Supplementary Figure S1
|
|
|
- Douglas Watson
- 5 years ago
- Views:
Transcription
1 Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI (red). DAPIstined nuclei in lue. () Plsm memrne (green) nd intrcellulr (red) immunofluorescence of Met (see Mterils nd methods section). Nuclei in lue. Br: 5µm.
2 Supplementry Figure S. (AAy)/A.. VSVG. 4h 48h 7h c MTT % Reltive Asornce Vlue CoCl VSVG nm VSVG nm % Reltive Numer Cells CoCl VSVG nm VSVG nm Supplementry Figure S The crdioprotective ctivity medited y Met gonist DN nd DO4 is specific. () Wound heling ssy in cells not treted (, white) or treted with VSVG ma (nm, grey) for 4, 48 or 7 hours. Ttest ws clculted etween treted vs smples t ech time point nd ws never sttisticlly significnt. (c) Cells were untreted (, white), treted with µm CoCl (lck) or CoCl VSVG (nm: light grey, nm: drk grey). MA ws concomitntly dded to CoCl for 4h () nd 48h (c). Cell viility ws mesured y MTT ssy () nd cells were counted (c). Results re expressed s the percentge of MTT or cell count reduction reltive to. Vlues re the men ± SD clculted in three independent experiments. For Ttest ech group of smples ws compred to CoCl treted cells, except for (). p<.5 nd p<.5.
3 Supplementry Figure S h HIF 6h h 4h c Glut mrna Reltive Expression.5.5 HIF mrna Reltive Expression d CAXII mrna Reltive Expression.5.5 Tu h h 4h 48h e Met mrna Reltive Expression.5 h h 4h 48h f GAPDH Reltive Densitometry.5 h h 4h 48h h h 4h 48h GAPDH Tu h 4h 48h CoCl Supplementry Figure S CoCl induces HIF protein stiliztion nd mrna upregultion of its trget genes in H9c crdiomyolsts. Cells were treted with µm of CoCl (lck) for different lengths of time. () WB of HIF protein. Tuulin is showed s loding control. HIF (), GLUT (c), CAXII (d) nd Met (e) mrna expression levels were nlysed nd normlized using the βctin. (f) WB of GAPDH protein, normlized using tuulin. The vlues re expressed s fold reltive to (white) nd re the men ± SD of three independent experiments. Ttest ws clculted etween treted smples vs. In (e) onetiled Ttest ws significnt. p<.5, p<. nd p<.5.
4 Supplementry Figure S4 PAkt Reltive Densitometry.5 PErk Reltive Densitometry PAkt PErk Tu CoCl (48h) HGF (h) c Tu CoCl (48h) HGF (h) PProtein Reltive densitometry.5 Pp7S6K Tu CoCl (48h) HGF (h) P4EBP Tu Supplementry Figure S4 CoCl tretment decreses the prosurvivl pthwys Akt, Erk nd mtor nd impirs the response to HGF. H9c cells were untreted (white) or treted with µm CoCl (lck), HGF (.5nM, light grey) or HGFCoCl (drk grey). Cells were treted for 48h nd HGF ws dded in the lst h. PAkt (), P Erk (), Pp7S6K nd P4EBP (c) protein levels were nlysed y WB densitometry. Tuulin ws used s loding control. Representtive imges re shown elow ech grph. The vlues re expressed s fold reltive to nd re the men ± SD of three independent experiments. Ttest ws clculted etween vs CoCl nd HGF vs HGFCoCl. p<.5, p<. nd p<.5.
5 Supplementry Figure S5 A B CoCl CoCl MA CoCl Bf C D Supplementry Figure S5 CoCl induces utophgosome formtion nd mturtion. Immunofluorescence imges of LC utophgic mrker (green) in H9c cells untreted (A) or treted with µm CoCl lone (B), CoCl MA (C) or CoCl Bf (D) for 48h. MA nd Bf were dded in the lst h nd 6h, respectively. DAPIstined nuclei in lue. Br: 7µm.
6 Supplementry Tle S. Antiodies used throughout the study. Primry Antiody Compny Dilution Product n. Exp Met Snt Cruz : SP6 IP G Millipore :/ 5ug 6579 IP PMet (TyR 4/5) Upstte : IP PTyrosines Snt Cruz : PY99 IP Bx Snt Cruz : sc748 WB Bcl BD Biosciences : ps7 WB Totl/Cleved Cspse Cell Signling : 966 WB Prp/ Snt Cruz : sc75 WB Redd (RTP8) Sigm : PRS459 WB Bnip cm : AN4 WB PAMPK thr7 Sigm : SAB45754 WB AMPK Sigm : SAB459 WB PP7s6K thr89 Cell Signling : 95 WB p7s6k New Englnd BioLs : WB P4ep ser65 Cell Signling : 945 WB 4ep Snt Cruz : sc9977 WB Beclin Sigm : B686 WB LCB Sigm :/: L754 WB/IF p6 Sigm : P67 WB HIFα Novus Biologicls : NB479 WB GAPDH Open iosystems : TAB WB αtuulin Sigm : B5 WB Met Zymed : D4 IF Connexin 4 Sigm : C69 IF TroponinI Millipore : 69 IF Secondry Antiody Got ntimouse IG Amershm : 4 WB Got ntirit IG Amershm : 46 WB Alex Fluor 488 ntimouse Moleculr Proes/Invitrogen :5 IF Alex Fluor 488 ntirit Moleculr Proes/Invitrogen :5 IF Alex Fluor 546 ntimouse Moleculr Proes/Invitrogen :5 IF
7 Supplementry Tle S. Primers used throughout the study. Gene Forwrd Reverse Tm ( C) Size (p) ReddRTPCR 5'GCCGGAGGAAGACTCCTCATA 5'CATCAGGTTGGCACACAGGT 6 97 Bnip RTPCR 5'GCCATTGGATTGGGGATCTAC 5'ACTGTGTGAGCAGAAGGCAG 6 9 Redd SQPCR 5'CTTGTCCGCAATCTTCGCTG 5'TATGAGGAGTCTTCCTCCGGC 6 98 Bnip SQPCR 5'TACCTCTCAGTGGTCACTTC 5'GTGGGTGTCAATTTCAGCTC 6 97 Beclin 5 CGCCTCCTATTCCATCAAAA 5 AACTGTGAGGACACCCAAGC 6 LC 5'CACTGCTCTGTCTTGTGTAGGTTG 5'TCGTTGTGCCTTTATTAGTGCATC 65 7 p6 5'CCCAGTGTCTTGGCATTCTT 5'AGGGAAAGCAGAGGAAGCTC 6 54 HIFα 5'GCTTGGTGCTGTTTGTGAACC 5'GCATCCTGTACTGTCCTGTGGTG GLUT 5'CAGAAGGTAATTGAGGAGTTCTACA 5'ACAAAGGCCAACAGGTTCATCATC 6 6 CAXII 5'CAGCCATCAAGAAGGAGG 5'ACTCCTGCCCCCTAGTTC Met 5'ACACCGTGGCGTGCCAACAT 5'TCGCCGCCGTTCAGCTTCAG βctin SQPCR 5'CACGATGGAGGGGCCGGACTCAT 5'TAAAGACCTCTATGCCAACACAG 6 4 βctin RTPCR 5'CGCGAGTACAACCTTCTTGC 5'CGTCATCCATGGCGAACTGG 6 7
Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
Supplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
SUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
Supplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
Supplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
SUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
Supplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
SUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
Supplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
ESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
SUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
Supplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
SUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
SUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
SUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
SUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk
EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated
TNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
MERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
![NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]](/thumbs/92/110177253.jpg "NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]")
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
SUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
Effect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
SUPPLEMENTARY INFORMATION
doi:.38/nture73 Glucose SSP THF Methyl- THF Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA Cycle Glucose p53 p Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA
SUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
SUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
SUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
SUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
Primers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
SUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
Supplementary information
Supplementry informtion Unsturted liphtic lcohol s nturl lignd for mouse odornt receptor Keiichi Yoshikw, Hiroki Nkgw, Noki Mori, Hidenori Wtne nd Kzushige Touhr* Deprtment of Applied Biologicl Chemistry,
Degree of SGLT1 phosphorylation is associated with but does not determine segment-specific glucose transport features in the porcine small intestines
ORIGINAL RESEARCH Physiologicl Reports ISSN 2051-817X Degree of SGLT1 phosphoryltion is ssocited with ut does not determine segment-specific glucose trnsport fetures in the porcine smll intestines Stefnie
% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
Supplementary Figure 1 a
% DAPI + Are Supplementry Figure 1 MOI 1 MOI.5 MOI.25 5 4 3 MOPC MOPC, LCMV reltive VL4 expression 2 1 d1 d2 d3 MOI.125 MOI.625 untreted Supplementry Figure 1: LCMV replictes in MOPC without ffecting cell
Supplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
residual wild type band (Supplementary Fig. 5c) that may be explained by the presence of
doi:1.138/nture9387 Supplementry Text RANK deletion in tumors nd Cre effects. Southern lotting of the tumors tht developed in RANK mm femles showed deletion of RANK, leit we oserved some residul wild type
* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
Two-step activation of FOXO3 by AMPK generates a coherent feed-forward loop determining excitotoxic cell fate
(22), 2 & 22 Mcmilln Pulishers Limited All rights reserved 35947/2 www.nture.com/cdd Twostep ctivtion of FOXO3 y AMPK genertes coherent feedforwrd loop determining excitotoxic cell fte D Dvil, NMC Connolly
Ginsenoside from Panax ginseng Meyer Enhances the Cytotoxic and Apoptotic Effect of Cisplatin in A549 Human Lung Cancer Cells
Ginsenoside from Pnx ginseng Meyer Enhnces the ytotoxic nd Apoptotic Effect of ispltin in A549 Humn Lung ncer ells J. K. PARK, V. ASTRO-AEITUNO, S. AHN, S. Y. SIMU 1, M. H. SIDDIQI 1, D. H. KIM, Y. J.
Molecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
SUPPLEMENTARY INFORMATION
DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved logfc SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
SUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
SUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF
SUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
Supplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
SUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
SUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
Supplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
Combination of microrna-21 and microrna-146a Attenuates Cardiac Dysfunction and Apoptosis During Acute Myocardial Infarction in Mice
Cittion: Moleculr Therpy Nucleic Acids (16) 5, e96; doi:1.138/mtn.16.1 Officil journl of the Americn Society of Gene & Cell Therpy All rights reserved 16-531/16 www.nture.com/mtn Combintion of microrna-1
Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
SUPPLEMENTARY INFORMATION
doi:1.138/nture1849 neurotoxic insults cute synptic dysfunctions chronic cognitive deficits epigenetic lockde of gene trnscription e.g. Bdnf IV, synptophysin neurotoxic insults Aβ H 2 O 2 Cdk5/p25 P GR1
In Vivo AAV1 Transduction With hrheb(s16h) Protects Hippocampal Neurons by BDNF Production
originl rticle In Vivo AAV1 Trnsduction With hrhe(s16h) Protects Hippocmpl Neurons y BDNF Production Min-Te Jeon 1,2, Jin Hn Nm 3,4, Won-Ho Shin 5, Eunju Leem 1,2, Kyoung Hoon Jeong 1,2, Un Ju Jung 6,
Defective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome
correction notice Nt. Med. 17, 726 731 (2011) Defective Wnt-dependent cereellr midline fusion in mouse model of Jouert syndrome Mdeline A Lncster, Dipik J Gopl, Joon Kim, Shr N Sleem, Jennifer L Silhvy,
Ndfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells
Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher
Chronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
Supporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
Arachidonic acid induces ERK activation via Src SH2 domain association with the epidermal growth factor receptor
http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology originl rticle Archidonic cid induces ERK ctivtion vi Src SH2 domin ssocition with the epiderml growth fctor receptor LD Alexnder
Single-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
Electronic Supplementary Information for:
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 214 Electronic Supplementry Informtion for: Gold nnoprticles functionlized with cresyl violet nd porphyrin
Mechanisms of Tanshinone II a inhibits malignant melanoma development through blocking autophagy signal transduction in A375 cell
Li et l. BMC Cncer (2017) 17:357 DOI 10.1186/s12885-017-3329-y RESEARCH ARTICLE Open Access Mechnisms of Tnshinone II inhiits mlignnt melnom development through locking utophgy signl trnsduction in A375
Supplementary Information. Title: RAS-MAPK dependence underlies a rational polytherapy strategy in EML4-
Supplementry Informtion Title: RAS-MAPK dependence underlies rtionl polytherpy strtegy in EML4- ALK positive lung cncer Authors: Gorjn Hrustnovic, Victor Olivs, Evngelos Pzrentzos, Asmin Tulpule, Surh
SUPPLEMENTARY INFORMATION
doi:1.13/nture173 Supplementry Text: Wheel-running ctivity hs secondry effects on ehvior Previous studies utilized wheel-running ctivity to ssy the influence the cycles on circdin rhythms 1, 2. Since wheel
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
The Journal of Physiology
J Physiol 595.13 (2017) pp 4189 4206 4189 mtor folte sensing links folte vilility to tropholst cell function Fredrick J. Rosrio 1,TheresL.Powell 1,2 nd Thoms Jnsson 1 1 Division of Reproductive Sciences,
Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via
Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces
Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
FoxP3 + regulatory CD4 T cells control the generation of functional CD8 memory
Received Fe Accepted 6 Jul Pulished 7 Aug DOI:.8/ncomms99 FoxP + regultory CD T cells control the genertion of functionl memory M.G. de Goër de Herve,,, S. Jfour,,, M. Vllée, & Y. Toufik, During the primry
Gender difference in the activity but not expression of estrogen receptors a and b in human lung adenocarcinoma cells
Endocrine-Relted Cncer (26) 13 113 134 Gender difference in the ctivity ut not expression of estrogen receptors nd in humn lung denocrcinom cells Susn M Dougherty 1, Willird Mzhwidz 1, Aimee R Bohn 1,
The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages
The endoplsmic reticulum is the site of cholesterol-induced cytotoxicity in mcrophges Bo Feng 1, Pin Mei Yo 1, Ynkun Li 1, Cecili M. Devlin 1, Djun Zhng 1, Hether P. Hrding 2, Michele Sweeney 3, Jmes X.
Polymer-Coated Metal-Oxide Nanoparticles Inhibit IgE Receptor Binding, Cellular Signaling, and Degranulation in a Mast Cell-like Cell Line
www.mterilsviews.com Polymer-Coted Metl-Oxide Nnoprticles Inhiit IgE Receptor inding, Cellulr Signling, nd Degrnultion in Mst Cell-like Cell Line Vn. Orteg, Jmes D. Ede, Dvid oyle, Jmes L. Stfford, nd
Axl Promotes Cutaneous Squamous Cell Carcinoma Survival through Negative Regulation of Pro-Apoptotic Bcl-2 Family Members
ORIGINAL ARTICLE Axl Promotes Cutneous Squmous Cell Crcinom Survivl through Negtive Regultion of Pro-Apoptotic Bcl-2 Fmily Memers Emmnouil S. Ppdkis 1, Monik A. Cichoń 1, Jshmin J. Vys 1, Nkul Ptel 1,
The role of insulin and glucose in goose primary hepatocyte triglyceride accumulation
1553 The Journl of Experimentl Biology 212, 1553-1558 Pulished y The Compny of Biologists 2009 doi:10.1242/je.022210 The role of insulin nd glucose in goose primry heptocyte triglyceride ccumultion Chunchun
Supplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
Supporting information
Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,
Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model
Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel
CheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
SUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
IGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
Cos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity