Mobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin

Size: px
Start display at page:

Download "Mobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin"

Transcription

1 Obesity Research Laboratory Institut Universitaire de France Franco-Czech Laboratory for Clinical Research on Obesity Mobilisation des lipides du tissu adipeux et insulinorésistance Dominique Langin Séminaire Pédagogique CNBBMM, Anglet, 215

2 Storage and mobilization of fat in adipocyte After a meal (high insulin levels): fat storage In case of energy needs (low insulin levels): mobilization of fat (adipose tissue lipolysis) Fatty acids Storage Triglycerides Mobilization Fatty acids Muscle Liver

3 Storage and mobilization of fat in adipocyte Triglycerides LPL Fatty acids Esterification Triglycerides Glycerol 3-phosphate Lipolysis Glut4 Fatty Acids + Glycerol To liver, muscle To liver

4 Coordination of the regulation of fat deposition and fat mobilization in white adipose tissue After a meal Triglycerides LPL FAT, Energy needs Gut + Glycerol 3-phophate Fatty acids Esterification + Triglycerides - Catecholamines + ANP, BNP Lipases Pancreas Glut4 Insulin + Fatty Acids + Glycerol To liver, muscle, heart To liver

5 Human adipose tissue lipolysis Insulin receptor Natriuretic peptide receptor A GC PI3-K PKB cgmp MGL PLINA β 1/2 -AR PDE-3B camp 5 AMP PKG PKA HSL TG CGI58 ATGL GS2 Antilipolytic GPCRs (GPR19A, GPR81, ) Prog Lipid Res 29 48: Trends Endocrinol Metab :

6 Insulin action on glucose metabolism Insulin Insulin stimulates glucose uptake in skeletal muscle and inhibits glucose production by the liver. The uptake of glucose in adipose tissue is quantitatively minor but has major systemic effect on insulin sensitivity.

7 Insulin resistance : an obesity-associated metabolic status X Insulin X X Resistance to the action of insulin uptake in skeletal muscle, liver and adipose tissue leads to compensatory hyperinsulinemia.

8 Type 2 diabetes X X X Insulin X Pancreatic b cell failure combined to insulin resistance results in type 2 diabetes.

9 Role of fatty acids and others products of adipose tissue in the appearance of insulin resistance Adipose tissue in excess releases lipids (fatty acids and others) and proteins in blood circulation Insulin does not inhibit glucose production Liver Lipids Proteins Insulin resistance Muscle Insulin does not stimulate glucose use Diabetes Cardiovascular diseases

10 Adipose tissue infiltration by macrophages in obesity

11 Role of fatty acids, lipokines and adipokines in the genesis of obesity complications Immune response Fibrosis Adipocyte dysfunction & death Cell Rep 214 7: FFA / Lipokines / Adipokines Thrombosis Hyperlipidemia NASH production utilization intolerance Insulin resistance Insulinemia Myocardial performance OBESITY COMPLICATIONS

12 Approaches to medical research in human obesity Clinical studies Mouse models Cell lines and primary cultures - In vivo : metabolism and body composition - Ex vivo and in vitro : work on adipose tissue (and other tissue) samples - Transgenic models - Kinetics studies - In vivo : metabolism and body composition - Ex vivo and in vitro : work on adipose tissue (and other tissue) samples - Many human and animal models - Cell lines vs. Primary cultures - Metabolic and signaling pathways - Protein overexpression and gene silencing

13 log HOMA-IR log HOMA-IR Insulin sensitivity and basal lipolysis in humans (glycerol release from adipose tissue explants) Cohort crosssectional study log lipolysis r=.3 p=.1 r=.3 p=.2 log lipolysis Bariatric surgery longitudinal follow up Increased lipolysis is associated with increased insulin resistance PLoS Biol :e11485

14 Putative consequences of low lipolysis in human obesity Trends Endocrinol Metab :

15 Which mouse models to investigate the relationship between adipose tissue lipolysis and insulin sensitivity in human obesity? HSL-/- WT ATGL-/- - Impaired weight gain on high fat diet! - Impaired adipogenesis due to defect in PPARg ligand production - WAT with a brown fat-like phenotype - Marked inflammation of WAT - Increased weight gain on high fat diet - Defect in thermogenesis - BAT with a white fat-like phenotype - Defect in PPARa ligand production premature death from cardiac dysfunction HSL and ATGL null mice are not appropriate models

16 Energy expenditure kcal/day Fat mass (%of body weight) HSL haploinsufficient mice fed high fat diet : a model of partial lipolysis deficiency in obesity (Western blot, lipase activity, in vitro and in vivo lipolysis, EchoMRI, fat pad mass, adipose tissue histology, in vitro adipogenesis, food intake, indirect calorimetry) Wild type mice HSL +/- mice HSL 1 WT HSL +/- HSL O 2 CO Decreased lipolytic capacity No difference in body weight compared to wild type No change in fat mass, weights of adipose tissue depots and adipogenesis capacity No difference in food intake and energy expenditure Day Night O 2 CO 2 PLoS Biol :e11485

17 Adipose tissue immune response and lipolysis inhibition WT (RT-qPCR, flow cytometry, conditioned media) Macrophage and inflammatory marker gene expression HSL +/- WT TG HSL FA HSL +/-? Macrophage number TG HSL FA Adipose tissue inflammation is not altered by HSL inhibition

18 Glycerol (µm) Emr1 mrna levels CD45 and F4/8 positive cells (fold change) Adipose tissue immune response and lipolysis stimulation (human adipocytes and macrophages, TLR4 mutant mice) *** $$$ ** $$ Vehicle HSLi WT TLR4 mut WT TLR4 mut WT TLR4 mut FA FA X TLR4 TG Interleukins FA X Chemiokines Cytokines Dietary and de novo lipogenesis-derived fatty acids do not activate macrophages but promote storage of lipids

19 µmol palmitate/kg/min Lipid metabolism in HSL haploinsufficient mice fed high fat diet ( 14 C-palmitate turnover) Wild type mice HSL +/- mice TG HSL FA TG oxidation TG TG * *** *** WT HSL +/- HSL TG FA TG oxidation TG TG Oxidation Storage Turnover Decreased fatty acid turnover : decreased lipolysis decreased storage and oxidation Decreased triacylglycerol content in skeletal muscle, liver and heart

20 pirs1tyr612/irs1 (arbitrary unit) pakt Ser473/Akt (arbitrary unit) (g/l) metabolism in high fat diet-fed mice with lower HSL activity (insulin, glucose and pyruvate tolerance tests; respiratory quotient; in vivo 14 C-2 deoxyglucose uptake; skeletal muscle glucose oxidation, liver insulin signaling, liver de novo lipogenesis) Wild type mice Glc oxidation insulin * * Time (min) HFD NCD WT HSL +/- HSL +/- mice Glc oxidation insulin Saline Insulin * 1.5 ** WT HSL +/- WT HSL +/- Increased use of carbohydrates, glucose uptake and glucose oxidation Increased insulin and glucose tolerance in mice with decreased lipolysis. Improvement of insulin action in skeletal muscle and liver

21 Effect of a selective HSL inhibitor on insulin tolerance in obese mice (g/l) AUC (a.u.) Body weight (g) Triolein hydrolysis (%) % of basal glucose AUC (a.u.) Insulin 15 min (ng/ml) 12 Cos7 cells 8 4 Chemical structure of HSLi Basal HSLi HSL Basal HSLi ATGL High fat diet-fed mice Lepr db / Lepr db mice ** Time (min) Fat mass Lean mass %of body weight Vehicle HSLi Time (min) * Body weight (g)4 Chronic pharmacological inhibition of HSL improves insulin action without affecting body weight.

22 metabolism in adipose tissue and systemic insulin action B. Kahn s lab Insulin K. Frayn s lab RBP4 Lipokines? RBP4 Lipokines? ChREBP DNL Compared to control mice, plasma RBP4 levels are no modified in HSL +/- and HSLi-treated mice.

23 carbon incorporation in fatty acids uptake WAT sirna-mediated knockdown of HSL in human adipocytes (glucose uptake, glucose and fatty acid oxidation, de novo lipogenesis) sigfp (control cells) Insulin Glycerol-3-P Triacylglycerol HSL Glycerol Fatty acid Fatty acid sigfp sihsl Basal sigfp sihsl Basal * Insulin * Insulin sihsl Insulin Glycerol-3-P Triacylglycerol HSL Glycerol Fatty acid Fatty acid Decreased lipolysis decreased fatty acid oxidation Increased glucose uptake and de novo lipogenesis

24 Upregulation of glycolysis and de novo lipogenesis genes in human adipocytes (DNA microarray, RTqPCR) Upregulation of glucose transporter 4 Other genes are known targets of the lipogenic transcription factor ChREBP

25 De novo lipogenesis and lipolytic capacity in humans (DNA microarray, glycerol release from adipose tissue explants) transporter 4 gene expression is negatively associated with lipolysis as are the lipogenic transcription factor ChREBP and fatty acid synthase

26 Chronic inhibition of adipocyte lipolysis and de novo lipogenesis gene expression in humans (isolated adipocytes, RTqPCR) Eight week treatment with the antilipolytic drug, nicotinic acid, upregulates de novo lipogenesis mrna levels in adipocytes from obese men

27 The improvement in glucose flux and intracellular fate is (at least partially) dependent on ChREBP sirna-mediated knockdown of HSL and ChREBP in human adipocytes (glucose uptake, glucose oxidation, de novo lipogenesis) uptake GLUT4 gene expression oxidation De novo lipogenesis

28 De novo lipogenesis? Liver Triglycerides Lipolysis Fatty acids Insulin resistance Muscle The inhibition of fat mobilization (lipolysis) by fat cells decreases insulin resistance by increasing de novo lipogenesis De novo lipogenesis Triglycerides Lipolysis? Fatty acids Restoration of insulin sensitivity Liver Muscle

29 New class of lipids : derivatives of hydroxy fatty acids OAHFAs: (O-acyl)- -hydroxy fatty acids OA HPA Stabilization of meibomian lipid films (a.k.a. tear films) FAHFAs : fatty acid esters of hydroxy fatty acids

30 Putative role of FAHFAs Yore et al. 214 Cell 159:

31 Conclusion Insulin? DNL? Adipokines Liver TG? Lipolysis Lipokines NEFA Restoration of insulin sensitivity Muscle Deciphering the cell autonomous (intracellular and/or paracrine) and endocrine mechanisms of insulin sensitivity improvement induced by lipolysis inhibition.

32 Marianne Houssier Pauline Morigny Amandine Girousse Sylvie Caspar-Bauguil Isabelle Vila Geneviève Tavernier Valentin Barquissau Diane Beuzelin Carine Valle Corinne Lefort Marie-Adeline Marques Catherine Koldtitz Aline Mairal Laurent Monbrun Etienne Mouisel Nathalie Viguerie Cédric Moro Peter Arner, Stockholm Rudolf Zechner, Graz Catherine Postic, Paris Mikael Ryden, Stockholm Stefan Hallen, Göteborg Anne Bouloumié, Toulouse Cecilia Holm, Lund Thierry Sulpice, Toulouse Hervé Guillou, Toulouse Jacques Grober, Dijon Lenka Rossmeislova, Prague Vladimir Stich, Prague AstraZeneca

Reviewer #1 (Remarks to the Author)

Reviewer #1 (Remarks to the Author) Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.

More information

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first? 7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre

More information

The art of tracing dietary fat in humans. Leanne Hodson

The art of tracing dietary fat in humans. Leanne Hodson The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:

More information

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia

More information

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Endocrine regulation of lipid mobilization in human obesity: unraveling the role of atrial natriuretic peptide

Endocrine regulation of lipid mobilization in human obesity: unraveling the role of atrial natriuretic peptide 2017 Faculty of Medicine and Life Sciences Doctoral dissertation submitted to obtain the degrees of - Doctor of Biomedical Sciences UHasselt - Doctor Universiteit Maastricht Kenneth Verboven DOCTORAL DISSERTATION

More information

Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.

Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of. Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis

More information

Author's personal copy

Author's personal copy Clinica Chimica Acta 383 (2007) 1 20 www.elsevier.com/locate/clinchim Abstract Invited critical review Oxidative mechanisms at rest and during exercise Edouard Ghanassia, Jean-Frédéric Brun, Jacques Mercier,

More information

patient-oriented and epidemiological research

patient-oriented and epidemiological research patient-oriented and epidemiological research Adipocyte triglyceride turnover and lipolysis in lean and overweight subjects Mikael Rydén, * Daniel P. Andersson, * Samuel Bernard, Kirsty Spalding, and Peter

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Importance of TNFa and neutral lipases in human adipose tissue lipolysis

Importance of TNFa and neutral lipases in human adipose tissue lipolysis Review TRENDS in Endocrinology and Metabolism Vol.17 No.8 Importance of TNFa and neutral lipases in human adipose tissue lipolysis Dominique Langin 1,2,3,4 and Peter Arner 5 1 Inserm, U586, Unité de Recherches

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Obesity in aging: Hormonal contribution

Obesity in aging: Hormonal contribution Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

Abstract. Regulation of Lipolysis By Perilipin: Influence of Obesity and Exercise Training. By: Emily Ann Johnson. June 2010

Abstract. Regulation of Lipolysis By Perilipin: Influence of Obesity and Exercise Training. By: Emily Ann Johnson. June 2010 Abstract Regulation of Lipolysis By Perilipin: Influence of Obesity and Exercise Training By: Emily Ann Johnson June 2010 Director: Robert C. Hickner Department of Exercise and Sport Science Obesity is

More information

Molecular Mechanisms associated with the Cancer-Cachexia Syndrome

Molecular Mechanisms associated with the Cancer-Cachexia Syndrome Molecular Mechanisms associated with the Cancer-Cachexia Syndrome Prof. Dr. Josep M. Argilés Department of Biochemistry & Molecular Biology University of Barcelona, Spain Disclosures: DANONE (Scientific

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

STUDIES ON NOVEL INTERACTORS IN HUMAN ADIPOSE TISSUE

STUDIES ON NOVEL INTERACTORS IN HUMAN ADIPOSE TISSUE From the Department of Medicine, Huddinge Karolinska Institutet, Stockholm, Sweden STUDIES ON NOVEL INTERACTORS IN HUMAN ADIPOSE TISSUE Amanda T. Pettersson Stockholm 2011 All previously published papers

More information

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

Interplay between FGF21 and insulin action in the liver regulates metabolism

Interplay between FGF21 and insulin action in the liver regulates metabolism Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan

More information

Master class Biomolecular Sciences Molecular Cell Biology.

Master class Biomolecular Sciences Molecular Cell Biology. Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track

More information

Intermediary metabolism. Eva Samcová

Intermediary metabolism. Eva Samcová Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Bachelorarbeit Fructose and weight gain

Bachelorarbeit Fructose and weight gain Bachelorarbeit Fructose and weight gain Bogner-Strauß, Juliane Gertrude, Assoc.Prof. Mag.rer.nat. Dr.rer.nat. Von Johanna Maria Ticar Mat: 0730208 Graz, 27.07.2011 Abstract The prevalence of obesity is

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

* Author to whom correspondence should be addressed; Tel.: ; Fax:

* Author to whom correspondence should be addressed;   Tel.: ; Fax: Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:

More information

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers

More information

Energy metabolism - the overview

Energy metabolism - the overview Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism

More information

Physical activity and exercise in the regulation of adipose mass and function

Physical activity and exercise in the regulation of adipose mass and function Physical activity and exercise in the regulation of adipose mass and function Key Questions What is the impact of exercise on adipose and fat metabolism? To what extent does exercise and physical activity

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

More information

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

For more information about how to cite these materials visit

For more information about how to cite these materials visit Author(s): Arno Kumagai, M.D., 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Noncommercial Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

Adipose Tissue, Inter-Organ Communication, and the Path to Type 2 Diabetes: The 2016 Banting Medal for Scientific Achievement Lecture

Adipose Tissue, Inter-Organ Communication, and the Path to Type 2 Diabetes: The 2016 Banting Medal for Scientific Achievement Lecture Diabetes Volume 68, January 2019 3 Adipose Tissue, Inter-Organ Communication, and the Path to Type 2 Diabetes: The 2016 Banting Medal for Scientific Achievement Lecture Barbara B. Kahn Diabetes 2019;68:3

More information

What systems are involved in homeostatic regulation (give an example)?

What systems are involved in homeostatic regulation (give an example)? 1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS (Diabetes Mellitus Part 1): An Overview

More information

298 Biomed Environ Sci, 2015; 28(4):

298 Biomed Environ Sci, 2015; 28(4): 298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS An Overview WHAT IS HOMEOSTASIS? Homeostasis

More information

Adipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA

Adipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA Adipose tissue: Roles and function in diabetes and beyond August 2015; SAGLB.DIA.15.07.0398 Acknowledgement The following slides intend to summarise the key points presented during the Banting Medal for

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

THE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE

THE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE Thesis for licentiate degree 2010 Thesis for licentiate degree 2010 THE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE THE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE Anna Eriksson Anna Eriksson From

More information

Integrative Metabolism: Significance

Integrative Metabolism: Significance Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

More information

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic

More information

DOWNLOAD PDF ADIPOSE TISSUE AND ADIPOKINES IN HEALTH AND DISEASE (NUTRITION AND HEALTH)

DOWNLOAD PDF ADIPOSE TISSUE AND ADIPOKINES IN HEALTH AND DISEASE (NUTRITION AND HEALTH) Chapter 1 : Adiposity, Adipokines, and Adiposopathy - Sick Fat Explained Adipose Tissue and Adipokines in Health and Disease, Second Edition is a useful resource for physicians interested in adipose tissue

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

READ THESE INSTRUCTIONS!

READ THESE INSTRUCTIONS! READ THESE INSTRUCTIONS! A. Please write your name at the top of this page, and on the Scantron sheet; fill in your student ID on the Scantron form. B. Make sure you fill in the exam letter (under your

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

HSN301 Diet and Disease Entire Note Summary

HSN301 Diet and Disease Entire Note Summary Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Association of serum adipose triglyceride lipase levels with obesity and diabetes

Association of serum adipose triglyceride lipase levels with obesity and diabetes Association of serum adipose triglyceride lipase levels with obesity and diabetes L. Yang 1 *, S.J. Chen 1 *, G.Y. Yuan 1, L.B. Zhou 2, D. Wang 1, X.Z. Wang 1 and J.J. Chen 1 1 Department of Endocrinology,

More information

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary Published in "" which should be cited to refer to this work. Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas http://doc.rero.ch Laboratory of Metabolic Stress Biology, Division

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,

More information

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle

More information

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

902 Biomed Environ Sci, 2014; 27(11):

902 Biomed Environ Sci, 2014; 27(11): 902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type

More information

Changes in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss. Robert Lawrence Bowers

Changes in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss. Robert Lawrence Bowers Changes in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss by Robert Lawrence Bowers A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Metabolic integration and Regulation

Metabolic integration and Regulation Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

MBB317. Dr D MANGNALL OBESITY. Lecture 2

MBB317. Dr D MANGNALL OBESITY. Lecture 2 MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Week 3 The Pancreas: Pancreatic ph buffering:

Week 3 The Pancreas: Pancreatic ph buffering: Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information