Microscopy Service 2019
|
|
|
- Sharlene Carr
- 5 years ago
- Views:
Transcription
1 Confocal (7) Leica STED 3X Microscopy Assisted Self Use Off Hours Leica SP5 DM Assisted Leica SP5 DMI Assisted Olympus FV0 Multiphoton Assisted Yokogawa Spinning Disk Confocal Assisted Zeiss LSM780 Assisted Zeiss LSM880 Airyscan Assisted Image Analysis Software (2) 2D3D Analysis Assisted Self Use Off Hours D Image Analysis Assisted Self Use Off Hours 9.27 Widefield (6) AxioImager Assisted Self Use Off Hours AxioImager. Z2M (Motorized) Assisted Self Use Off Hours Live Cell Olympus Assisted Olympus Stereoscope MVX10 Assisted Leica DMi8 Assisted Zeiss AxioPlan2 Assisted Electron Microscope (2) Hitachi 7000 Electron Microscope Assisted Self Use Off Hours Hitachi 7700 Electron Microscope Assisted Self Use Off Hours Page 1
2 Ancillary EM Equipment (1) Leica UltraMicrotome UC7 Assisted Self Use Off Hours Lightsheet (1) LaVision UltraMicroscope II Assisted Self Use Off Hours ELECTRON MICROSCOPY Tissue Preparation (training) (Electron Microscope) 2, Staff Assistance Perfusionsmall animal model (First) Perfusionsmall animal model subsequent (28) Perfusionlarge animal model (First) Perfusionlarge animal model (Second) Vibratome sectioning, small model Vibratome sectioning, large model (based on volume/blocks) 1.03 Embedding EPON Tissue Embedding EPON Cell Culture Embedding EPON Subcellular Fraction Embedding (Myelin) Tissue Embedding LOWICRYL Tissue Embedding LOWICRYL Subcellular Fraction Immunogold Labeling Sectioning semithick (ToluidineBlue stained) (per block) Sectioning semithick & ultrathin (per block) Sectioning semithick and serial ultrathin sections (per block) Counterstaining (Uranyl Acetate and Lead Citrate) (per run) Immunogold labeling (per antibody) Negative staining (e.g., viral suspension) (per sample) Subcellular fraction pellets/nanoparticles embedding, Lowicryl6 samples (1 run) Corelative confocal/em CLEM (per sample) Array tomography(at) Carbon Coat AT sectioning (per sample) Training Tissue Preparation (18) Perfusion small animal model (Training) Perfusionlarge animal model (Training) Vibratome sectioning, small model (Training) Vibratome sectioning, large model (Training) Embedding EPON (Training) Embedding LOWICRYL (Training) Sectioning semithick Toluidine Blues stained (Training) Sectioning semithick & ultrathin (Training) Sectioning semithick and serial ultrathin sections (Training) Counterstaining (Uranyl Acetate and Lead Citrate) (Training) Lowicryl embedded immunogold labeling (Training) Negative staining (e.g., viral suspension) (Training) Subcellular fraction pellets/nanoparticles embedding, Epon (Training) Subcellular fraction pellets/nanoparticles embedding, Lowicryl (Training) Cell culture see EPON embedding sample (Training) Corelative confocal/em cell culture sample (Training) Array tomography(at) see Lowicryl embedding (Training) AT sectioning (Training) Page 2
3 Irradiator 15 min. Appointment (1/min) * Will remain at 15 as per Dr. Kelley* Page 3
4 Sorter (6) CSM4L Flow Cytometry CSM5L IMI3L IMI5L Influx Assisted.00 Syd Analyzer (8) CantoII.00 Assisted.00 LSRIIA.00 Assisted.00 LSRIIB.00 Assisted.00 Aurora 60 Assisted Attune Assisted i15cantoii Assisted i15fortessa Assisted i11fortessa Assisted Page 4
5 Mouse Genetics Pronuclear Injection C57Bl/6 Hybrid or FVB Inbred (Pronuclear Injection) 3,068 Pronuclear Injection C57Bl/6 Inbred or Other Inbred Lines (Pronuclear Injection) 3,838 Pronuclear Injection for Preimplantation Embryos: C57Bl/6 Hybrid or FVB Inbred (Pronuclear Injection) 2,299 Pronuclear Injection for MidGestation Embryos: C57Bl/6 Hybrid or FVB Inbred (Pronuclear Injection) 2,605 Genome Editing (CRISPR) Hybrid (Genome Editing) 3,068 Genome Editing (CRISPR) Inbred (Genome Editing) 3,838 IVF rederivation (IVF rederivation) 1,534 IVF Recovery from Cryopreserved Sperm (IVF Recovery) 1,534 Cryopreserved embryo recovery (Cryopreserved embryo recovery) 1,295 ES cell injection (ES cell injection) 1,295 ES Cell Injection MidGestation Embryos (ES Cell Injection for MidGestation Embryos) 1,099 ES Cell Injection Preimplantation Embryos (ES Cell Injection for PreImplantation Embryos) 970 ES Cell Karyotyping (ES Cell Karyotyping) 198 Sperm cryopreservation Basic (Basic Sperm Cryo) 520 Sperm cryopreservation Plus (Sperm CryoPlus) 905 Embryo rederivation (Embryo Rederivation) 1,295 Shipment of Cryopreserved Sperm (Shipment of Cryopreserved Sperm) 171 Mouse Embryos (Mouse Embryos) 568 ES Cell Derivation from existing lines (ES Cell Derivation ) 3,120 ES Cell Subcloning (ES Cell Subcloning) 3,068 GermFree IVF Rederivation (IVF rederivation) 2,271 GermFree Embryo Rederivation (Embryo Rederivation) 2,271 Embryo rederivations or recovery 1,295 ES cell generation from existing lines 3,120 ES cell injection 1,295 ES Cell Injections for MidGestation Embryos 1,099 ES Cell Injections for PreImplantation Embryos 970 ES cell Karyotyping (per clone) 198 ES cell subcloning 3,068 GermFree Embryo Rederivation 2,271 GermFree IVF Rederivation 2,271 Health Testing 125 IVF rederivations or recovery 1,534 Mouse Embryos 568 Pronuclear injection (hybrid) 3,068 Pronuclear injection (inbred) 3,838 Pronuclear Injection for MidGestation Embryos: C57Bl/6 Hybrid or FVB Inbred 2,605 Pronuclear Injection for Preimplantation Embryos: C57Bl/6 Hybrid or FVB Inbred 2,299 Shipment of Cryopreserved Sperm 171 Sperm cryopreservation (basic/per male) 520 Sperm cryopreservation (plus/per male) *In addition to the service fees listed above, the cost of the mice used for each day of a project will be paid by the requesting investigator. All projects that result in the production of mice will also be assessed a health testing fee (health testing is required prior to transfer of animals from the CoRE production room to a requesting investigator s animal housing room). Page 5
6 Service Allelic discrimination run (qpcr plate read) CNVNanostring assays* Digital PCR: Droplet generator and reader* DNA/RNA extraction from FFPE DNA/RNA extraction from tissue DNA/RNA extraction from whole blood RNA extraction from cell using Qiagen Universal Biorobot ElementsNanostring assays* IncRNANanostring assays* mirnananostring assays* mrnananostring assays* Nanostring scanner usage PCR assay set up ussing Beckman Biobek robot (384 well) Pinworm/ Helicobacter Assays Plate Purchase Multiples of 10 Primer design, synthesis, and validation (SYBR) Realtime PCR plate run (384 well) Realtime PCR plate run (96 well) # Reverse Transcription SNP assay development SYBRgreen realtime PCR assays (in triplicates) Taqman assay development TaqMan probe acquisition Taqman realtime PCR assays (in triplicates) qpcr Unit 2019 Plate Sample Min Sample Min. 2.06/Sample Sample Sample Min Sample Min Sample Min Sample Min Sample Plate Assay Plate Plate Sample Per SNP Per Sample/Gene 4.12 Per Assay Per probe Per sample/gene 5.15 Page 6
7 Freezer Farm Box in 80 Freezer 5 Shelf in 80 Freezer 25 One 80 Freezer 200 Page 7
Microscopy Service 2019 Confocal Leica STED 3X Assisted $ 121
Microscopy Confocal Leica STED 3X Assisted $ 121 Self Use $ 54 Self Use Off Hours $ 27 Leica SP5 DM $ - Assisted $ 104 Self Use $ 37 Leica SP5 DMI $ - Assisted $ 114 Self Use $ 47 Olympus FV1000 Multiphoton
Reproductive Engineering Techniques in Mice
Reproductive Engineering Techniques in Mice Preface In recent years, the number of genetically engineered mice being produced has increased dramatically. Moreover, the rapid progress in the development
Genotype analysis by Southern blots of nine independent recombinated ES cell clones by
Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
SUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,
JCB. Supplemental material. Gu et al.,
Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L
Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome
Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Patient Price List. t: e: w:
Patient Price List t: 0333 015 9774 e: enquires@ivi.uk w: www.ivi.uk fertility treatments Pre Treatment Medical Consultation 250 Nurse Planning 200 Baseline ultrasound scan of uterus and ovaries included
Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
Avian Influenza A H5N8
TM Primerdesign Ltd Avian Influenza A H5N8 Hemagglutinin (HA) gene & Neuraminidase (NA) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian Influenza
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Epstein-Barr Virus: Stimulation By 5 '-Iododeoxy uridine or 5 '-Brom odeoxy uridine in Human Lymphoblastoid Cells F ro m a Rhabdom yosarcom a*
A n n a ls o f C l i n i c a l L a b o r a t o r y S c i e n c e, Vol. 3, No. 6 Copyright 1973, Institute for Clinical Science Epstein-Barr Virus: Stimulation By 5 '-Iododeoxy uridine or 5 '-Brom odeoxy
EMMA Cryopreservation Workshop Novel concepts in mouse production and preservation
EMMA Cryopreservation Workshop Novel concepts in mouse production and preservation Consejo Superior de Investigaciones Cientificas Madrid, Espagna May 7-8, 2012 K. C. Kent Lloyd, DVM, PhD University of
Supporting Information
Supporting Information Bertolini et al. 10.1073/pnas.0905653106 SI Text Lung Tissue Disaggregation. Solid tissues were finely minced by razorblade, washed in DMEM/F12 (Lonza), and then incubated with Accumax
Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,
Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
ncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Supplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
AmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Enzyme-activatable Probe with a Self-immolative Linker for Rapid and Sensitive
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Cryopreservation and rederivation of mouse strains
www.oulu.fi/biocenter/tg-core Cryopreservation and rederivation of mouse strains Raija Soininen Biocenter Oulu University of Oulu Finnish INFRAFRONTIER-EMMA node Insurance against loss Accident/Catastrophe
Human Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
Temperature-Sensitive Mutants Isolated from Hamster and
JOURNAL OF VIROLOGY, Nov. 1975, p. 1332-1336 Copyright i 1975 American Society for Microbiology Vol. 16, No. 5 Printed in U.S.A. Temperature-Sensitive Mutants Isolated from Hamster and Canine Cell Lines
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Supplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
Avian influenza A virus subtype (H5)
TM Primerdesign Ltd Avian influenza A virus subtype (H5) Haemoglutinin H5 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype
QIAGEN's Growing Immuno-Oncology Testing Portfolio
QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)
ISOLATION OF A SARCOMA VIRUS FROM A SPONTANEOUS CHICKEN TUMOR
ISOLATION OF A SARCOMA VIRUS FROM A SPONTANEOUS CHICKEN TUMOR Shigeyoshi ITOHARA, Kouichi HIRATA, Makoto INOUE, Masanori Veterinary Pathology, Faculty of Agriculture, Yamaguchi University* HATSUOKA, and
Identification of Microbes Lecture: 12
Diagnostic Microbiology Identification of Microbes Lecture: 12 Electron Microscopy 106 virus particles per ml required for visualization, 50,000-60,000 magnification normally used. Viruses may be detected
Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
REPRODUCTIVE BIOTECHNOLOGY IN SWINE
REPRODUCTIVE BIOTECHNOLOGY IN SWINE References * Animal breeding and infertility by M. J. Meredith * Controlled reproduction in pigs by I. Gordon * Reproduction in farm animals by E.S.E. Hafez * Progress
Cryopreservation in Australia
Cryopreservation in Australia The Australian Phenome Bank Stuart Read, PhD APB Curator stuart.read@anu.edu.au 21 May 2012 1 Mouse Models Created, Characterised, Cryopreserved Mouse Models Created, Characterised,
Osteoclast Culture Kit
K-ASSAY KAMIYA BIOMEDICAL COMPANY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 CC-109 Mouse Osteoclast Precursor Cells,
Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
CRYOPRESERVATION OF SEMEN FROM TESTICULAR TISSUE
INFERTILITY & IVF MEDICAL ASSOCIATES OF WESTERN NEW YORK CRYOPRESERVATION OF SEMEN FROM TESTICULAR TISSUE BUFFALOIVF.COM When you have scheduled your appointment with Dr Crickard or Dr Sullivan to sign
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Swine H1N1 Influenza Human Pandemic Strain
TM Primerdesign Ltd Swine H1N1 Influenza Human Pandemic Strain M1 - global Influenza A & N1- specific for Swine H1N1 Influenza Human Pandemic Strain genesig Standard Kit 150 tests For general laboratory
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Chemokine Regulation of Oligodendrocyte Development in the Spinal Cord. Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011
Chemokine Regulation of Oligodendrocyte Development in the Spinal Cord Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011 Richard J. Miller, PhD Northwestern University Feinberg School
Avrahami et al., Suppression of p57kip2 allows successful replication of adult human -cells
Avrahami et al., Suppression of p57kip2 allows successful replication of adult human -cells Legends to Supplementary Figures Supplementary Figure 1. A. Suppression of p57 Kip2 in human islets does not
SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
Rotavirus A. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
For Research Use Only Ver
INSTRUCTION MANUAL Quick-RNA Viral Kit Catalog Nos. R1034 & R1035 Highlights Quick, spin-column purification of viral RNA from plasma, serum, CSF, cell culture media, cellular suspensions, urine, blood,
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Avian influenza A virus subtype (H7)
TM Primerdesign Ltd Avian influenza A virus subtype (H7) Haemoglutinin H7 gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype
Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
Supplementary materials
Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds
MEGA Assay. Modernizing quality control in IVF.
MEGA Assay Modernizing quality control in IVF MEGA assures product consistency through: Analysis of pre-implantation embryo development and health by gene expression in addition to morphology Increased
Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.
PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded
Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma
Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..
INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
Human Influenza Types A(M1) & B and Respiratory Syncytial Virus. genesig PLEX kit. 100 tests. Primerdesign Ltd
Primerdesign Ltd Human Influenza Types A(M1) & B and Respiratory Syncytial Virus genesig PLEX kit 100 tests For general laboratory and research use only 1 Introduction FluA-M1 & FluB Influenza, commonly
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's
Swine H1N1 Influenza Human Pandemic Strain
TM Primerdesign Ltd Swine H1N1 Influenza Human Pandemic Strain M1 - global Influenza A & N1- specific for Swine H1N1 Influenza Human Pandemic Strain genesig Advanced Kit 150 tests For general laboratory
ELECTRON MICROSCOPIC STUDIES ON EQUINE ENCEPHALOSIS VIRUS
Onderstepoort]. vet. Res. 40 (2), 53-58 (1973) ELECTRON MICROSCOPIC STUDIES ON EQUINE ENCEPHALOSIS VIRUS G. LECATSAS, B. J. ERASMUS and H. J. ELS, Veterinary Research Institute, Onderstepoort ABSTRACT
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are