Shuqin Sun 1, Shuo Yang 2, Min Dai 1, Xiujuan Jia 1, Qiyan Wang 3, Zheng Zhang 1 and Yongjun Mao 1*

Transcription

1 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 DOI /s RESEARCH ARTICLE The effect of Astrglus polyscchrides on ttenution of dietic crdiomyopthy through inhiiting the extrinsic nd intrinsic poptotic pthwys in high glucose -stimulted H9C2 cells Shuqin Sun 1, Shuo Yng 2, Min Di 1, Xiujun Ji 1, Qiyn Wng 3, Zheng Zhng 1 nd Yongjun Mo 1* Open Access Astrct Bckground: Apoptosis plys criticl role in the progression of dietic crdiomyopthy (DC). Astrglus polyscchrides (APS), n extrct of strglus memrnceus (AM), is n effective crdioprotectnt. Currently, little is known out the detiled mechnisms underlying crdioprotective effects of APS. The ims of this study were to investigte the potentil effects nd mechnisms of APS on poptosis employing model of high glucose induction of poptosis in H9C2 cells. Methods: A model of high glucose induction of H9C2 cell poptosis ws dopted in this reserch. The cell viilities were nlyzed y MTT ssy, nd the poptotic response ws quntified y flow cytometry. The expression levels of the poptosis relted proteins were determined y Rel-time PCR nd western lotting. Results: Incution of H9C2 cells with vrious concentrtions of glucose (i.e., 5.5, 12.5, 25, 33 nd 44 mmol/l) for 24 h reveled tht cell viility ws reduced y high glucose dose-dependently. Pretretment of cells with APS could inhiit high glucose-induced H9C2 cell poptosis y decresing the expressions of cspses nd the relese of cytochrome C from mitochondri to cytoplsm. Further experiments lso showed tht APS could modulte the rtio of Bcl-2 to Bx in mitochondri. Conclusions: APS decreses high glucose-induced H9C2 cell poptosis y inhiiting the expression of propoptotic proteins of oth the extrinsic nd intrinsic pthwys nd modulting the rtio of Bcl-2 to Bx in mitochondri. Keywords: Dietic crdiomyopthy, Apoptosis, The extrinsic pthwy, The intrinsic pthwy, Astrglus polyscchrides Bckground Dietes mellitus is one of the mjor cuses of mortlity nd moridity worldwide. The numer of dult dietic ptients will continue to increse glolly due to n ging popultion, growth of popultion size, urniztion nd high prevlence of oesity [1]. Among the complictions, dietic crdiomyopthy (DC) is the leding cuse of deth for dietic ptients. Dietic crdiomyopthy is * Correspondence: sumit1985@163.com 1 Deprtment of Geritrics, the Affilited Hospitl of Qingdo University, Qingdo 2663, Chin Full list of uthor informtion is ville t the end of the rticle first descried y Ruler in 1972 s crdic structurl normlities in the sence of hypertension, coronry hert diseses nd other specific trditionl diseses [2]. The erly mnifesttion of DC is distolic dysfunction, followed y the systolic dysfunction nd eventul hert filure [3]. The pthophysiology of dietic crdiomyopthy is not completely understood. DC could e cused y the interctions mong multiple fctors such s hyperglycemi, hyperinsulinemi/hypoinsulinemi, norml ftty cid metolism, oxidtive stress nd crdic utonomic neuropthy [4]. Recent studies showed tht there ws n increse of cellulr poptosis in the hert of dietic The Author(s). 217 Open Access This rticle is distriuted under the terms of the Cretive Commons Attriution 4. Interntionl License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.

2 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 2 of 12 ptients, Streptozocin (STZ)-induced dietic nimls nd high glucose-treted crdiomyocytes [5 7]. Apoptosis is n importnt contriuting fctor to pthology in dietes mellitus. Apoptosis leds to crdic cell loss, decresed crdic contrctile ility nd eventully crdic remodeling [8]. The extent of crdiomyocyte deth prllels the severity of the dietic crdiomyopthy nd its stge of evolution [7]. Attenution of crdiomyocyte poptosis hs een shown to prevent dietic crdiomyopthy [8, 9]. The mechnisms of poptosis involved in dietic crdiomyopthy re not cler. Studies suggest tht it my e relted to oxidtive/nitrtive stress nd incresed production of inflmmtory fctors such s TNF-α [1 12]. Cspses re inctive in the cells nd cn e ctivted when cleved upon induction of the poptotic progrm [13]. During dietic crdiomyopthy, crdiomyocyte poptosis is initited through intrinsic pthwy (the mitochondri-medited pthwy) nd extrinsic pthwy (the deth receptor-medited pthwy) [1, 14]. Either ctivted cspse-8 in the extrinsic pthwy or cytochrome C ctivted cspse-9 in the intrinsic pthwy could ctivte the finl executor cspse-3 to result in poptosis [13]. Mitochondril memrne integrity is key protecting fctor ginst poptosis. Bcl-2 fmily cts t the outer mitochondril memrne nd is involved in regulting mitochondril memrne integrity, wheres the propoptotic fctor Bx is involved in the intrinsic pthwy controlling poptosis [15]. When ctivted, Bx stimultes the relese of cytochrome C nd other poptogenic mitochondril proteins into the cytosol to trigger poptosis. On the other hnd, Bcl-2 ntgonizes this process. It is hypothesized tht the cell fte is determined y the rtio of Bcl-2 to Bx [16]. Drugs tht cn interfere with ny prt of the intrinsic or extrinsic pthwy or the Bcl-2 fmily cn reduce poptosis in dietic crdiomyopthy [17]. Therefore, fctors in the intrinsic or extrinsic poptotic pthwy or the Bcl-2 fmily cn e potentil therpeutic trgets for dietic crdiomyopthy. Mny trditionl Chinese hers hve een used for treting dietes, mong which the root of Astrglus memrnceus (AM, Hungqi) is one notle tht hs een used for thousnds of yers. AM contins 68 components such s polyscchrides, sponins, flvonoids, etc. Astrglus polyscchrides (APS) hs een identified s the mjor ingredient with nti-dietic ctivity [18]. More nd more evidence shows tht APS cn lower lood glucose nd lipid levels, nd improve insulin resistnce in dietic rts [18, 19]. APS lso plys n importnt role in ttenuting dietic complictions. Wng et l. suggested tht APS could llevite liver endoplsmic reticulum stress oth in high glucose induced heptocytes nd in type 2 dietes mellitus (T2DM) rts [2]. Zhng et l. showed tht APS could improve erly dietic nephropthy through modulting mrna expressions of nucler fctor kpp B (NF-κB) nd inhiitor kpp B (IκB) in renl cortex of dietic rts [21]. For dietic crdiomyopthy, Chen et l. suggested tht APS could modulte glucose nd lipids metolism through peroxisome prolifertor ctivted receptor (PPAR)-α pthwy nd reduce crdic firosis through suppression of locl crdic chymse- Angiotensin II system [22, 23]. However, the effects nd moleculr mechnisms of APS on the min pthologicl chnge of dietic crdiomyopthy re fr from cler. The ojective of this study ws to investigte the inhiition of APS on crdic poptosis in high glucose-stimulted H9C2 cells. The underlying moleculr mechnisms of APS on the crdiomyocytes were lso investigted in this study. Methods Cell culture nd tretments H9C2 cells were purchsed from the Shnghi Cellulr Reserch Institute (Shnghi, Chin) nd cultured in Dulecco s modified essentil medium (DMEM, Hyclone, USA) supplemented with 1% fetl ovine serum (FBS, Hyclone, USA) nd 1% penicillin-streptomycin (Hyclone, USA) t 37 C in n incutor with humidified tmosphere of 5% CO 2. During the experimentl period, cells were divided into severl groups, which were treted with low glucose, high glucose nd high glucose comined with APS, respectively. The APS group ws pretreted with APS for 24 h, followed y incution with high glucose for n dditionl 24 h. APS ws purchsed from Tinjin Cinorch Phrmceuticl Compny s hzel-colored nd wter-solule powder. The minimum purity ws determined to e 98%. The APS consists of α-1,4 (1,6) dextrns, rinoglctn (AGs), rhmnoglcturonn I (RGIs) nd rinoglctn-proteins (AGPs) compositions, nd it hs moleculr weight etween 4, 8,. Its monoscchride composition is minly composed of glucose, rinose, glctose, rhmnose nd glcturonic cid, mong which glucose, rinose nd glctose re the min components, ccounting for more thn 9% of the whole composition. Determintion of cell viility Cell viility ws mesured using the 3-(4,5-dimethylthizol-2-yl)-2,5-diphenyl-tetrzolium romide (MTT) ssy (Sigm, USA). Briefly, The H9C2 crdiomyocytes were cultured t density of cells/ml in 96-well pltes nd divided into groups of norml glucose (5.5 mmol/l), high glucose (12.5, 25, 33, 44 mmol/l) nd high glucose comined with different concentrtions of APS (.1,.2,.4,.8, 1.6 nd 3.2 mg/ml) for 24 h. Then 2 μl MTT ws dded (5 mg/ml finl concentrtion in medium) nd the H9C2 crdiomyocytes were

3 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 3 of 12 incuted for nother 4 h t 37 C. The medium ws then ndoned nd 15 μl dimethyl sulfoxide (DMSO) ws dded to ech well which ws then shken for 1 min t room temperture to completely dissolve the lue-purple precipitte from the MTT. The sornce ws mesured t 49 nm using Microplte Reder (Thermo, USA). The sornce of 6 wells for ech group ws verged. To exclude the hyperosmolr effect of high glucose on H9C2 cell viility, identicl concentrtion of mnnitol in norml glucose group ws dded. Flow cytometry nlysis of poptotic cells The poptotic cells were detected y flow cytometry y mens of nnexin V-FITC/propidium iodide (PI) stining (BD, USA) following the mnufcturer s instructions. After tretment for 24 h, the cells were hrvested nd wshed in cold phosphte uffer sline (PBS) twice, then doule stined y Annexin V nd PI in 1 μl 1 inding uffer t room temperture for 15 min in the drk. After incution, nother 4 μl 1 nnexin-inding uffer ws dded. The poptotic cells were then nlyzed y flow cytometry (BD, USA). Quntittive rel-time polymerse chin rection (PCR) Totl RNA ws extrcted from H9C2 cells using 1 ml TRIzol regent (Invitrogen, Crlsd, CA) following the mnufcturer s instructions.all RNA smples were kept t 8 C until use. The PCR primer sequences were designed ccording to the gene sequences reported in GenBnk nd were chemiclly synthesized. Ech smple ws tested in triplicte, with the use of the quntittive SYBR Green PCR kit (VAZYME, Nnjing, Chin) for 4 cycles (5 C for 2 min, 95 C for 1 min, 95 C for 3 s, nd 6 C for 3 s) on the ABI 79HT fst rel time PCR System (Applied Biosystems, Foster, CA). The primers were s follows: GAPDH forwrd primer, ACAGCAACAGGGTGGTG GAC, reverse primer, TTTGAGGGTGCAGCGAACTT; Bx forwrd primer, TGGCGATGAACTGGACAAC, reverse primer, GCAAAGTAGAAAAGGGCAACC; Bcl-2 forwrd primer, CCTGGCATCTTCTCCTTCCA, reverse primer, GGACATCTCTGCAAAGTCGC; cspse 3 forwrd primer, GGACCTGTGGACCTGAAAAA, reverse primer, GCATGCCATATCATCGTCAG; cspse 8 forwrd primer, TTCTGTTTTGGATGAGGTG, reverse primer, TTGCTGAGTTTGGGTATGT; cspse 9 forwrd primer, CACTGCCTCATCATCAACAAC, reverse primer, TGTGCCATAGACAGCACCC; cytochrome C forwrd primer, TGTTCAAAAGTGTGCCCAGT, reverse primer, CTTCTTCTTAATTCCAGCG. Cycle threshold (Ct) vlues were otined grphiclly for the trget genes nd GAPDH. The reltive fold chnge in gene expression ws clculted s 2-ΔΔCt. Western lotting The extrction of cell cytoplsmic nd mitochondril frctions were performed using the Mitochondri/Cytosol Frctiontion Kit (BioVision, CA, USA) ccording to the mnufcturer s protocol. Totl cell proteins were extrcted y RIPA lysing uffer (Beyotime Institute of Biotechnology, Chin) nd protein concentrtion ws determined y the BCA Brdford protein ssy kit (Beyotime Institute of Biotechnology, Chin). The extrcted proteins were then mixed with loding uffer nd oiled for 1 min. Equl mountsofproteins(4μg) were seprted using sodium dodecyl sulfte-polycrylmide gel electrophoresis (SDS-PAGE) nd trnsferred to polyvinylidene difluoride (PVDF) memrnes (Millipore, Germny). After eing locked with 5% non-ft dry milk for 2 h, memrnes were incuted overnight t 4 C with primry ntiodies ginst GAPDH (1:1, Acm, USA), VDAC (1:2, cm, USA), cytochrome C (1:5, Acm, USA), Bcl-2 (1:5, Acm, USA), Bx (1:8, Acm, USA), cleved cspse 3 (1:5, Acm, USA), cspse 8 (1:5, Acm, USA), cleved cspse 9 (1:5, Acm, USA), nd then incuted with horserdish peroxidse-conjugted secondry ntiody (ZSGB-BIO, Chin) for 2 h t room temperture. Memrnes were visulized y n enhnced chemiluminescence (ECL) kit (Thermo, USA) nd quntified y densitometry using n imge nlyzer (BndScn, USA). Sttisticl nlysis Sttisticl nlysis ws performed using one-wy nlysis of vrince (ANOVA) nd lest significnt difference (LSD) post hoc nlysis y using SPSS 17. (SPSS Inc., Chicgo, USA). All dt re presented s Men ± stndrd devition (SD). P < 5 were considered significnt. Results High glucose dose-dependently induced poptosis in H9C2 cells H9C2 cells were incuted with vrious concentrtions of glucose (5.5, 12.5, 25, 33 nd 44 mmol/l) for 24 h nd cell viilities were mesured y MTT ssy. The results reveled tht cell viilities were not significntly different etween 5.5 mmol/l nd 12.5 mmol/l glucose-treted groups. However, s the glucose concentrtion incresed, the cell viilities decresed dose-dependently. Compred with the 5.5 mmol/l-treted control group, the cell viilities in the 33 mmol/l nd 44 mmol/l glucose-treted group decresed significntly, y nerly 16% nd 45%, respectively (1 ± 3.5 vs ± 4.43; 1 ± 3.5 vs ± 7.79; P < 1. Fig. 1). As 33 mmol/l glucose could mimic hyperglycemi in vivo, this concentrtion ws selected for the following experiment. To further exclude the osmotic effect of high glucose on H9C2 cell viility, the cell viilities of 5.5 mmol/l glucose group,

4 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 4 of 12 glucose(mmol/l) cell viility(%) 15 1 viility(%) cell * mmol/L mnnitol 33mmol/L glucose Fig. 1 Cell viilities in cells treted with vrious concentrtions of glucose for 24 h. MTT ssy ws used to mesure cell viility. Dt were expressed s Men ± SD. * P <5versuscontrol. P <1 versus control.. Cell viilities in cells treted with 5.5 mmol/l glucose group, 5.5 mmol/l glucose with 33 mmol/l mnnitol nd 33 mmol/l glucose groups for 24 h. MTT ssy ws used to mesure cell viility. Dt were expressed s Men ± SD. P <1versuscontrol 5.5 mmol/l glucose with 33 mmol/l mnnitol nd 33 mmol/l glucose groups were compred. Mnnitol hd no effect on cell viility (1 ± 3.85 vs ± 4.45; P > 5. Fig. 1), indicting tht hyperosmolr effect could e excluded for high glucose-induced cell viility decrese. Bsed on these dt, 33 mmol/l ws chosen for the further experiments. Effects of APS on cell viilities of high glucose-treted H9C2 cells In the APS treted groups, H9C2 cells were pretreted with different concentrtions of APS (.1,.2,.4,.8, 1.6 nd 3.2 mg/ml) for 24 h nd then incuted with high glucose (33 mmol/l) for 24 h. The control group nd high glucose group were incuted with 5.5 mmol/ L nd 33 mmol/l of glucose for 24 h, respectively. The cell viilities were mesured y MTT ssys. The results showed tht high glucose could significntly decrese cell viilities (1 ± 3.98 vs 82.2 ± 6.85; P < 1, Fig. 2). Compred to cells treted with high glucose lone, pretretment with.4 mg/ml or.8 mg/ ml APS could increse cell viilities, nd cells pretreted with.8 mg/ml APS hd the highest cell viilities (82.2 ± 6.85 vs 95.7 ± 9.75; P < 1, Fig. 2). Therefore, the.8 mg/ml APS ws selected for the following experiments. APS protected H9C2 cells from high glucose-induced poptosis To further elucidte whether APS could inhiit high glucose-induced H9C2 cell poptosis, nnexin V/PI doule leling flow cytometric nlysis ws conducted to determine cell poptosis rtes in ech group. As shown in Fig. 3, the poptotic rtes were significntly higher in high glucose group compred with tht of low glucose (4.92 ± 1.27 vs ± 1.81; P < 1, Fig. 3). The poptotic rte of cells treted with high glucose nd APS decresed significntly s compred with tht of cells treted with high glucose lone (15.96 ± 1.81 vs 7.2 ± 1.6; P < 1, Fig. 3), demonstrting tht APS could ttenute poptosis induced y high glucose in H9C2 cells. Effects of APS on the mrna expression levels of extrinsic poptotic pthwy-relted fctors To investigte whether APS could regulte the extrinsic poptotic pthwy-relted fctors, the mrna expression levels of cspse 8 nd cspse 3 were determined y quntittive rel-time PCR nlysis. In comprison to the low glucose group, high glucose tretment incresed the mrna expression levels of cspse 8 nd cspse 3 (cspse 8 ±.14 vs 1.77 ±.21; cspse 3 ±.22 vs 2.78 ±.39; P < 1, Fig. 4, ). Pretretment with APS could remrkly inhiit the expression levels of cspse 8 nd cspse 3 (cspse ±.21 vs 1.46 ±.21, P < 5; cspse ±.39 vs 2.7 ±.37; P <1, Fig. 4, ). Effects of APS on the mrna expression levels of intrinsic poptotic pthwy-relted fctors To determine whether APS could suppress the intrinsic poptotic pthwy in high glucose stimulted H9C2 cells, the mrna expression levels of cspse 9 nd cytochrome C were mesured. The results showed tht the levels of cspse 9 nd cytochrome C were up-regulted in high glucose group (cspse 9 ±.16 vs 1.76 ±.18; cytochrome C ±.17 vs 2.32 ±.45; P < 1, Fig. 5, ) nd APS could down-regulte them towrd control levels (cspse ±.18 vs 1.44 ±.23, P < 5; cytochrome C 2.32 ±.45 vs 1.66 ±.34; P <1,Fig.5,).Theseresults indicted tht the induction of intrinsic poptotic pthwy in high glucose group could e suppressed y APS pretretment.

5 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 5 of cell viility(%) mmol/lglucose APS(mg/ml) Fig. 2 Cell viilities in cells treted with 5.5 mmol/l glucose, 33 mmol/l glucose or 33 mmol/l glucose in comintion with different concentrtions of APS (.1,.2,.4,.8, 1.6 nd 3.2 mg/ml) for 24 h. MTT ssy ws used to mesure cell viility. Dt were expressed s Men ± SD. P < 1 versus control. P < 5 versus 33 mmol/l glucose group. P < 1 versus 33 mmol/l glucose group Effects of APS on the mrna expression levels of Bx nd Bcl-2 Bcl-2 fmily ws served s vitl regultors of the intrinsic poptotic pthwy. To investigte whether APS could regulte the Bcl-2 fmily Bx nd Bcl-2 mrna, quntittive rel-time PCR ws used to quntity the levels of these mrna. As shown in Fig. 6, high glucose could increse Bx mrna expression level ut hd no significnt effects on the Bcl-2 mrna expression (Bx ±.11 vs 2.23 ±.25; P < 1; Bcl-2 ±.13 vs.81 ±.22; c d 2 Apoptosis rte(%) mg/mlAPS Fig. 3 Cell poptotic rtes mesured y flow cytometry using nnexin V-FITC/PI stining. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. Cells were hrvested nd detected with flow cytometer mmol/l glucose group.. 33 mmol/l glucose group. c. 33 mmol/l glucose nd.8 mg/ml APS group. Dt were expressed s Men ± SD. P < 1 versus 5.5 mmol/l glucose group; P < 1 versus 33 mmol/l glucose group

6 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 6 of 12 cspse 8 mrna reltive expression cspse 3 mrna reltive expression mg/mlAPS +.8mg/mlAPS Fig. 4 APS modulted the mrna expression levels of extrinsic poptotic pthwy-relted fctors. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. The expression of GAPDH ws mesured s n internl control.. the reltive mrna expression levels of cspse 8 in different groups.. the reltive mrna expression levels of cspse 3 in different groups. Dt were expressed s Men ± SD. P <1 versus 5.5 mmol/l glucose group; P < 5 versus 33 mmol/l glucose group. P < 1 versus 33 mmol/l glucose group P > 5, Fig. 6, ). APS tretments resulted in significnt decrese of Bx mrna expression level ut hd no significnt effects on the Bcl-2 mrna expression. (Bx 2.23 ±.25 vs 1.78 ±.23; P < 1; Bcl-2.81 ±.22 vs ±.21, P > 5. Fig. 6, ). The rtio of Bcl-2 to Bx ws incresed in APS tretment group s compred with tht of the high glucose group. APS inhiited extrinsic poptotic pthwy in high glucose stimulted H9C2 cells To determine whether APS could suppress the extrinsic poptotic pthwy in high glucose stimulted H9C2 cells, the levels of cleved cspse 3 nd cspse 8 were mesured. The results showed tht the levels of cleved cspse 3 nd cspse 8 were up-regulted in high glucose group (cleved cspse 3 ±.15 vs 1.91 ±.17; cspse 8 ±.14 vs 2.11 ±.22; P < 1, Fig. 7, ) nd APS could down-regulte them towrd control levels (cleved cspse ±.17 vs ±.22; cspse ±.22 vs 1.79 ±.15; P < 1, Fig. 7, ). APS inhiited intrinsic poptotic pthwy in high glucose stimulted H9C2 cells Previous studies demonstrted tht APS cn ttenute high glucose-induced cellulr poptosis. To determine if APS could inhiit poptosis through the intrinsic poptotic pthwy, the levels of cleved cspse 9 nd cytochrome C were studied. After cells were incuted with high glucose for 24 h, cleved cspse 9 level ws upregulted ( ±.18 vs 1.94 ±.15; P <1,Fig.8)nd relese of cytochrome C from mitochondri to cytoplsm ws incresed (mitochondri cytochrome C ±.4 vs 5 ±.12; P < 5. cytoplsm cytochrome C ±.14 vs 1.74 ±.31; P < 1, respectively, Fig. 8, c). These results indicted tht the intrinsic poptotic pthwy ws ctivted y high glucose. Pretretment with APS could suppress these responses, suggesting tht APS could inhiit cell poptosis t lest in prt through suppression of the intrinsic poptotic pthwys (cleved cspse ±.15 vs 9 ±.19; P < 1. mitochondri cytochrome C 5 ±.12 vs.92 ±.29; P < 5. cytoplsm cytochrome C 1.74 ±.31 vs 1.27 ± 2; P < 5, respectively. Fig. 8 c). APS could regulte mitochondril levels of Bx nd Bcl-2 in high glucose stimulted H9C2 cells The relese of cytochrome C from mitochondri to cytoplsm is coordinted y the Bcl-2 fmily proteins, especilly the rtio of Bcl-2 to Bx in mitochondri [16].Therefore,theeffectsofAPSonproteinexpressions of Bcl-2 nd Bx were further investigted. The results showed tht high glucose could increse Bx protein expression ut hd no significnt effects on the Bcl-2 protein expression in the mitochondri (Bx ±.34

7 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 7 of 12 cspse 9 mrna reltive expression mg/mlAPS cytochrome C mrna reltive expression +.8mg/mlAPS Fig. 5 APS modulted the mrna expression levels of intrinsic poptotic pthwy-relted fctors. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. The expression of GAPDH ws mesured s n internl control.. the reltive mrna expression levels of cspse 9 in different groups.. the reltive mrna expression levels of cytochrome C in different groups. Dt were expressed s Men ± SD. P < 1 versus 5.5 mmol/l glucose group; P < 5 versus 33 mmol/l glucose group. P < 1 versus 33 mmol/l glucose group vs 2.2 ±.38; P < 1. Bcl-2 ±.18 vs.88 ±.14; P > 5, respectively. Fig. 9, ). The rtio of Bcl-2 to Bx decresed in high glucose group s compred to tht of the control. APS tretments resulted in significnt decrese of Bx protein expression nd significnt increse of Bcl-2 protein expression in mitochondri (Bx 2.2 ±.38 vs 1.78 ±.22; P < 5. Bcl-2.88 ±.14 vs 1.29 ±.29, P < 5. Fig. 9, ) nd the rtio of Bcl-2 to Bx incresed in APS tretment group s compred with tht of the high glucose group. These results indicted tht APS could lso suppress poptosis through modulting the rtio of Bcl-2 to Bx. Discussion Dietic crdiomyopthy is the mjor compliction of dietes mellitus nd the leding cuse of deth in dietic ptients. Accumulting evidences hve proven tht poptosis plys vitl role in the pthophysiology of dietic crdiomyopthy [5 9]. The use of plnts nd their derived sustnces hs een incresing dy y Bx mrna reltive expression mg/mlAPS Bcl-2 mrna reltive expression +.8mg/mlAPS Fig. 6 APS modulted the mrna expression levels of Bx nd Bcl-2. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. The expression of GAPDH ws mesured s n internl control.. the reltive mrna expression levels of Bx in different groups.. the reltive mrna expression levels of Bcl-2 in different groups. Dt were expressed s Men ± SD. P <1versus5.5mmol/L glucose group; P < 1 versus 33 mmol/l glucose group

8 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 8 of 12 cleved cspse 3 cspse 8 GAPDH GAPDH cleved cspse 3 reltive to control cspse 8 reltive to control mg/mlAPS +.8mg/mlAPS Fig. 7 APS modulted poptosis-relted proteins in the extrinsic pthwys. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. The expression of GAPDH ws mesured s n internl control for the cytoplsmic frction.. Semi-quntittive expressions of cleved cspse 3 in different groups.. Semi-quntittive expressions of cspse 8 in different groups. Dt were expressed s Men ± SD. P < 1 versus 5.5 mmol/l glucose group; P < 1 versus 33 mmol/l glucose group dy owing to their verstile nd powerful effects. For exmple, the seed extrcts of Syzygium fruticosum Rox nd white mulerry possess significnt ntioxidnt nd nticncer properties [24, 25]. Polyscchrides present in multiple plnts re constructed from monoscchride unit nd their derivtives, such s glucose, rinose, glctose, rhmnose, etc. Polyscchrides isolted from Slvi miltiorrhiz showed crdioprotective effects ginst myocrdil ischemi-reperfusion injury in rts y meliorting oxidtive stress nd inhiiting myocrdil poptosis [26]. The polyscchrides could lso e isolted from other plnts such s Lycium rrum erries, Gnoderm trum nd Morchell importun [27 29]. APS is extrcted from AM, trditionl Chinese her tht hs een used in clinic for more thn 3 yers. AM is distriuted in Inner Mongoli, Shnxi, Gnsu nd other provinces of Chin. APS hs een identified s the primry ingredient exerting immunomodultory, nti-dietic, nti-hypertrophic, ntivirus, nti-rdition ctivities [18, 3 32]. APS lso plys n importnt role in ttenuting dietic complictions such s dietic crdiomyopthy nd dietic nephropthy, ut the exct moleculr mechnisms hve remined uncler. In this study, the effects of APS on high glucoseinduced poptosis in H9C2 cells were explored nd the nti-poptotic mechnisms were investigted y MTT, nnexin V-FITC/PI stining nd western lotting methods. Our results showed tht the nti-poptotic function of APS ws medited through regulting the intrinsic/extrinsic poptosis pthwys nd the Bcl-2 fmily. Previous experiments showed tht high glucose could induce poptosis in H9C2 cells [33, 34]. In our study, consistent with previous oservtions, we found tht high glucose could induce H9C2 cell poptosis. Pretretment with APS incresed cell viility nd reduced poptotic rte in high glucose stimulted H9C2 cells, suggesting tht APS possesses nti-poptotic function in crdiomyocytes. The mechnisms y which APS exerted nti-poptotic effects were further explored. Vrious fctors cn ctivte cspses to initite the poptotic process. Apoptosis is medited minly y the extrinsic poptotic pthwy nd the intrinsic poptotic pthwy [13, 35]. Extrinsic poptosis is initited through lignd-medited ctivtion of cell surfce deth receptors, such s the tumor necrosis fctor receptors nd CD95. Activted deth receptors promote cspse-8 clevge, which then ctivtes down strem cspse 3. The intrinsic pthwy strts from the relese of cytochrome C from the intermemrne spce of mitochondri into the cytosol. Cytochrome C, together with poptosis ctivting fctor 1 (Apf-1), ctivte cspse 9, which in turn ctivtes the executor cspse 3 [13]. It hs een proven tht during dietes mellitus, high glucose cn promote the relese of cytochrome C into the cytoplsm nd ctivte procspse 3, which leds to the poptosis of pncretic islet cells y intrinsic pthwy [36]. On the other hnd, high glucose

9 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 9 of 12 cleved cspse 9 GAPDH cytochrome C VDAC cleved cspse 9 reltive to control c mg/mlAPS mitochondril cytochrome C reltive level * +.8mg/mlAPS cytochrome C GAPDH cytoplsmic cytochrome C reltive to control mg/mlAPS Fig. 8 APS modulted poptosis-relted proteins in the intrinsic pthwys. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. The expression of GAPDH ws mesured s n internl control for the cytoplsmic frction. The expression of VDAC ws mesured s n internl control for the mitochondril frction.. Semi-quntittive expressions of cleved cspse 9 in different groups.. Semi-quntittive expressions of mitochondril cytochrome C in different groups. c. Semi-quntittive expressions of cytoplsmic cytochrome C in different groups. Dt were expressed s Men ± SD. * P < 5 versus 5.5 mmol/l glucose group; P < 1 versus 5.5 mmol/l glucose group; P < 5 versus 33 mmol/l glucose group; P < 1 versus 33 mmol/l glucose group cn promote the expression of Fs receptor in pncretic islet cells, ctivte cspse 8 nd increse the poptosis of islet cells y extrinsic pthwy [37]. In ddition, the poptotic rte of kidney nd liver cells in the dietic ptients lso increse significntly, which led to the occurrence of dietic nephropthy nd dietic liver disese [38, 39]. Previous studies hve shown tht APS could reduce poptosis of et cells y decresing the expression of Fs [4]. Studies hve lso shown tht APS could inhiit high ft diet induced poptosis of H9C2 cells through lowering the expression of cspse 8 nd cspse 3 nd modulting the rtio of Bcl-2 to Bx [41]. These previous studies suggested tht APS could inhiit poptosis in islet nd crdic cells through multiple pthwys. Our results showed tht high glucose could induce poptosis in H9C2 cells y promoting the relese of cytochrome C into the cytoplsm, ctivting procspse 9 nd 3 nd ctivting procspse 8 nd 3. After pretretment of cells with APS, the relese of cytochrome C into cytoplsm nd expression of cspse 3, 8, 9 decresed s compred with those in high glucose treted group. Our results indicted tht APS protected cells from poptosis y modulting nti (pro)-poptotic proteins of oth intrinsic nd extrinsic pthwy. Mitochondril outer memrne permeiliztion (MOMP) plys key role in cell poptosis [42, 43]. MOMP increses with poptotic stimuli, which is followed y relese of pro-poptotic fctors such s cytochrome C from mitochondri to cytoplsm to initite

10 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 1 of 12 Bx Bcl-2 VDAC VDAC mitochondril Bx reltive to control mitochondril Bcl-2 reltive to control mg/mlAPS +.8mg/mlAPS Fig. 9 APS modulted poptosis-relted proteins of the Bcl-2 fmily. H9C2 cells were pre-incuted with/without APS for 24 h nd then treted with 33 mmol/l glucose for 24 h. The expression of VDAC ws mesured s n internl control for the mitochondril proteins.. Semi-quntittive expressions of mitochondril Bx in different groups.. Semi-quntittive expressions of mitochondril Bcl-2 in different groups. Dt were expressed s Men ± SD. P < 1 versus 5.5 mmol/l glucose group; P < 5 versus 33 mmol/l glucose group intrinsic pthwy of poptosis. Bcl-2 fmily cn modulte MOMP. This fmily includes oth nti-poptotic fctors such s Bcl-2, Bcl-xL, nd Mcl-1 nd pro-poptotic fctors such s Bid, Bx nd Bk. The pro-poptotic fmily memer Bx cn undergo conformtionl chnge, nd trnslocte from cytoplsm to the mitochondri when ctivted [44]. On the other hnd, the nti-poptotic fmily memer Bcl-2 cn ntgonize this process. The rtio of Bcl-2 to Bx in mitochondri determines the cell fte [16, 45]. Studies showed tht Bid deficiency or Bcl-2 overexpression could reduce the poptosis of pncretic islet cells induced y Fs or TNF-α. Loss of Bx or Bk could lso reduce the poptosis of pncretic islet cells medited y deth receptors [46]. Other studies hve lso demonstrted tht during dietic nephropthy, the expression of Bcl-2 decresed nd expressions of Bid nd Bx incresed. After tretment with mngiferin, the expression of Bcl-2 incresed nd expressions of Bid nd Bx decresed [47]. These studies suggest tht Bcl-2 fmily proteins re involved in the occurrence of poptosis in dietic nephropthy. APS hs een shown to hve nti-poptotic function. Studies showed tht APS could enhnce the expression of Bcl-2, reduce the expression of cspse 3 nd poptosis of islet cells in type 1 dietes mellitus [18]. Our experiment showed tht high glucose could induce poptosis in H9C2 cells y up-regulting Bx nd reducing the rtio of Bcl-2 to Bx in mitochondri. After pretretment of cells with APS, the expression of Bcl-2 in mitochondri incresed, the expression of Bx in mitochondri decresed nd the rtio of Bcl-2 to Bx incresed. These results indicted tht APS could inhiit high glucose induced poptosis of H9C2 cells y modulting the rtio of Bcl-2 to Bx in mitochondri. Conclusions The results of this study suggest tht APS could ttenute cellulr poptosis induced y high glucose y inhiiting the expression of pro-poptotic proteins of oth the extrinsic nd intrinsic pthwy nd modulting the rtio of Bcl-2 to Bx in mitochondri. The nti-poptotic effect of APS confirms tht it is n importnt therpeutic gent for the tretment of dietic crdiomyopthy. Arevitions AGPs: Arinoglctn-proteins; AGs: Arinoglctn; AM: Astrglus memrnceus; ANOVA: Anlysis of vrince; Apf-1: Apoptosis ctivting fctor1; APS: Astrglus polyscchrides; Ct: Cycle threshold; DC: Dietic crdiomyopthy; DMSO: Dimethyl sulfoxide; ECL: Enhnced chemiluminescence; IκB: Inhiitor kpp B; LSD: Lest significnt difference; MOMP: Mitochondril outer memrne permeiliztion; MTT: 3-(4,5- dimethylthizol-2-yl)-2,5-diphenyl-tetrzolium romide; NF-κB: Nucler fctor-kpp B; PBS: Phosphte uffer sline; PCR: Polymerse chin rection; PI: Propidium iodide; PPAR: Peroxisome prolifertor ctivted receptor; PVDF: Polyvinylidene difluoride; RGIs: Rhmnoglcturonn I; SD: Stndrd devition; SDS-PAGE: Sodium dodecyl sulfte-polycrylmide gel electrophoresis; STZ: Streptozocin; T2DM: Type 2 dietes mellitus

11 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 11 of 12 Acknowledgements We re extremely grteful to Dr. Hu Liu who kindly edited this mnuscript. Funding This study ws finncilly supported y the Grnts from Ntionl Nturl Science Foundtion of Chin ( ). Avilility of dt nd mterils All dt supporting the conclusions of this rticle re included within the rticle. Authors contriutions MD XJJ crried out experiment studies. QYW SQS nd SY drfted the mnuscript. YJM ZZ prticipted in the design of the study nd performed the sttisticl nlysis. SQS YJM conceived of the study. All uthors red nd pproved the finl mnuscript. Competing interests The uthors declred tht they did not hve ny commercil or ssocitive interest tht represented conflict of interest in connection with the work sumitted. Consent for puliction Not pplicle. Ethics pprovl nd consent to prticipte Not pplicle. Pulisher s Note Springer Nture remins neutrl with regrd to jurisdictionl clims in pulished mps nd institutionl ffilitions. Author detils 1 Deprtment of Geritrics, the Affilited Hospitl of Qingdo University, Qingdo 2663, Chin. 2 Deprtment of the Intensive Cre Unit, the Affilited Hospitl of Qingdo University, Qingdo 2663, Chin. 3 School of Life Sciences, Beijing University of Chinese Medicine, Beijing 129, Chin. Received: 6 Jnury 217 Accepted: 7 June 217 References 1. Shw JE, Sicree RA, Zimmet PZ. Glol estimtes of the prevlence of dietes for 21 nd 23. Dietes Res Clin Prct. 21;87(1): Ruler S, Dlugsh J, Yuceoglu YZ, Kumrl T, Brnwood AW, Grishmn A. New type of crdiomyopthy ssocited with dietic glomerulosclerosis. Am J Crdiol. 1972;3(6): Hyt SA, Ptel B, Khttr RS, Mlik RA. Dietic crdiomyopthy: mechnisms, dignosis nd tretment. Clin Sci (Lond). 24;17(6): Acr E, Url D, Bildirici U, Shin T, Yilmz I. Dietic crdiomyopthy. Andolu Krdiyol Derg. 211;11(8): Frustci A, Kjstur J, Chimenti C, Jkoniuk I, Leri A, Mseri A, et l. Myocrdil cell deth in humn dietes. Circ Res. 2;87(12): Fiordliso F, Binchi R, Stszewsky L, Cuccovillo I, Doni M, Lrgione T, et l. Antioxidnt tretment ttenutes hyperglycemi-induced crdiomyocyte deth in rts. J Mol Cell Crdiol. 24;37(5): Ghosh S, Pulinilkunnil T, Yuen G, Kewlrmni G, An D, Qi D, et l. Crdiomyocyte poptosis induced y short-term dietes requires mitochondril GSH depletion. Am J Physiol Hert Circ Physiol. 25;289(2):H Ci L, Wng Y, Zhou G, Chen T, Song Y, Li X, et l. Attenution y metllothionein of erly crdic cell deth vi suppression of mitochondril oxidtive stress results in prevention of dietic crdiomyopthy. J Am Coll Crdiol. 26;48(8): Adel-Hmid AA, Firgny Ael D. Atorvsttin llevites experimentl dietic crdiomyopthy y suppressing poptosis nd oxidtive stress. J Mol Histol. 215;46(4 5): Ci L, Kng YJ. Oxidtive stress nd dietic crdiomyopthy: rief review. Crdiovsc Toxicol. 21;1(3): Pcher P, Beckmn JS, Liudet L. Nitric oxide nd peroxynitrite in helth nd disese. Physiol Rev. 27;87(1): Westermnn D, Vn Linthout S, Dhyt S, Dhyt N, Schmidt A, Noutsis M, et l. Tumor necrosis fctor-lph ntgonism protects from myocrdil inflmmtion nd firosis in experimentl dietic crdiomyopthy. Bsic Res Crdiol. 27;12(6): Budihrdjo I, Oliver H, Lutter M, Luo X, Wng X. Biochemicl pthwys of cspse ctivtion during poptosis. Annu Rev Cell Dev Biol. 1999;15: Amin AH, El-Missiry MA, Othmn AI. Meltonin meliortes metolic risk fctors, modultes poptotic proteins, nd protects the rt hert ginst dietes-induced poptosis. Eur J Phrmcol. 215;747: Wei MC, Zong WX, Cheng EH, Lindsten T, Pnoutskopoulou V, Ross AJ, et l. Propoptotic BAX nd BAK: requisite gtewy to mitochondril dysfunction nd deth. Science. 21;292(5517): Oltvi ZN, Millimn CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with conserved homolog, Bx, tht ccelertes progrmmed cell deth. Cell. 1993;74(4): Rni N, Bhrti S, Bhti J, Ng TC, Ry R, Ary DS. Chrysin, PPAR-gmm gonist improves myocrdil injury in dietic rts through inhiiting AGE- RAGE medited oxidtive stress nd inflmmtion. Chem Biol Interct. 216; 25: Agyemng K, Hn L, Liu E, Zhng Y, Wng T, Go X. Recent dvnces in Astrglus Memrnceus nti-dietic reserch: phrmcologicl effects of its phytochemicl constituents. Evid Bsed Complement Alternt Med. 213; 213: Cho M, Zou D, Zhng Y, Chen Y, Wng M, Wu H, et l. Improving insulin resistnce with trditionl Chinese medicine in type 2 dietic ptients. Endocrine. 29;36(2): Wng N, Zhng D, Mo X, Zou F, Jin H, Ouyng J. Astrglus polyscchrides decresed the expression of PTP1B through relieving ER stress induced ctivtion of ATF6 in rt model of type 2 dietes. Mol Cell Endocrinol. 29;37(1 2): Zhng YW, Wu CY, Cheng JT. Merit of Astrglus polyscchride in the improvement of erly dietic nephropthy with n effect on mrna expressions of NF-kppB nd IkppB in renl cortex of streptozotoxininduced dietic rts. J Ethnophrmcol. 27;114(3): Chen W, Li YM, Yu MH. Astrglus polyscchrides inhiited dietic crdiomyopthy in hmsters depending on suppression of hert chymse ctivtion. J Dietes Complict. 21;24(3): Chen W, Xi YP, Chen WJ, Yu MH, Li YM, Ye HY. Improvement of myocrdil glycolipid metolic disorder in dietic hmster with Astrglus polyscchrides tretment. Mol Biol Rep. 212;39(7): Alm AK, Hossin AS, Khn MA, Kir SR, Rez MA, Rhmn MM, et l. The Antioxidtive frction of white mulerry induces poptosis through regultion of p53 nd NFkppB in EAC cells. PLoS One. 216;11(12):e Islm S, Nsrin S, Khn MA, Hossin AS, Islm F, Khndokhr P, et l. Evlution of ntioxidnt nd nticncer properties of the seed extrcts of Syzygium fruticosum Rox. growing in Rjshhi, Bngldesh. BMC Complement Altern Med. 213;13: Song M, Hung L, Zho G, Song Y. Beneficil effects of polyscchride from slvi miltiorrhiz on myocrdil ischemi-reperfusion injury in rts. Crohydr Polym. 213;98(2): He M, Pn H, Chng RC, So KF, Brech NC, Pu M. Activtion of the Nrf2/HO- 1 ntioxidnt pthwy contriutes to the protective effects of Lycium rrum polyscchrides in the rodent retin fter ischemi-reperfusioninduced dmge. PLoS One. 214;9(1):e Li WJ, Nie SP, Yn Y, Zhu SB, Xie MY. The protective effect of Gnoderm trum polyscchride ginst noxi/reoxygention injury in neontl rt crdiomyocytes. Life Sci. 29;85(17 18): Xiong C, Li Q, Chen C, Chen Z, Hung W. Neuroprotective effect of crude polyscchride isolted from the fruiting odies of Morchell importun ginst H2O2-induced PC12 cell cytotoxicity y reducing oxidtive stress. Biomed Phrmcother. 216;83: Di H, Ji G, Liu X, Liu Z, Wng H. Astrglus polyscchride inhiits isoprenline-induced crdic hypertrophy vi suppressing c(2)(+)-medited clcineurin/nfatc3 nd CMKII signling cscdes. Environ Toxicol Phrmcol. 214;38(1): Chen Y, Song M, Wng Y, Xiong W, Zeng L, Zhng S, et l. The nti-dhav ctivities of Astrglus polyscchride nd its sulfte compred with those of BSRPS nd its sulfte. Crohydr Polym. 215;117: Liu Y, Liu F, Yng Y, Li D, Lv J, Ou Y, et l. Astrglus polyscchride meliortes ionizing rdition-induced oxidtive stress in mice. Int J Biol Mcromol. 214;68:29 14.

12 Sun et l. BMC Complementry nd Alterntive Medicine (217) 17:31 Pge 12 of Tsi KH, Wng WJ, Lin CW, Pi P, Li TY, Tsi CY, et l. NADPH oxidsederived superoxide nion-induced poptosis is medited vi the JNKdependent ctivtion of NF-kppB in crdiomyocytes exposed to high glucose. J Cell Physiol. 212;227(4): Wei WB, Hu X, Zhung XD, Lio LZ, Li WD. GYY4137, novel hydrogen sulfide-relesing molecule, likely protects ginst high glucose-induced cytotoxicity y ctivtion of the AMPK/mTOR signl pthwy in H9c2 cells. Mol Cell Biochem. 214;389(1 2): Movssgh M, Foo RS. Simplified poptotic cscdes. Hert Fil Rev. 28; 13(2): Prk MH, Hn JS. Phloroglucinol protects INS-1 pncretic et-cells ginst Glucotoxicity-induced poptosis. Phytother Res. 215;29(11): Medler K, Spins GA, Lehmnn R, Sergeev P, Weer M, Fontn A, et l. Glucose induces et-cell poptosis vi upregultion of the Fs receptor in humn islets. Dietes. 21;5(8): Sweetwyne MT, Gruenwld A, Nirnjn T, Nishinkmur R, Strol LJ, Susztk K. Notch1 nd Notch2 in podocytes ply differentil roles during dietic nephropthy development. Dietes. 215;64(12): Mnn P, Ds J, Ghosh J, Sil PC. Contriution of type 1 dietes to rt liver dysfunction nd cellulr dmge vi ctivtion of NOS, PARP, IkppBlph/ NF-kppB, MAPKs, nd mitochondri-dependent pthwys: prophylctic role of rjunolic cid. Free Rdic Biol Med. 21;48(11): Li CD, Li JJ, Wng L, Wng JH, Di G, Kng B, et l. inhiitory effect of Astrglus polyscchrides on poptosis of pncretic et-cells medited y Fs in dietes mellitus rts. Zhong Yo Ci. 211;34(1): Zhng J, Gu JY, Chen ZS, Xing KC, Sun B. Astrglus polyscchride suppresses plmitte-induced poptosis in humn crdic myocytes: the role of Nrf1 nd ntioxidnt response. Int J Clin Exp Pthol. 215;8(3): Youle RJ, Krowski M. Mitochondril fission in poptosis. Nt Rev Mol Cell Biol. 25;6(8): Jourdin A, Mrtinou JC. Mitochondril outer-memrne permeiliztion nd remodelling in poptosis. Int J Biochem Cell Biol. 29;41(1): Czotr PE, Lessene G, Strsser A, Adms JM. Control of poptosis y the BCL-2 protein fmily: implictions for physiology nd therpy. Nt Rev Mol Cell Biol. 214;15(1): Cory S, Adms JM. The Bcl2 fmily: regultors of the cellulr life-or-deth switch. Nt Rev Cncer. 22;2(9): McKenzie MD, Crrington EM, Kufmnn T, Strsser A, Hung DC, Ky TW, et l. Propoptotic BH3-only protein id is essentil for deth receptor-induced poptosis of pncretic et-cells. Dietes. 28;57(5): Pl PB, Sinh K, Sil PC. Mngiferin ttenutes dietic nephropthy y inhiiting oxidtive stress medited signling cscde, TNFlph relted nd mitochondril dependent poptotic pthwys in streptozotocin-induced dietic rts. PLoS One. 214;9(9):e1722. Sumit your next mnuscript to BioMed Centrl nd we will help you t every step: We ccept pre-sumission inquiries Our selector tool helps you to find the most relevnt journl We provide round the clock customer support Convenient online sumission Thorough peer review Inclusion in PuMed nd ll mjor indexing services Mximum visiility for your reserch Sumit your mnuscript t