. A Targeted
Proteins: Proteomics & Protein-Protein Interactions Part I
Proteins: Proteomics & Protein-Protein Interactions Part I Jesse Rinehart, PhD Department of Cellular & Molecular Physiology Systems Biology Institute DNA RNA PROTEIN DNA RNA PROTEIN Proteins: Proteomics
A Quantitative, High-Throughput Reverse Genetic Screen Reveals Novel Connections between Pre mrna Splicing and 59 and 39 End Transcript Determinants
A Quantitative, High-Throughput Reverse Genetic Screen Reveals Novel Connections between Pre mrna Splicing and 59 and 39 End Transcript Determinants Laura-Oana Albulescu, Nevin Sabet, Mohanram Gudipati,
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
UCLA UCLA Electronic Theses and Dissertations
UCLA UCLA Electronic Theses and Dissertations Title Identification of new RNA substrates for the NMD and exosome RNA surveillance pathways in Saccharomyces cerevisiae Permalink https://escholarship.org/uc/item/32p4t1vq
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/8/e1701143/dc1 Supplementary Materials for Impaired DNA replication derepresses chromatin and generates a transgenerationally inherited epigenetic memory Adam
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student