THE STUDY OF PHOSPHATE TRANSPORTER NAPI2B EXPRESSION IN DIFFERENT HISTOLOGICAL TYPES OF EPITHELIAL OVARIAN CANCER

Transcription

1 Experimentl Oncology 31, 37 42, 2009 (Mrch) 37 Exp Oncol , 1, THE STUDY OF PHOSPHATE TRANSPORTER NAPI2B EXPRESSION IN DIFFERENT HISTOLOGICAL TYPES OF EPITHELIAL OVARIAN CANCER V. Gryshkov 1, I. Gonchruk 2, V. Gurtovyy 3, Yu. Khozhyenko 3, S. Nesprydko 2, L. Vorobjov 2, V. Usenko 3, I. Gout 1, 4, V. Filonenko 1, *, R. Kiymov 1 1 Deprtment of Cell Signling, Institute of Moleculr Biology nd Genetics NAS of Ukrine, Kyiv, 03680, Ukrine 2 Ntionl Cncer Institute, Kyiv, 03022, Ukrine 3 Reserch nd Production Center Medicl technologies, Dnipropetrovsk 49000, Ukrine 4 Deprtment of Structurl nd Moleculr Biology, University College London, London WC1E6BT, United Kingdom The identifiction of mrkers tht re specificlly expressed by different histologicl types of epithelil ovrin cncer (EOC) my led to the development of novel nd more specific dignostic nd therpeutic strtegies. Sodium-dependent phosphte trnsporter NPi2b (or MX35 ovrin cncer ntigen) is novel perspective mrker of EOC. To dte, the studies on NPi2b/MX35 expression in different histologicl types of EOC re limited. Aim: To exmine NPi2b/MX35 expression in different histologicl types of epithelil ovrin tumors. Methods: Here, we describe the nlysis of NPi2b expression in serous (n = 17), endometrioid (n = 8), nd mucinous ovrin tumors (n = 3) by Western-blotting (WB), immunohistochemistry nd RT-PCR. Results: The results of immunohistochemicl nd WB nlysis showed tht benign nd well-differentited mlignnt ppillry serous tumors s well s well-differentited mlignnt endometriod tumors overexpress NPi2b protein. However, no overexpression of NPi2b ws detected in benign nd mlignnt mucinous tumors s well s in poorly differentited endometriod tumors. Notbly, the expression NPi2b mrna ws detected in ll investigted histologicl types of EOC. Conclusion: We hve shown the differentil expression profile of NPi2b phosphte trnsporter t protein level in vrious histologicl types of epithelil ovrin cncer. This finding might fcilitte the development of more effective pproches for dignosis nd tretment of this disese. Key Words: epithelil ovrin cncer, tumor mrkers, phosphte trnsporter NPi2b. Ovrin cncer is the most common cuse of deth from cncers of the femle genitl trct [1 4]. The high mortlity rte results in prt from the frequent dignosis of ovrin cncer t dvnced stges. Epithelil tumors of ovry comprise 58% of ll ovrin neoplsms nd more thn 90% of mlignnt tumors of ovry [5]. EOC rises from ovrin surfce epithelium (OSE) tht hs uncommitted phenotype nd retins the cpcity to differentite into different types of cells in response to environmentl signls [6]. During ovrin crcinogenesis, the epithelium of ovry could differentite into fllopin tube epithelium (ppillry serous tumors), endomethril epithelium (endomethrioid tumors), colonic or endocervicl epithelium (mucinous tumors) nd component of endometriosis (cler cell tumors). The histologicl nlysis of EOC indicte tht ppillry serous tumors represent 50 60% of ll ovrin cncers, nd the remining tumors exhibit endometrioid (25%), mucinous (4%) nd cler cell (4%) histology [7]. It is obvious tht the observed tumor heterogeneity hs moleculr bsis, nd the identifiction of moleculr mrkers specific for different histologicl types of epithelil ovrin cncer cn led to the development of more effective tretment pproches. Received: Jnury 8, *Correspondence: Fx: +38 (044) E-mil: filonenko@imbg.org.u Abbrevitions used: EOC epithelil ovrin cncer; IH immunohistochemistry; OSE ovrin surfce epithelium; SLC34A2 solute crrier fmily 34 (sodium phosphte), member 2; WB Western-blotting. Recently, studies from collbortive consortium hve led to the identifiction of sodium-dependent phosphte trnsporter NPi2b s ovrin cncer ntigen, termed MX35 [8]. The identity of MX35 ntigen ws confirmed by screening of ovrin cncer cell line OVCAR3 cdna expression librry with monoclonl ntibody MX35 nd by ffinity purifiction of MX35 ntigen followed by mss spectrometry. MX35 ntigen ws originlly identified with the use of monoclonl ntibody MX35, obtined from mice immunized with fresh ovrin crcinom cells nd selected by extensive nlysis of norml nd mlignnt tissues nd cell lines. Biochemicl nd immunohistochemicl studies reveled tht MX35 MAb recognizes cell surfce glycoprotein with moleculr wight of bout 95 kd, which is overexpressed in 90% ovrin cncer specimens but shows restricted expression in norml tissues. Clinicl studies with Fb frgments of rdiolbeled MX35 ntibody suggest therpeutic potentil in ptients with ovrin cncer [9, 10]. The humn sodium-dependent phosphte trnsporter NPi2b is encoded by SLC34A2 gene, nd belongs to the type II fmily of sodium-dependent phosphte trnsporters (SLC34 fmily). It is involved in mintining the homeostsis of inorgnic phosphte in humn body by regulting intestinl Pi bsorption [11]. In norml tissues, the expression of NPi2b t the protein level is restricted to smll intestine [12], lung [13], liver [14], mmmry nd slivry glnds [15, 16]. The overexpression of NPi2b trnsporter ws reveled in epithelil ovrin crcinoms by SAGE nlysis nd rel-time RT-PCR [17]. However, there re

2 38 Experimentl Oncology 31, 37 42, 2009 (Mrch) lmost no dt concerning the expression of NPi2b/ MX35 protein by different histologicl types of EOC. The investigtion of NPi2b expression by different histologicl types of EOC might provide the insight on its prognostic vlue nd the potentil for developing immunotherpeutic pproches in ovrin cncer. In this study, we compred the expression of NPi2b protein between norml ovrin tissues nd different histologicl types of EOC, such s serous, endometroid nd mucinous ovrin tumors. MATERIALS AND METHODS Tissue smples. Tumor smples were obtined from ovrin cncer ptients (n = 28) dmitted for tumor resection t the Ntionl Cncer Institute (Kyiv, Ukrine). The types of EOC were confirmed by histopthologicl exmintion t the Deprtment of Ptholo gy, Ntionl Cncer Institute (Kyiv, Ukrine). Norml ovrin tissue smples (n = 10), obtined during surgicl tretment of the ptients with endometril cncer (men ge 46 yers, rnge yers), were used s the control. The men ge of ptients with ovrin cncer 47 yers (rnge yers). The study ws pproved by the Ethics Committee of the Institute of Moleculr Biology nd Genetics, nd consent forms were obtined from ll ptients. Western-blot nlysis. We hve nlyzed NPi2b expression in 28 ovrin cncer smples nd 10 norml ovrin tissue smples. Tissues smples were homogenized in RIPA buffer (20 mm TrisHCl, ph 7.5, mm NCl, 1 mm EDTA, 1% NP-40, 0.1% SDS) supplemented with PMSF (Sigm, Steinheim, Germny), nd Protese Inhibitor Cocktil (Sigm, Steinheim, Germny) nd then centrifugted t 4 C for 30 min. Soluble frctions of lystes (50 μg per smple) were seprted by 8% SDS-PAGE t non-reducing conditions. Seprted proteins were trnsferred to PVDF membrne for 2 h t 80 V (Perkin Elmer, Boston, MA) using wet trnsfer cell (Phrmci Biotech). After the trnsfer, the membrne ws blocked in PBST buffer (1 x PBS with 0.05 % Tween), contining 3% BSA nd then incubted with nti-npi2b (0.5 mg/ml) mab [18] t 4 C overnight. After extensive wshing in PBST buffer, the membrne ws incubted with nti-mouse IgG secondry ntibody (1 : 5000) for 1 h (Promeg, Mdison, WI). The immune complexes were detected by ECL system (Amershm, Uppsl, Sweden). GAPDH ws used s loding control. Immunohistochemistry. Immunohistochemicl nlysis of ovrin cncer smples with nti-npi2b MAbs ws performed ccording to stndrd protocol. Briefly, representtive sections of ovrin tumors were prepred from prffin blocks. Endogenous peroxidse ws quenched with H 2 O 2 (3%) in 0.01% PBS. After blocking of non-specific binding with vidin-biotin blocking solution (Vector Lbortories, Burlingme, CA, USA), tissue sections were incubted overnight t 4 C with nti-npi2b mab (10 µg/ml). Then, sections were incubted with biotinylted secondry ntibodies for 2 h t room temperture t 1 : 400 dilution (got nti-mouse biotinylted IgG, Sigm, Steinheim, Germny), followed by incubtion with vidin-biotinperoxidse complex (Vector Lbortories, Burlingme, CA, USA) for 30 min t RT nd developed with diminobenzidine solution. Hemtoxylin ws used for counterstining. Stndrd microscopy ws performed using Zeiss Universl microscope (Zeiss, Jen, Germny), nd imges were cptured using digitl Axiocm softwre. Totl RNA isoltion nd RT-PCR nlysis. Totl RNA ws isolted by cid gunidinum-thiocyntephenol-chloroform extrction procedure [19]. Briefly, 1 ml of denturtion solution (4 M gunidinium thiocynte, 25 mm sodium citrte, ph 7.0, 5% srcosyl, 0.1 M 2-mercptoethnol) ws dded to 100 mg of homogenized tissues. Sequentilly, 0.1 ml of 2 M sodium cette, ph 4, 1 ml of phenol (wter sturted), nd 0.2 ml of chloroform-isomyl lcohol mixture (49 : 1) were dded to the homogente. After centrifugtion t g for 20 min t 4 C, totl RNA ws precipitted from queous phse with the sme volume of isopropnol t 20 C for 1 h. The pellet ws resuspended in 75% ethnol, ir dried nd dissolved in 50 μl nuclese-free wter. Totl RNA (5 μg) ws converted to cdna with M- MuLV Reverse Trnscriptse (Ferments) t 37 C for 60 min using oligo dt primers. Produced cdna (100 ng) were mplified using following primers forwrd GTCATCACTAAGCCCTTCACA nd reverse CAGGCAACCACAGAGGAC for 30 cycles in 50 μl totl volume of PCR buffer 5 x PCR (Ferments) contining 10 mm dntp, one unit Tq polymerse, 20 pmol of ech primer. The mplifiction ws performed in DNA Therml cycler (Perkin Elmer) under following conditions: 94 C for 60 s, 60 C for 30 s nd 72 C for 60 s. Amplified products were seprted on 1% grose gel nd visulised. RESULTS In this study, we hve exmined NPi2b expression in ovrin tumors of serous, endometroid nd mucinous histology. In pnel of 28 ovrin tumors, there were 17 serous tumors (3-cystdenoms, 1 ppillry cystdenom nd 13 ppillry crcinoms); 8 endometrioid tumors (1 cystdenom, 4 well-differntited nd 3 poor-differentited crcinoms); nd 3 mucinous tumors (1 cystdenom, nd 2 crcinoms) (Tble). The techniques of Western blot, immunohistochemistry nd RT-PCR were employed to exmine the expression profile of NPi2b in these tumors nd to compre them with norml ovrin tissues. Tble. The chrcteriztion of nlyzed ovrin cncer smples Histologicl type of Number of mlignnt smples Number of EOC (including type of differentition) benign smples Serous Ppillry 13, w/d 1 Non-ppillry 3 Endometrioid 4, w/d 1 3, p/d Mucinous 2, n/ 1 Notes: w/d well-differentited; p/d poor-differentited; n/ not vilble. Immunoblot nlysis of NPi2b expression in ovrin smples ws performed t non-reduced conditions using monoclonl ntibody rised ginst the extrcellulr

3 Experimentl Oncology 31, 37 42, 2009 (Mrch) 39 loop of humn NPi2b ( ). The specifity of nti-npi2b MAb ws tested with the use of recombinnt NPi2b expressed in bcteri s GST fussion protein (Fig. 1, ). Furhtermore, using WB we hve confirmed the expression of endogenous NPi2b protein in ovrin cncer cell line (OVCAR3), kidney crcinom cell line (SKRC18) tht re MX35 positive cell lines, nd HEK293 stbly expressing NPi2b protein (Fig. 1, b). It hs been previously demonstrted tht NPi2b protein is recognized on WB s pnel of immunorective bnds with different moleculr weights, reflecting the stte of the protein glycosyltion [12 16, 20 22]. The results presented on Fig. 1, c show tht NPi2b is recognized in ovrin tumor tissue lystes s bnd with moleculr weight of 100 kd. Notbly, only some ovrin tumors overexpress NPi2b. Further nlysis hs indicted tht the expression of NPi2b is detected in ll (13/13) investigted smples of ppillry serous tumors. In the cse of benign serous tumors, NPi2b expression ws detected only in ppillry cystdenom (1/1), wheres serous cystdenoms with non-ppillr structure did not express NPi2b (0/3) (see Fig. 1, c). In endometrioid tumors NPi2b expression ws found in some of tested tumors. Interestingly, welldifferentited endometrioid crcinoms (4/4) were chrcterized by overexpression of NPi2b, while poor-differentited endometrioid crcinoms (0/3) nd endometrioid cystdenom (0/1) did not express detectble level of Npi2b (see Fig. 1, c). The expression of NPi2b protein in WB ws not detected in mucinous cystdenom (0/1) nd mucinous crcinoms (0/2) s well s in control ovrin lystes (0/10) (see Fig. 1, c). c OVCAR-3 SKRC-18 HEK293 HEK293/NPi2b GST/NPi2b-ECL b 45 kd 100 kd +IPTG IPTG 100 kd kd Fig. 1. Western-blot nlysis of NPi2b protein with the use of nti- NPi2b MAb generted ginst extrcellulr loop (ECL) of NPi2b., Expression of GST/NPi2b-ECL in bcteri ws induced by 1 mm IPTG. Totl lystes were resolved by SDS-PAGE nd probed with nti-npi2b MAb. b, Endogenous expression of NPi2b protein in OVCAR-3, SKRC-18 cell lines nd HEK293 cells stbly expressing NPi2b. c, Expression of NPi2b in different types of ovrin cncer nd norml ovry (upper prt), lne 1 8 ppillry serous crcinom, lne 9 ppillry serous cystdenom, lne 10 serous cystdenom, lne 11 endometrioid cystdenom, lne 12 poor-differentited endometrioid crcinom, lne welldifferentited endometrioid cystdenom, lne 17 mucinous cystdenom, 18 mucinous crcinom, lne norml ovry. GAPDH ws used s loding control (lower prt) We performed immunohistochemicl (IH) detection of NPi2b in ll smples of ovrin tumors mentioned bove nd norml ovrin tissues. Using IH stining the presence of NPi2b ws detected only on the picl surfce of the epithelil cells tht is chrcteristic feture of NPi2b expression. We found tht the surfce epithelium of norml ovry s well s ovrin strom were negtive for NPi2b stining (Fig. 2, ). IH nlysis of serous tumors showed strong stining with nti-npi2b MAb in ppillry serous crcinoms (Fig. 2, b) nd ppillry serous cystdenoms (Fig. 2, c) but no stining ws detected in serous cystdenoms with non-ppillry structures (Fig. 2, d). Moreover, well-differentited endometrioid tumors exhibited strong stining with the use of NPi2b MAb (Fig. 2, e), which ws bsent in poor-differentited nd benign endometrioid tumors. All exmined cses of benign nd mlignnt mucinous ovrin tumors (3) were negtive for NPi2b (Fig. 2, f). The results presented bove indicte good correltion between the expression of NPi2b protein nd the histologicl types of tumors. Differentil pttern of NPi2b protein expression in vrious types of ovrin tumors prompted us to exmine NPi2b protein expression in norml tissues of femle reproductive system, such s fllopin tubes, endometrium nd endocervic. We observed the positive stining with NPi2b MAb in norml fllopin tube epithelium (Fig. 3, ) nd endometrium (Fig. 3, b) but not in endocervicl epithelium (Fig. 3, c). Totl RNA derived from 28 ovrin cncer tissues nd 10 norml ovrin tissues were investigted by RT-PCR nlysis with the use of SLC34A2 specific primers (see Mterils nd Methods), which were designed for unique sequences of SLC34A2 gene. The product of mplifiction (350 bp) ws nlysed on n grose gel. The results presented in Fig. 4, hve shown SLC34A2 mrna expression in ll tissues nlyzed. DISCUSSION We hve recently identified sodium-dependent phosphte cotrnsporter NPi2b s MX35 ntigen, which is known to be overexpressed in 90% of humn ovrin cncers [8, 9]. The pttern of NPi2b expression in norml tissues nd ovrin cncer mkes NPi2b/MX35 ntigen potentil trget for the development of immunotherpeutic nd dignostic pproches of EOC. NPi2b is trnsmembrne glycoprotein tht possesses 8 trnsmembrne domins, lrge extrcellulr loop ( ) with severl potentil sites of glycosyltion, nd the N-nd C-terminl cytoplsmic tils fcing the cytosol [8]. In ddition to MX35 ntibody, we hve recently developed severl monoclonl ntibodies recognizing the extrcellulr loop of humn NPi2b [18]. To our knowledge, the expression of NPi2b/MX35 protein in different histologicl types of EOC hve not been nlysed so fr. The elucidtion of NPi2b expression profile in vrious types of ovrin cncer might be useful not only for understnding moleculr mechnisms of crcinogenesis, but lso for the verifiction of dignosis, prognosis nd tretment strtegies. In this study, we hve nlyzed NPi2b expression t protein nd mrna levels in different types of epithelil ovrin cncer nd norml ovrin tissues. We

4 40 Experimentl Oncology 31, 37 42, 2009 (Mrch) b c d e f Fig. 2. Immunohistochemistry of ovrin tumors nd norml ovries smples with the use of nti-npi2b MAb., norml ovry; b, ppillry serous crcinom; c, ppillry serous cystdenom; d, serous cystdenom; e, well-differentited endometrioid crcinom; f, mucinous cystdenom hve observed good correltion of NPi2b protein expression detected by WB nd IH in ovrin tumor smples of different histologicl types. Our results showed tht NPi2b protein is overexpressed in ppillry serous tumors nd low-grde endometrioid tumors when compred to mucinous ovrin cncer. The most common histologicl type of EOC is ppillry serous crcinoms, which re often ssocited with concentric rings of clcifiction known s psmmom bodies [23]. Notbly, brest nd ppillry thyroid cncers, which re chrcterized by bberrnt expression of NPi2b, re lso ffected by clcifictions [24, 25]. It hs been demonstrted tht the downregultion of the NPi2b trnsport function results in the deposition

5 Experimentl Oncology 31, 37 42, 2009 (Mrch) M b b Fig. 4. RT-PCR nlysis of ovrin tumor smples with SLC34A2 primers () nd primers to bet-ctin (b). Lne 1 ppillry serous crcinom, lne 2 ppillry serous cystdenom, lne 3 serous cystdenom, lne 4 endometrioid cystdeno m, lne 5 welldifferentited endometrioid crcinom, lne 6 mucinous cystdenom, lne 7 mucinous crcinom, lne 8 norml ovry lithisis (PAM) [26]. Bsed on these dt we propose tht the clcifiction in ppillry serous ovrin cncer could be ssocited with the filure of clcium phosphte homeostsis due to the berrnt expression or muttions in NPi2b phosphte trnsporter gene. Since low tumor grde hs been ssocited with good outcome nd survivl [27, 28], the overexpression of NPi2b in well-differentited ppillry serous nd endometrioid crcinoms could be mrker of good prognosis. Our dt correlte well with the results published by with Rngel et l. [17], showing tht well differentited epithelil ovrin tumors tend to express higher level of NPi2b. IH nlysis of norml tissues of femle reproductive system with NPi2b MAb reveled its expression in fllopin tube epithelium nd endometrium, but not in endocervicl epithelium. Since ovrin surfce epithelium of ppillry serous tumors resembles epithelium of fllopin tube, nd endometrioid tumors endometril epithelium, nd mucinous tumors colonic or endocervicl epithelium [29], it is not surprisingly tht only ppillry serous nd endometrioid tumor of low grde overexpressed NPi2b protein. So, the overexpression of NPi2b protein in well-differentited ppillry serous nd endometrioid tumors is linked to differentition of ovrin surfce epithelium into fllopin tubes epithelium nd endometrium, respectively. The expression of NPi2b mrna in different types of EOC showed no correltion with tht of NPi2b protein detected by IH nd WB. We observed mrna NPi2b expression in ll investigted histologicl types of EOC nd did not revel significnt difference between smples with high nd low level of NPi2b protein expression. The bsence of correltion between NPi2b mrna nd protein expression could indicte the regultion of NPi2b expression t the level of trnsltion tht should be further investigted. Our dt concerning NPi2b mrna expression correlte with the dt reported by Rngel et l. [17], showing up-regultion of SLC34A2 expression in serous, endometrioid, mucinous nd cler-cell tumors of EOC by rel-time RT-PCR nlysis. In summry, our dt demonstrte tht phosphte trnsporter NPi2b is overexpressed in well-differentited ppillry serous nd endometrioid ovrin tuc M Fig. 3. Immuhistochemistry of norml fllopin tubes (), endometrium (b), endocervicl epithelium (c) with nti-npi2b mab of clcium phosphte microliths in ptient s lungs. This phenomenon is cused by muttions in SLC34A2 gene of phosphte trnsporter, which finlly mnifests by itself the development of pulmonry lveolr micro-

6 42 Experimentl Oncology 31, 37 42, 2009 (Mrch) mors. Moreover, we found tht differentil expression of NPi2b in EOC my be the consequence of chnges in ovrin epithelium differentition during mlignnt process. The findings of this study might fcilitte the rtionl development of new dignostic modlities nd trgeted therpies of ovrin mlignncies. ACKNOWLEDGMENTS This study ws supported in prt by grnt from the Ntionl Acdemy of Sciences of Ukrine. V. Gryshkov ws supported by short-term fellowship from FEBS to perform the prt of this work t University College London (UCL), United Kingdom. REFERENCES 1. Jeml A, Siegel R, Wrd E, et l. Cncer sttistics. CA Cncer J Clin 2008; 58: Cnnistr SA. Cncer of the ovry. N Engl J Med 2004; 351: Bhool S, Hoskins WJ. Dignosis nd mngement of epithelil ovrin cncer. Obstet Gynecol 2006; 107: Ozols RF, Rubin SC, Thoms GM, Robboy SJ. Epithelil ovrin cncer. In: Hoskins WJ, Young RC, Mrkmn M, Perez CA, Brkt R, Rndll M, eds. Principles nd Prctice of Gynecologic Oncology. Phildelphi, PA: Lippincott Willims & Wilkins 2005; Zoloudek CF. Tumors of the ovry. In: Fletcher C. Dignostic Histopthology of Tumors. New-York, NY: Churchill Livingstone, 3d ed.; 2007: Auersperg N, Wong AS, Choi KC, et l. Ovrin surfce epithelium: biology, endocrinology, nd pthology. Endocr Rev 2001; 22: Frley J, Ozbun LL, Birrer MJ. Genomic nlysis of epithelil ovrin cncer. Cell Res 2008; 18: Yin BWT, Kiymov R, Chu R, et l. Monoclonl ntibody MX35 detects the membrne trnsporter NPi2b (SLC34A2) in humn crcinoms; new trget for cncer immunotherpy. Cncer Immun [seril online] 2008; 8:3. URL: 9. Mttes MJ, Look K, Furukw K, et l. Mouse monoclonl ntibodies to humn epithelil differentition ntigens expressed on the surfce of ovrin crcinom scites cells. Cncer Res 1987; 47: Rubin SC, Kostkoglu L, Divgi C, et l. Biodistribution nd intropertive evlution of rdiolbeled monoclonl ntibody MX35 in ptients with epithelil ovrin cncer. Gynecol Oncol 1993; 51: Murer H, Forster I, Biber J. The sodium phosphte cotrnsporter fmily SLC34. Pflugers Arch Eur J Physiol 2004; 447: Feild JA, Zhng L, Brun KA, et l. Cloning nd functionl chrcteriztion of sodium-dependent phosphte trnsporter expressed in humn lung nd smll intestine. Biochem Biophys Res Commun 1999; 258: Trebert M, Httenhuer O, Murer H, et l. Expression of type II sodium-phosphte cotrnsporter in murine type II lveolr epithelil cells. Am J Physiol 1999; 277: L Frei P, Go B, Hgenbuch B, et l. Identifiction nd locliztion of sodium-phosphte cotrnsporters in heptocytes nd cholngiocytes of rt liver. Am J Physiol Gstrointest Liver Physiol 2005; 288: G Huber K, Muscher A, Breves G. Sodium-dependent phosphte trnsport cross the picl membrne of lveolr epithelium in cprine mmmry glnd. Comp Biochem Phys 2007; 146: Homnn V, Rosin-Steiner S, Strtmnn T, et l. Sodium-phosphte cotrnsporter in humn slivry glnds: moleculr evidence for the involvement of NPT2b in cinr phosphte secretion nd ductl phosphte rebsorption. Arch Orl Biol 2005; 50: Rngel LB, Shermn-Bust CA, Wernyj RP, et l. Chrcteriztion of novel humn ovrin cncer-specific trnscripts (HOSTs) identified by seril nlysis of gene expression. Oncogene 2003; 22: Kiymov R, Gryshkov V, Ovchrenko G, et l. Development of monoclonl ntibodies specific for the humn sodium-dependent phosphte cotrnsporter NPi2b. Hybridom 2008; 27: Siebert PD, Chenchik A. Modified cid gunidinium thiocynte-phenol-chloroform RNA extrction method, which gretly reduces DNA contmintion. Nucleic Acids Res 1993; 21: Xu Y, Yeung C-H, Setiwn I, et l. Sodium-inorgnic phosphte cotrnsporter NPi-IIb in the epididymis nd its potentil role in mle fertility studied in trnsgenic mouse model. Biol Reprod 2003; 69: Lundquist P, Murer H, Biber J. Type II N + -P cotrnsporters in osteoblst minerl formtion; regultion by inorgnic phosphte. Cell Physiol Biochem 2007; 19: Hilfiker H, Httenhuer O, Trebert M, et l. Chrcteriztion of new murine type II sodium-phosphte cotrnsporter expressed in mmmlin smll intestine. Proc Ntl Acd Sci USA 1998; 95: Mki M, Hirot S, Kneko Y, Morohoshi T. Expression of osteopontin messenger RNA by mcrophges in ovrin serous ppillry cystdenocrcinom: possible ssocition with clcifiction of psmmom bodies. Pthol Int 2000; 50: Blnchrd A, Shiu R, Booth S, et l. Gene expression profiling of erly involuting mmmry glnd revels novel genes potentilly relevnt to humn brest cncer. Front Biosci 2007; 12: Głęz-Kulik M, Zebrck J, Szpk-Ulczok S, et l. Expression of selected genes involved in trnsport of ions in ppillry thyroid crcinom. Endokrynol Pol 2006; 57: (in Polish). 26. Corut A, Senyigit A, Ugur SA, et l. Muttions in SLC34A2 cuse pulmonry lveolr microlithisis nd re possibly ssocited with testiculr microlithisis. Am J Hum Genet 2006; 79: Mkr AP, Bekelnd M, Trope CG, et l. The prognostic significnce of residul disese, FIGO substge, tumor histology, nd grde in ptients with FIGO stge lll ovrin cncer. Gynecol Oncol 1995; 56: Shimuzu Y, Kmoi S, Amd S, et l. Towrd the development of universl grding system of ovrin epithelil crcinom. 1. Prognostic significnce of histopthologic fetures problems involved in the rchitecturl grding system. Gynecol Oncol 1998; 70: Seidmn JD, Kurmn RJ. Pthology of ovrin crcinom. Hemtol Oncol Clin North Am 2003; 17: Copyright Experimentl Oncology, 2009