Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
|
|
|
- Abraham Mathews
- 5 years ago
- Views:
Transcription
1 Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra
2 Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates of Obesity among Adults aged 2 years 24 County-level Estimates of Diagnosed Diabetes among Adults aged 2 years 24 County-level Estimates of Obesity among Adults aged 2 years 28 County-level Estimates of Diagnosed Diabetes among Adults aged 2 years 28 Percent Percent
3 Adipose tissue inflammation Macrophage influx into the adipose tissue High Fat Diet Low Fat Diet 1x 1x Evan D. Rosen and Bruce M. Spiegelman,26, Nature
4 The pro-inflammatory cytokine IL-1β and Type 2 Diabetes Current knowledge IL-1β inhibits insulin signaling IL-1β negatively affects pancreatic β-cell function Elevated levels of interleukin-1β (IL-1β) are predictive of Type 2 Diabetes Inhibition of the IL-1 signalling cascade by treatment with IL-1 receptor antagonist is beneficial in patients with Type 2 Diabetes and leads to reduced markers of systemic inflammation
5 The NLRP3-inflammasome controls IL-1β release Signal 2 NLRP3 ASC Caspase-1 Signal 1
6 Is caspase-1 present in adipose tissue and regulated during obesity? 45 kda Caspase-1 Diet-induced obesity Genetically-induced obesity Note: no increase in caspase-1 gene expression levels in liver or muscle
7 Caspase-1 activation in adipose tissue is accompanied by increased levels of IL-1β Low Fat Diet High Fat Diet Inactive Active Actin Does inflammasome-mediated caspase-1 activity contribute to the development of obesity-induced adipose tissue inflammation and insulin resistance?
8 High fat diet-induced obesity in NLRP3-/-, ASC-/-, Casp-1-/- animals NLRP3 ASC Caspase-1 Bodyweight (% of initial) 3 2 *** 3 2 *** 3 2 *** 1 WT NLRP3-/ Time (wks) 1 WT ASC-/ Time (wks) 1 WT Casp1-/ Time (wks)
9 Plasma levels of adipokines and insulin Leptin Insulin Resistin Plasma concentration (pg/ml) LFD HFD *** *** LFD ** HFD ** ** LFD HFD ** ** ** Adipose tissue mass Insulin resistance Adipocyte inflammation
10 Adipose tissue inflammation in HFD-fed wild-type and caspase-1-/- animals Wildtype-HFD casp-1-/-hfd 1x 1x Protection against the influx of macrophages paralleled by reduced levels of the chemoattractant MCP-1
11 Does the absence of caspase-1 improves systemic insulin sensitivity? Hyperinsulinemic euglycemic clamp study in HFD-fed Wild-type and caspase-1-/- animals Approach: Infusion of high levels of insulin together with infusion of glucose to keep plasma glucose at a normal level during the clamp procedure Readout: glucose infusion rate (GIR) Low infusion rate: insulin resistant High infusion rate: insulin sensitive GIR (μl min -1 kg -1 ) Time (minutes) * * Casp1 -/- WT
12 Inhibition of caspase-1 in obese and insulin resistant animals? Daily treatment with caspase-1 inhibitor Pralnacasan Two weeks ITT test Bodyweight development Ob/ob mouse Obese Insulin resistant High levels of caspase-1 in adipose tissue
13 Insulin sensitivity is robustly improved in Ob/Ob animals after 2 weeks of caspase-1 inhibition Plasma glucose (mmol/l) Control group Inhibitor group ** ** ** * Insulin Time (minutes)
14 Caspase-1 inhibition limits bodyweight gain Bodyweight change (%) Control group Inhibitor group ** 3 2 *** 1 WT Casp1-/ Days of treatment Time (Weeks) Inhibition or absence of caspase-1 prevents weight gain > mechanism?
15 Food intake and intestinal absorption Food intake (g) WT-HFD Casp1 -/- HFD Time plasma 3 H activity (dpm) 5 caspase-1-/ Wild-type Time (h) Kilo joule/g feces
16 Energy expenditure is enhanced in the absence of caspase-1 EE (kcal *h -1 ) WT Casp1 -/- EE (kcal *h -1 ).9 WT Casp1 -/- * N D N D.4 Night Day Note: overall activity levels were similar in both genotypes Inhibition/absence of caspase-1 No change in food intake or intestinal absorption Enhanced energy expenditure Therapeutic target in the treatment of obesity and insulin resistance?
17 The inflammasome and caspase-1 in human adipose tissue Tran, T. T. & Kahn, C. R. (21) Transplantation of adipose tissue and stem cells: role in metabolism and disease Nat. Rev. Endocrinol. The location is important: Increased visceral adipose tissue is associated with adverse health risks including insulin resistance, type 2 diabetes mellitus, dyslipidemia, hypertension, atherosclerosis and hepatic steatosis.
18 IL-1β secretion by human VAT vs. SAT? Ex-vivo: adipose tissue explant culture (24 hrs) From five mildly obese subjects (BMI: kg/m 2 ; aged 4-6 yrs) IL-1β secretion (pg/ml/gr WAT) IL-1β TNFα secretion (pg/ml/gr WAT) TNFα
19 Caspase-1 activity is enhanced in human VAT compared to SAT caspase-1 activity assay
20 Inhibition of caspase-1 specifically inhibits IL-1β production by VAT Ex-vivo: AT explant culture (24 hrs) + or caspase-1 inhibitor Pralnacasan From five mildly obese subjects (BMI: kg/m 2 ; aged 4-6 yrs) IL-1β secretion (pg/ml/gr WAT) IL-1β TNFα secretion (pg/ml/gr WAT) TNFα
21 Summary Caspase-1 is activated in adipose tissue of obese and insulin resistant animals leading to increased levels of IL-1β in adipose tissue Absence of caspase-1 protects against the development of diet-induced obesity and insulin resistance Inhibition of caspase-1 in obese animals improves insulin sensitivity and limits weight gain Caspase-1-/- animals display enhanced levels of energy expenditure Visceral adipose tissue of mildly obese individuals is characterized by enhanced caspase-1 activity levels and higher production of IL-1β as compared to subcutaneous adipose tissue
22 Future perspective Identification of potential triggers of inflammasome activation
23 Conclusion Inflammasome-mediated caspase-1-activity represents an attractive therapeutic target in the treatment of obesity-induced insulin resistance
24 Acknowledgements -Tim Koenen -Anneke Hijmans -Leo Joosten -Mihai Netea -Cees Tack -Janna van Diepen -Irene Vroegrijk -Peter Voshol -Patrick Rensen Dutch Diabetes Research Foundation -Thirumala Devi-Kanneganti -Sander Kersten -Michael Müller -Guido Hooiveld
HHS Public Access Author manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2014 November 01.
Lower NLRP3 Inflammasome activity in NAG-1 transgenic mice is linked to a resistance to obesity and increased insulin sensitivity Xingya Wang 1, Kali Chrysovergis 1, Justin Kosak 1, and Thomas E. Eling
Inflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
Adipose tissue dysfunction in obesity. Gijs Goossens, PhD
Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre
Activation of Proteinase 3 Contributes to Nonalcoholic Fatty Liver Disease and Insulin Resistance
Activation of Proteinase 3 Contributes to Nonalcoholic Fatty Liver Disease and Insulin Resistance Erik JM Toonen, 1 * Andreea-Manuela Mirea, 1 Cees J Tack, 1 Rinke Stienstra, 1,2 Dov B Ballak, 1 Janna
3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
![3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.](/thumbs/82/84935173.jpg "3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.")
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
The Inflammasome-Mediated Caspase-1 Activation Controls Adipocyte Differentiation and Insulin Sensitivity
Article The Inflammasome-Mediated Caspase-1 Activation Controls Adipocyte Differentiation and Insulin Sensitivity Rinke Stienstra, 1, * Leo A.B. Joosten, 1,6 Tim Koenen, 1 Berry van Tits, 1 Janna A. van
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
PDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/156941
Exploring the link between gut microbiota and metabolic health
Food Matters Live, Nov 21-23 rd, London Exploring the link between gut microbiota and metabolic health Ellen Blaak Professor in Physiology of fat metabolism, Department of Human Biology NUTRIM School of
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
Start of insulin therapy in patients with type 2 diabetes mellitus promotes the influx of macrophages into subcutaneous adipose tissue
Diabetologia (2013) 56:2573 2581 DOI 10.1007/s00125-013-3018-6 ARTICLE Start of insulin therapy in patients with type 2 diabetes mellitus promotes the influx of macrophages into subcutaneous adipose tissue
Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희
Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies
Roadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total
Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors
Tissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
HSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
![TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]](/thumbs/89/99233308.jpg "TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]")
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary
Published in "" which should be cited to refer to this work. Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas http://doc.rero.ch Laboratory of Metabolic Stress Biology, Division
LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES
LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES A THESIS SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA
Empower Preventive Medicine. Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL
Empower Preventive Medicine Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL 32217 904-367-4005 Drtim@emprevmed.com Obesity Medicine Old paradigm: Obesity was a matter of willpower,
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
METABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing
METABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat
Mary-Kate Perrone Capstone Seminar July 14, 2007 Draft #2 Fat Stats FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat According to the 2003-2004
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
Tomasz J Guzik. Diabetes, perivascular adipose tissue and inflammation.
Tomasz J Guzik Diabetes, perivascular adipose tissue and inflammation. Translational Research Laboratory Department of Internal and Agricutural Medicine Jagiellonian University School of Medicine Cracow,
Obesity mediated hypertension and renal dysfunction
Obesity mediated hypertension and renal dysfunction Gergely Bodor Marion Hervouet Nicky Honnef Mariarosaria Malgadi Julie Robert Tutor: Pr Alina Parvu Objectives 1. Introduction 2. Renal structural and
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
Reviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Targeting Inflammation in Breast Cancer Pathogenesis
Targeting Inflammation in Breast Cancer Pathogenesis Clifford Hudis, M.D. Chief, Breast Cancer Medicine Service Attending Physician, MSKCC Professor of Medicine, Weill Cornell Medical College August 7,
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Getting Ahead of the Curve in the Trouble with Fat
Getting Ahead of the Curve in the Trouble with Fat Zhaoping Li, M.D., Ph.D. Professor of Medicine David Geffen School of Medicine, UCLA VA Greater Los Angeles Health Care System Obesity Pandemic Predicted
Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption
Diabetes in Asian Americans
Diabetes in Asian Americans www.screenat23.org Winston F. Wong, MD National Council of Asian Pacific Islander Physicians www.ncapip.org American Diabetes Association Joslin Diabetes Center National Council
Targeting Adipose Tissue in Rheumatoid Arthritis TARA study HOFFA L SCAPTIPL 0.1013606 0.270906 0.3759505 0.3373511 0.4050987 0.404667 11.6 DISCUSSIONS The study targeted the serum levels of adipokines
The true cost of inpatient obesity impact on inflammatory stress and morbidity.
The true cost of inpatient obesity impact on inflammatory stress and morbidity. Professor Bob Grimble, Institute of Human Nutrition, Institute of Developmental Sciences Building, University of Southampton
Adipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA
Adipose tissue: Roles and function in diabetes and beyond August 2015; SAGLB.DIA.15.07.0398 Acknowledgement The following slides intend to summarise the key points presented during the Banting Medal for
UMHS-PUHSC JOINT INSTITUTE
Role of Visceral Adiposity in the Pathogenesis of Non-Alcoholic Fatty Liver Disease in Lean versus Obese Patients: A Comparative Study between Patients at UMHS versus PUHSC Lai WEI and Anna LOK W Zhang,
Body Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)
Clinical Role of Inflammation in Metabolic Diseases
Clinical Role of Inflammation in Metabolic Diseases Won-Young Lee Department of Endocrinology and Metabolism Kangbuk Samsung Hospital Sungkyunkwan University Medical School, Seoul, Korea (2009-Nov-19)
R. Leibel Naomi Berrie Diabetes Center 19 March 2010
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Body Mass Index Chart 25-29.9 29.9 = overweight; 30-39.9= 39.9 obese; >40= extreme obesity 5'0" 5'2" 52
Metabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
NAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?
7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
Chapter 1, Part A: Biological background of obesity, insulin resistance and dyslipidemia
General introduction The introduction to this thesis consists of two parts. The first part gives an overview of the current concepts and developments regarding obesity and insulin resistance, as well as
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Obesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
Inflammation: How to Cool the Fire Inside your Gut? REINVENTING DIAGNOSTICS
Inflammation: How to Cool the Fire Inside your Gut? REINVENTING DIAGNOSTICS Future of Healthcare REINVENTING DIAGNOSTICS Inflammation Gut Inflammation Basis of a Healthy
The Relationship between Dietary Fatty Acids and Inflammatory Genes on the Obese Phenotype and Serum Lipids
Nutrients 2013, 5, 1672-1705; doi:10.3390/nu5051672 Review OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journal/nutrients The Relationship between Dietary Fatty Acids and Inflammatory Genes on the
Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity
Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice
ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.
AECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA
INCB013739, a Selective Inhibitor of 11β-Hydroxysteroid Dehydrogenase Type 1 (11βHSD1), Improves Insulin Sensitivity and Lowers Plasma Cholesterol Over 28 Days in Patients with Type 2 Diabetes Mellitus
Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Are anti-inflammatory drugs an appropriate option for treating obesity?
Boston University OpenBU Theses & Dissertations http://open.bu.edu Boston University Theses & Dissertations 2013 Are anti-inflammatory drugs an appropriate option for treating obesity? Andreucci, Amy Jada
Energy balance. Factors affecting energy input. Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain
1 Energy balance Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain Special implications Infancy, Illness, Pregnancy & Lactation, Sports Factors affecting energy input neuro-endocrine
Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119
Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk
Metabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
Research Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus
ISRN Biomarkers, Article ID 952636, 5 pages http://dx.doi.org/10.1155/2014/952636 Research Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus
FAPESP Week /21/2017
Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr
Effects of short-term exercise training on intestinal metabolism and gut microbiota
Effects of short-term exercise training on intestinal metabolism and gut microbiota Kumail K. Motiani M. Carmen Collado, Joonas J. Eskelinen, Kirsi A. Virtanen, Eliisa Löyttyniemi, Seppo Salminen, Pirjo
Thrombin promotes diet-induced obesity through fibrin-driven inflammation
Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,
Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Energy balance. Factors affecting energy input. Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain
1 Energy balance Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain Special implications Infancy, Illness, Pregnancy & Lactation, Sports Factors affecting energy input neuro-endocrine
Brian Francis Zamarron
Metabolic Abnormalities and Adipose Tissue Leukocyte Dynamics in a Murine Model of Obesity, Weight Loss, and Weight Regain By Brian Francis Zamarron A dissertation submitted in partial fulfillment of the
Diabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs
Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,
Regulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway
Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )
Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
The Reduced Obese State: The Challenge of Weight Maintenance 2011 Annual CAN Conference November 17, 2011
The Reduced Obese State: The Challenge of Weight Maintenance 2011 Annual CAN Conference November 17, 2011 Robert H. Eckel, M.D. Professor of Medicine Professor of Physiology and Biophysics Charles A. Boettcher
Paul Hofman. Professor. Paediatrician Endocrinologist Liggins Institute, The University of Auckland, Starship Children Hospital, Auckland
Professor Paul Hofman Paediatrician Endocrinologist Liggins Institute, The University of Auckland, Starship Children Hospital, Auckland 9:25-9:50 Endocrine and Metabolic Consequences of Being Born Preterm
Interactions of metabolic challenges with fertility in dairy cows
Interactions of metabolic challenges with fertility in dairy cows Geert Opsomer Department of Reproduction, Obstetrics and Herd Health Faculty of Veterinary Medicine Ghent University Belgium 1 Aims of
A thesis submitted to the. Graduate School of the University of Cincinnati. in partial fulfillment of the requirements for the degree of
The association between erythrocyte docosahexaenoic acid (EDHA) status and insulin sensitivity in overweight/obese pregnant women of different racial/ethnic groups A thesis submitted to the Graduate School
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
ACR Meeting November, 2012
ACR Meeting November, 212 Arhalofenate is a Novel Dual-Acting Agent with Uricosuric and Anti-Inflammatory Properties Yun-Jung Choi, Vanina Larroca, Annette Lucman, Vic Vicena, Noe Abarca, Tim Rantz, Brian
WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State