Interdependency of Reactive Oxygen Species generating and scavenging system in salt sensitive and salt tolerant cultivars of rice
|
|
- Ashley Singleton
- 5 years ago
- Views:
Transcription
1 Kur et l. BMC Plnt Biology (2016) 16:131 DOI /s RESEARCH ARTICLE Interdependeny of Retive Oxygen Speies generting nd svenging system in slt sensitive nd slt tolernt ultivrs of rie Nvdeep Kur 1, Mnish Dhwn 1, Ish Shrm 1,2 nd Prtp Kumr Pti 1* Open Aess Astrt Bkground: Slinity stress is mjor onstrin in the glol rie prodution nd hene serious efforts re eing undertken towrds deiphering its remedil strtegies. The omprtive nlysis of differentil response of slt sensitive nd slt tolernt lines is judiious pproh to otin essentil lues towrds understnding the quisition of slinity tolerne in rie plnts. However, dpttion to slt stress is firly omplex proess nd opertes through different mehnisms. Among vrious mehnisms involved, the retive oxygen speies medited slinity tolerne is elieved to e ritil s it evokes sde of responses relted to stress tolerne. In this kground, the present pper for the first time evlutes the ROS generting nd the svenging system in tndem in oth slt sensitive nd slt tolernt ultivrs of rie for getting etter insight into slinity stress dpttion. Results: Comprtive nlysis of ROS indites the higher level of hydrogen peroxide (H 2 O 2 ) nd lower level of superoxide ions (O 2- ) in the slt tolernt s ompred to slt sensitive ultivrs. Speifi tivity of ROS generting enzyme, NADPH oxidse ws lso found to e more in the tolernt ultivrs. Further, tivities of vrious enzymes involved in enzymti nd non enzymti ntioxidnt defene system were mostly higher in tolernt ultivrs. The trnsript level nlysis of ntioxidnt enzymes were in lignment with the enzymti tivity. Other stress mrkers like proline were oserved to e higher in tolernt vrieties wheres, the level of mlondildehyde (MDA) equivlents nd hlorophyll ontent were estimted to e more in sensitive. Conlusion: The present study showed signifint differenes in the level of ROS prodution nd ntioxidnt enzymes tivities mong sensitive nd tolernt ultivrs, suggesting their possile role in providing nturl slt tolerne to seleted ultivrs of rie. Our study demonstrtes tht the ellulr mhinery for ROS prodution nd svenging system works in n interdependent mnner to offer etter slt stress dpttion in rie. The present work further highlights tht the elevted level of H 2 O 2 whih is onsidered s key determinnt for onferring slt stress tolerne to rie might hve originted through n lterntive route of phototlyti tivity of hlorophyll. Keywords: Rie, Slinity, Retive oxygen speies (ROS), NADPH oxidse, Hydrogen peroxide (H 2 O 2 ), Antioxidnt enzymes * Correspondene: pkpti@yhoo.om 1 Deprtment of Biotehnology, Guru Nnk Dev University, Amritsr , Punj, Indi Full list of uthor informtion is ville t the end of the rtile 2016 The Author(s). Open Aess This rtile is distriuted under the terms of the Cretive Commons Attriution 4.0 Interntionl Liense ( whih permits unrestrited use, distriution, nd reprodution in ny medium, provided you give pproprite redit to the originl uthor(s) nd the soure, provide link to the Cretive Commons liense, nd indite if hnges were mde. The Cretive Commons Puli Domin Dedition wiver ( pplies to the dt mde ville in this rtile, unless otherwise stted.
2 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 2 of 13 Bkground Rie is n importnt erel rop tht hs the potentil to provide food seurity to the inresing world popultion. Out of the totl glol griulturl lnd, 150 million hetres is estimted to e under rie ultivtion tht leds to n nnul prodution verging to 500 million metri tons [1]. But lrge mount of the rie iomss is not hrvested under field onditions due to sensitivity of the rop to vrious ioti stresses like drought, slinity, low temperture, het shok [2, 3]. Among these stresses, slinity is mjor onstrin to rie prodution worldwide whih dversely ffet its growth nd development t the moleulr, iohemil nd physiologil level [4, 5]. It ffets more thn 20 % of totl ultivted lnd worldwide tht results in US$12 illion loss in glol griulturl prodution nd this loss is further inresing eh yer [5, 6]. As in the present senrio of glol limte hnge, the level of lnd sliniztion is expeted to inrese nd hene there is n immedite world-wide onern for development of etter slt tolernt ultivrs for future food seurity. For hieving this ojetive, thorough omprtive nlysis of slt sensitive nd tolernt ultivrs oupled with inresed understnding of the underlying mehnism involved in slt stress dpttion is muh wrrnted. Retive oxygen speies (ROS) genertion, signlling nd detoxifition re vitl omponents of slt stress dpttion mehnisms nd priority re of reserh worldwide for the omplishment of etter growth nd yield of rop under slt ffeted res [7]. ROS suh s superoxide rdil (O 2 - ), hydroxyl rdil (OH - ) nd hydrogen peroxide (H 2 O 2 ) re produed in low onentrtion s result of norml ellulr metolism in plnts nd plys importnt role in growth, development nd in dpttion to stress [8]. But, when plnt is sujeted to stress, the perturtion of ROS homeostsis tkes ple whih triggers multiple signlling responses involved in ritil funtions of plnts [9]. Hene, fine tuned lne etween ROS prodution nd svenging is ruil for the plnt survivl under unfvourle onditions. NADPH oxidses re one of the mjor enzyme systems involved in prodution of ROS in the poplsti spe under stress [10]. They tlyze the trnsfer of eletons from NADPH to moleulr oxygen (O 2 ) for the genertion of free rdil O 2- [11]. NADPH oxidses hold distint position mong the vrious ROS generting enzyme systems in plnts euse of their role in different signlling pthwys involved in plnt growth, development nd stress tolerne [12]. Superoxide ions produed s result of enzymti tivity of NADPH oxidse is onverted into H 2 O 2 vi superoxide dismutse (SOD) nd it diffuses to djent ellulr omponents where it ts s signlling moleule tht tivtes vrious stress responsive pthwys. This indites tht the oordintion of ROS generting nd svenging system might ply ritil role in slt stress dpttion mehnism. However, the ext role of NADPH oxidse in onferring slt stress dpttion is not yet properly understood. Erlier studies onduted on slt tolernt ultivr Pokli nd sensitive ultivr IR64 under the effet of slt tretment hs indited definitive link etween svenging system nd slinity tolerne [13]. However, to est of our knowledge no work hs een initited to ompre the ROS generting nd svenging system together in slt sensitive nd tolernt ultivrs. Therefore, in the present study, omprtive study of ROS dynmis ws onduted in slt tolernt (Lun Snkhi nd Lun Suvrn) nd slt sensitive (IR64 nd Pus Bsmti-1) ultivrs of rie. The informtion gined on rel time sitution on this ritil stress lleviting ROS pthwy will filitte in developing ultivrs with etter slt stress dpttion. Further, this work dds to the existing knowledge of our understnding on the omplex physiologil, iohemil nd geneti mehnisms involved in slt stress dpttion. Results Histohemil nlysis of ROS The level of different types of ROS mong slt sensitive nd tolernt ultivrs ws monitored histohemilly using three different dyes (Fig. 1). Nitrozolium lue (NBT) ssy showed higher umultion of drk lue oloured pigment tht estimtes the higher level of O 2- in the rie ultivrs IR64 nd Pus Bsmti-1. On the ontrry to this, 3, 3-diminoenzidine (DAB) showed higher level of H 2 O 2 tht ws ssessed through the intensity of drk rown oloured spots in tolernt ultivrs (Lun Snkhi nd Lun Suvrn). Similrly, stining using 2', 7 -dihlorodihydrofluoresein diette (H 2 DCFDA) whih inds to ROS (predominntly H 2 O 2 ) yielded higher intensity of green fluoresene in tolernt ultivrs s ompred to the sensitive ultivrs. NADPH oxidse tivity ssy The quntittive nlysis of ROS generting NADPH oxidse enzyme tivity showed signifint differene mong four ultivrs of rie (Fig. 2). The enzymti tivity (nmoles min -1 mg -1 ) ws found to e signifintly high in Lun Snkhi (0.424 ± 0.009) followed y Lun Suvrn ± thn the sensitive ultivr IR64 (0.182 ± 0.011) nd Pus Bsmti-1 (0.177 ± 0.028).
3 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 3 of 13 Fig. 1 O2- nd H2O2 umultion in leves of different ultivrs of rie. Leves were exised t the se of stems nd were supplied with different stins. () NBT stining () DAB stining () Confol imges of H2DCFDA stining (d) 3D-view of onfol H2DCFDA stining imges (IR: IR64, PB: Pus Bsmti-1, SA: Lun Snkhi, SU: Lun Suvrn) H2O2 ontent estimtion Antioxidnt enzyme tivity The estimtion of queous H2O2 ontent in four vrieties showed onsiderle differene s expeted on the sis of histohemil ssys (Fig. 2). The ontent of queous H2O2 (units nmoles g-1 FW) ws found to e signifintly more in tolernt ultivrs Lun Snkhi ( ± 0.187) nd Lun Suvrn ( ± 0.585) s ompred to sensitive vrieties IR64 ( ± 0.76) nd Pus Bsmti-1 ( ± 0.340) whih were t pr with eh other. Signifint differenes in the speifi tivity of vrious ntioxidnt enzymes were oserved in different ultivrs (Tle 1). The overll speifi tivity of ll the ntioxidnt enzymes, exept tlse (CAT) ws found to e higher in tolernt ultivrs. SOD tht onverts superoxide ions into hydrogen peroxide showed signifintly higher speifi tivity (units mg protein-1) in Lun Snkhi ( ± ) nd Lun Suvrn ( ± ) with respet to IR64 ( ± )
4 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 4 of 13 NADPH oxidse tivity (nmoles min -1 mg -1 ) IR PB SA SU IR PB SA SU Fig. 2 Comprtive nlysis of () NADPH oxidse tivity nd () H 2 O 2 ontent of 14 dys old seedlings of different rie ultivrs. (IR: IR64, PB: Pus Bsmti-1, SA: Lun Snkhi, SU: Lun Suvrn). Brs represent men ± SE (n = 3). Different letters (,, ) within ultivrs re signifintly different (Tukey LSD, p 0.05) H 2 O 2 ontent (nmoles g FW -1 ) nd Pus Bsmti-1 ( ± ). The speifi tivity of sorte peroxidse (APX) ws ugmented to signifintly higher in Lun Snkhi (26.21 ± 0.301) nd Lun Suvrn (26.13 ± 0.230) s ompred to IR64 (19.85 ± 0.563) nd Pus Bsmti-1 (18.55 ± 0.518) ut on the ontrry the speifi tivity of CAT ws more in sensitive ultivrs IR64 (0.486 ± 0.012) nd Pus Bsmti-1 (0.581 ± 0.003) in omprison to Lun Snkhi (0.277 ± 0.190) nd Lun Suvrn (0.397 ± 0.013) (Tle 1). The enzymes involved in the well known glutthionesorte pthwy lso showed onsiderle differene in their speifi tivity mong different ultivrs. The speifi tivity of glutthione redutse (GR) ws found to e higher in Lun Snkhi (5.98 ± 0.276) nd Lun Suvrn (5.91 ± 0.072) thn IR64 (3.58 ± 0.045) nd Pus Bsmti-1 (4.12 ± 0.112) (Tle 1). Similrly, guiol peroxidse enzyme (GPX) lso showed similr type of trend with higher tivity in Lun Snkhi (68.41 ± 3.45) nd Lun Suvrn (75.51 ± 1.68) followed y IR64 (51.16 ± 1.65) nd Pus Bsmti-1 (51.80 ± 0.40). Dehydrosorte redutse (DHAR) nd monodehydrosorte redutse (MDHAR) tivities were lso found to e high in tolernt ultivrs (Lun Snkhi nd Lun Suvrn) in omprison to the sensitive ones (IR64 nd Pus Bsmti-1) (Tle 1). Expression nlysis of ntioxidnt enzymes The semi-rt PCR nlysis of vrious ntioxidnt genes lso showed higher level of key ntioxidnt enzymes in tolernt ultivrs exept CAT nd Mn-SOD t the trnsript level (Fig. 3). Among the different isoforms of SOD, the trnsript level of Fe-SOD nd Cu/Zn-SOD showed muh higher umultion in Lun Snkhi nd Lun Suvrn. These results were further onfirmed t the protein level with in gel SOD ssy (Fig. 4). On the ontrry, Mn-SOD showed lesser expression in tolernt ultivrs when ompred ginst the sensitive ultivrs. The trnsript level of CAT ws lso found to e more in the sensitive ultivrs (IR64 nd Pus Bsmti-1). However, APX nd GR enzymes were found in the sme type of trend t the trnsript level s followed in their respetive enzymti tivities. Their gene expression ws lso higher in Lun Snkhi nd Lun Suvrn s ompred to the sensitive ones (IR64 nd Pus Bsmti-1). Asorte ontent A notle differene in the redued to oxidised sorte rtio ws found in 4 ultivrs of rie (Tle 1). Tolernt ultivrs Lun Suvrn nd Lun Snkhi showed signifintly higher rtio of (0.905 ± 0.033) nd (0.884 ± 0.017), respetively in ontrst to the sensitive ultivrs IR64 (0.739 ± 0.027) nd Pus Bsmti-1 (0.698 ± 0.011). Totl protein, free proline nd MDA ontent nlysis In this study, we estimted the totl protein ontent in the four ultivrs. The protein ontent (mg FW -1 ) ws found to e signifintly high in tolernt ultivrs Lun Snkhi (14.73 ± 0.275) nd Lun Suvrn (15.22 ± 0.403) with respet to the sensitive ultivrs IR64 (12.75 ± 0.275) nd Pus Bsmti-1(12.85 ± 0.352) (Tle 2). The signifintly enhned ontent of proline (μmoles g FW -1 ) ws found in Lun Snkhi (6.90 ± ) nd Lun Suvrn (6.78 ± ) ginst the sensitive ultivr IR64 (4.29 ± ) nd Pus Bsmti-1 (4.58 ± ) (Tle 2). Further, the level of lipid peroxidtion (μmoles g FW -1 ) ws determined through the estimtion of MDA equivlents
5 Tle 1 Comprtive nlysis of different ntioxidnt enzymes nd sorte ontent in 14 dys old seedlings of different rie ultivrs Cultivr SOD (units mg protein -1 ) APX (μmol min -1 mg protein -1 ) CAT (μmol min -1 mg protein -1 ) GPX (μmol min -1 mg protein -1 ) GR (μmol min -1 mg protein -1 ) DHAR (μmol min -1 mg protein -1 ) MDHAR (μmol min-1 mg protein -1 ) Redued sorte/oxidised sorte rtio IR ± d ± ± ± ± ± ± ± PB ± ± ± ± ± ± ± ± Lun Snkhi ± ± ± ± ± ± ± ± Lun Suvrn ± ± ± ± ± ± ± ± (SOD Superoxide Dismutse, APX Asorte Peroxidse, CAT Ctlse, GPX Guiol Peroxidse, GR Glutthione Redutse, DHAR Dehydrosorte Redutse, MDHAR Monodehydrosorte Redutse). Vlues represent men ± SE (n =3) Different letters (,,, d ) within ultivrs re signifintly different (Tukey LSD, p 0.05) Kur et l. BMC Plnt Biology (2016) 16:131 Pge 5 of 13
6 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 6 of 13 Reltive Expression Reltive Expression Mn-SOD Cu/Zn-SOD EF1 Reltive Expression EF1 Reltive Expression Fe-SOD APX EF1 EF1 Reltive Expression Reltive Expression CAT EF1 GR EF1 Fig. 3 An ethidium romide stined grose gel hrouring produts from reverse trnsriptse-pcr of different key ntioxidnt genes of 14 dys old seedlings of different rie ultivrs. Gel shows the PCR produts fter 35 yles of PCR nd the results were first normlized to the housekeeping gene EF1α. Brs represent men ± SE (n = 3). Different letters (,,, d) within ultivrs re signifintly different (Tukey LSD, p 0.05). (IR: IR64, PB: Pus Bsmti-1, SA: Lun Snkhi, SU: Lun Suvrn) IR PB SA SU Mn-SOD Fe-SOD Cu/Zn-SOD Fig. 4 In-gel nlysis of the pttern of SOD isoenzymes in two slt sensitive nd two slt tolernt ultivrs of rie (IR: IR64, PB: Pus Bsmti-1, SA: Lun Snkhi, SU: Lun Suvrn) Tle 2 Comprtive nlysis of totl protein, proline nd MDA of 14 dys old seedlings of different rie ultivrs Cultivr Protein ontent (mg FW -1 ) Proline ontent (μmoles g FW -1 ) MDA ontent (μmoles g FW -1 ) IR ± ± ± PB ± ± ± Lun Snkhi ± ± ± Lun Suvrn ± ± ± Vlues represent men ± SE (n =3) Different letters (,, ) within ultivrs re signifintly different (Tukey LSD, p 0.05)
7 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 7 of 13 ontent in plnts. The level of MDA ws found to e more in sensitive ultivrs IR64 ( ± 0.058) nd Pus Bsmti-1 ( ± 0.047) thn the tolernt ultivrs Lun Snkhi ( ± 0.206) nd Lun Suvrn ( ± 0.222) (Tle 2). Chlorophyll ontent nlysis A signifint differene in the ontent of hlorophyll, hlorophyll nd totl hlorophyll ws oserved in sensitive nd tolernt ultivrs of rie (Fig. 5). The mximum ontent of hlorophyll (μg/ml) ws found in IR64 ( ± 0.076) followed y Pus Bsmti- 1( ± 0.995) tht ws signifintly higher from the Lun Snkhi ( ± 0.128) nd Lun Suvrn ( ± 0.195). However, the highest ontent of hlorophyll ( ± 0.868) nd totl hlorophyll ( ± 0.772) ws found in Pus Bsmti-1 wheres the minimum ontent of these pigments ws found in Lun Suvrn. Disussion In the present study, it ws oserved tht the tolernt ultivrs (Lun Snkhi nd Lun Suvrn) mintin higher level of H 2 O 2 nd lower level of O 2- s ompred to the sensitive ultivrs (IR64 nd Pus Bsmti-1). H 2 O 2 ts s seondry messenger tht tivtes the vrious stress dptive signlling pthwys t oth geneti nd physiologil levels [14]. It is known to tivte vrious genes involved in the limtion nd tolerne to slt stress [15]. Further, enhned H 2 O 2 prodution in hlophytes is essentil for their slt stress prepredness [16]. Our study indites tht slt tolernt ultivrs Lun Snkhi nd Lun Suvrn re ple of onstitutive tivtion of plnt defene pthwys due to the higher sl level of H 2 O 2 tht in turn keeps the tolernt ultivrs redy for dpttion to slt stress onditions. Hene, H 2 O 2 signtures my e operting in slt stress signlling pthwys in rie tht keeps the defene pthwy networks tivted in tolernt ultivrs [17]. Furthermore, the elevted sl level of H 2 O 2 found in the tolernt ultivrs ould e ttriuted to the higher tivity of NADPH oxidse nd SOD enzyme in Lun Snkhi nd Lun Suvrn tht ws further onfirmed through the estimtion of speifi enzymti tivity of SOD. These findings suggest tht the higher genertion of O 2- in NADPH dependent mnner nd its rpid onversion into signlling moleule H 2 O 2 ould e onsidered s ritil lue in understnding the model depiting etter dpttion of tolernt ultivrs towrds slinity. One the signlling sde hs een initited, plnts re defended to the toxi effets of H 2 O 2 with the help of APX, CAT nd other peroxidses in wy similr to the C 2+ efflux system tht opertes in well-known ytosoli lium signtures [6]. Similrly, in the present work, the speifi tivity of peroxidses APX nd GPX ws found to e high in tolernt vrieties whih ould e svenging the exess of H 2 O 2 to prevent the plnt from its ill effets, wheres the speifi tivity of CAT ws found to e low. The less expression of CAT in tolernt ultivrs ould e due to the ommon sustrte of APX nd CAT nd euse of the higher ffinity of APX for hydrogen peroxide thn CAT [18]. Moreover, APX regultes the role of H 2 O 2 s signlling moleule unlike CAT whih is more involved in detoxifition [15]. Till now, the mjority of reserh on the reltion etween ROS nd slinity tolerne hs een foussed on the enzymti ntioxidnts lthough non-enzymti ntioxidnts lso ply ruil role in svenging exess of ROS nd onferring tolerne [6]. Asorte is known non enzymti ntioxidnt tht plys entrl role in Chlorophyll ontent (µg/ml) d d d IR PB SA SU 0 Chl Chl Totl Chl Fig. 5 Comprtive nlysis of hlorophyll, hlorophyll nd totl hlorophyll in 14 dys old seedlings of different rie ultivrs. Brs represent men ± SE (n = 3). Different letters (,,, d) within ultivrs re signifintly different (Tukey LSD, p 0.05). (Chl: Chlorophyll, IR: IR64, PB: Pus Bsmti-1, SA: Lun Snkhi, SU: Lun Suvrn)
8 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 8 of 13 the sorte glutthione yle [19]. APX uses sorte s redutnt for the svenging of H 2 O 2 nd onverts it into dehydrosorte. But for the mintenne of ntioxidtive pity of sorte, its rpid regenertion into redued form is neessry. APX funtions in omintion with GR, DHAR nd MDHAR in glutthione-sorte pthwy for the regenertion of sorte. In our studies, the speifi tivities of GR, DHAR nd MDHAR enzymes were lso found to e high in tolernt ultivrs. Further the rtio of redued to oxidised sorte ws lso oserved to e high in Lun Snkhi nd Lun Suvrn. This ould e implied to the etter opertion of non-enzymti glutthione-sorte pthwy in tolernt ultivrs whih my e one of the mny resons for their superior slt tolerne ility [19]. Furthermore, the higher tivity of vrious ntioxidnt enzymes (SOD, CAT, GPX, APX, nd GR) in oordinted mnner in slt tolernt ultivrs suggests tht they re the mjor determinnts in the model for depiting slt tolerne. To further understnd the dynmi role of ntioxidnt enzymes in onferring slt tolerne to hlophyti vrieties of rie, their trnsript level expression study ws onduted. Among the different isoforms of SOD, the expression of Fe-SOD nd Cu/Zn-SOD ws found to e high in tolernt ultivrs wheres, the expression of Mn-SOD ws more in sensitive ultivrs. In n erlier study from our lortory, we oserved higher expression of Fe-SOD nd Cu/Zn-SOD in response to slt tretment in Pus Bsmti-1 [20]. Therefore, the higher sl expression level of Fe-SOD nd Cu/Zn-SOD in tolernt ultivrs ould e one of the mny resons for their etter dpttion in slt stress. Furthermore, to get etter insight into the mehnism onferring elevted dpttion to slinity stress in Lun Snkhi nd Lun Suvrn, some of the iohemil stress mrkers were studied. In the present study, enhned level of totl protein in Lun Snkhi nd Lun Suvrn ws oserved whih ould e ttriuted to the synthesis of new or elevted level of proteins linked to stress tolerne in these ultivrs. This result is further strengthened y the report tht enhned synthesis level of proteins is one of the mjor determinnts of stress dpttion in hlophytes [21]. Proline is known osmoprotetnt tht lso plys multiple ntioxidnt roles. Hyperumultion of free proline in plnts is known in onferring slinity tolerne [22, 23]. The higher umultion of free proline in Lun Snkhi nd Lun Suvrn my e plying n importnt role in quenhing of exess of ROS nd stiliztion of ROS-svenging enzymes long with its well known role in osmotium mintinene [24]. Further, with regrd to redued MDA ontent in tolernt ultivrs, our results re in greement to the previous studies where it hs een shown tht higher ntioxidnt enzyme tivities re responsile for low MDA ontent whih in turn inhiits the memrne dmge y ROS nd hene onfers tolerne [25, 26]. It ws interesting to note tht the ontent of hlorophyll, hlorophyll nd totl hlorophyll ws less in the tolernt ultivrs in omprison to sensitive ultivrs. Under slt stress onditions, plnts re often oserved to hve redued hlorophyll ontent [20, 27]. However, nlysis of hlorophyll ontent in slt tolernt nd sensitive ultivrs will provide the physiologil explntion to dpttion of plnt to slinity stress nd hene it is sujet of worth investigtion. In our investigtion the less hlorophyll ontents in tolernt ultivrs my e either due to the ROS medited degrdtion of holorophyll or it ould e phototlyti tivity of holorophyll itself for the prodution of H 2 O 2 [28, 29]. In our se, we presume tht in tolernt ultivrs the slt tolerne ould e ttriuted to the enhned prodution of H 2 O 2, whih my e due to the phototlyti tivity of hlorophyll [30]. Moreover, the role of light in hlorophyll degrdtion hs lso een suggested [31]. Conlusion The tolernt ultivrs of rie mintin high threshold level of H 2 O 2 due to more enzymti tivity of NADPH oxidse nd enough SOD in stok tht my onstitutively tivtes the defene pthwys resulting in higher intrinsi tivity of vrious ntioxidnt enzymes. This provides ertin dptive dvntge to hlophytes over glyophytes euse of whih slt stress does not led to oxidtive stress in tolernt ultivrs. Further, the first time omprtive nlysis of ROS generting system NADPH oxidse in hlophytes nd glyophytes provide ritil lue on understnding the model depiting slt tolerne in rie. We propose tht these two systems work together in synhroniztion with eh other for hieving slt tolerne. It will e interesting to further explore the rosstlk tht exists etween ROS generting nd svenging system for hieving slinity tolerne nd whether this rosstlk opertes in feedforwrd or feedk mnner. Furthermore, the oservtion of degrdtion of hlorophyll for produing higher level of H 2 O 2 nd in turn offering tolerne points out towrds n unhrted mehnism in slt stress dpttion iology. Methods Plnt mteril Four rie ultivrs differing in slt stress tolerne level were seleted for this work. Seeds of two slt sensitive ultivrs viz. IR64 nd Pus Bsmti-1 were proured from IARI (Indin Agriulturl Reserh Institute, New Delhi) nd the seeds of two slt tolernt ultivrs Lun Snkhi nd Lun Suvrn were olleted from CRRI (Centrl Rie Reserh Institute Cuttk, Odish, Indi).
9 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 9 of 13 Lun Snkhi (CR Dhn 405) nd Lun Suvrn (CR Dhn 403) re slt tolernt vrieties of Indin origin tht n tolerte slinity stress in the rnge of 6-8 ds m -1 [31]. Surfe steriliztion nd inoultion Surfe steriliztion of the seeds ws rried out ording to Shrm s method [26]. Helthy nd mture seeds were seleted nd were sterilized using sodium hypohlorite nd meruri hloride. Sterilized seeds were then inoulted in utolved snd moistened with utolved doule distilled wter in plsti oxes nd were kept t 25 ± 2 C temperture with 14 h photoperiod under light intensity of 2000 lux for 14 dys. Histohemil ROS detetion The histohemil level of different types of ROS ws deteted using three different dyes. For the detetion of O 2-, the seond lef of 14 d seedlings ws ut into smll piees nd these piees were vuum infiltered in 6 mm NBT prepred in 10 mm of sodium itrte uffer (ph = 6) for 10 min. They were inuted for 2 h t room temperture nd the hlorophyll ontent of these piees ws then removed y oiling them in solute ethnol till the omplete removl of hlorophyll. After the removl of hlorophyll, piees were oserved under the stereo-mirosope [32]. For the detetion of H 2 O 2, two different stins were used, DAB nd H 2 DCFDA. For the DAB ssy, smll piees of seond lef of 14 d seedlings were vuum infiltered in DAB (1 mg/ml in wter) for 10 min nd were then inuted for 2 h under the drk onditions. Chlorophyll ontent ws removed nd they were oserved under the stereo-mirosope [32]. For H 2 DCFDA ssy, piees of seond lef were inuted in 10 μm H 2 DCFDA nd were vuum infiltered for 5 min. The leves were then wshed with doule distilled wter nd were oserved under the onfol mirosope using lser em of exittion 488 nm [33, 34]. NADPH oxidse ssy Isoltion of plsm memrne proteins Plsm memrne proteins were extrted from the 0.5 g of fresh tissue [13]. The plntlets were homogenized in protein extrtion uffer ontining 0.25 M surose, 50 mm HEPES (ph 7.2), 3 mm ethylenediminetetreti id (EDTA), 1 mm dithiothreitol (DTT), 3.6 mm L- ysteine, 0.1 mm MgCl 2, 0.6 % PVP nd PIC (Protese Inhiitory Coktil). The homogente ws filtered through two lyers of muslin loth nd ws entrifuged t 10,000 g for 45 min t 4 C. Superntnt ws ultrentrifuged t 1, 80, 000 g for 60 min t 4 0 C. The pellet ws resuspended in 10 mm hilled Tris-HCl. The protein ontent ws determined ording to method desried y Brdford [35] using Bovine Serum Alumin (BSA) s stndrd. Spetrophotometri ssy of NADPH oxidse tivity The O 2- generting tivity of NADPH oxidse ws mesured y following the Kundl s method [13]. The ssy mixture ws prepred with 50 mm Tris-HCl uffer (ph 7.5), 1 mm XTT (sodium, 3-[1-[phenylmino-ronyl]-3, 4-tetrzolium]-is(4-methoxy-6-nitro)enzenesulfoni id hydrte), 1 mm NADPH, nd 20 μg of memrne protein. The rte of redution of XTT y O 2 - ws determined spetrophotometrilly t 492 nm using n extintion oeffiient of 2.16 x 10 4 M -1 m -1. Estimtion of queous H 2 O 2 ontent The ontent of queous H 2 O 2 ws estimted using the modified ferrous oxidtion-xylenol ornge (FOX) ssy [13]. 0.5 g of fresh seedlings of 14 d plnts ws homogenised in tivted hrol (0.1 g) prepred in 5 ml of 5 % trihloroeti id. Homogente ws filtered through Whtmnn filter No.1 nd ws entrifuged t 8000 rpm for 10 min. The superntnt ws used for the estimtion of queous H 2 O 2. FOX regent ws prepred using 1 ml of regent (25 mm mmonium ferrous sulfte prepred in 2.5 M sulfuri id), 50 μl of regent (0.25 M xylenol ornge prepred in HPLC-grde methnol), nd 90 ml of regent (9.69 mg of utylted hydroxytoluene prepred in 90 ml of HPLC- grde methnol). The totl volume ws rised to 100 ml with distilled wter. In test tue, 0.2 ml of plnt extrt ws tken nd 1 ml FOX regent ws dded to it. The retion mix ws mixed properly nd ws inuted t room temperture for 15 min. All solutions were prepred fresh nd used within 2 h. The ontent of queous H 2 O 2 ws estimted y reording the sorne t 560 nm. Conentrtion ws lulted using stndrd urve prepred y tking vrying onentrtions of H 2 O 2. Extrtion of protein For the estimtion of ntioxidnt enzyme tivities, 1 g of fresh 14 d seedlings were homogenised in 3 ml of hilled uffer ontining 50 mm phosphte uffer (ph = 7.8), 2 mm EDTA, 1 mm DTT, 1 mm PMSF (Phenylmethylsulfonyl Fluoride), 0.5 %(v/v) Triton X- 100 nd 10 % (w/v) PVP-40 (Polyvinylpyrrolidone). The homogente ws entrifuged for 20 min t 12,000 rpm nd the superntnt ws olleted. This superntnt ws then used for vrious enzymti ssys [26]. Protein onentrtion ws determined using Brdford ssy with BSA s stndrd [35]. Estimtion of ntioxidnt enzyme tivities The enzymti tivities of different ntioxidnt enzymes were determined spetrophotometrilly. The EC (Enzyme Commission) numer mentioned ginst eh enzyme is
10 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 10 of 13 unique numer in the numeril lssifition sheme for enzymes nd represent the hemil retions they tlyze. ) SOD ssy (EC ) The enzymti tivity of SOD ws determined using the method given y Beuhmp nd Fridovih [36]. 1 ml of retion mixture ws prepred in 50 mm potssium phosphte uffer using 2 μm rioflvin, 75 μm Nitrotetrzolium lue (NBT), 100 μm EDTA, 13 mm DL-methionine nd 50 μl of enzyme extrt nd the sorne ws tken t 560 nm. The retion mix ws illuminted for 20 min t 25 C for initition. 1 unit of enzyme tivity is expressed s the mount of enzymes required for 50 % inhiition of NBT redution t 25 C. ) CAT ssy (EC ) CAT speifi tivity ws estimted t 25 C using the method given y Aei [37]. Derese in sorne of H 2 O 2 ws mesured in 1 ml of retion mixture hving 10 mm H 2 O 2 nd 20 μl of enzyme extrt in 50 mm of potssium phosphte uffer (ph = 7). Speifi enzyme tivity ws expressed s l mole of H 2 O 2 deomposed mg protein -1 min -1. ) APX ssy (EC ) The speifi tivity of APX ws ssyed s the rte of oxidtion of sorte in the presene of H 2 O 2 [26]. The retion mixture of 1 ml omprised of 0.5 mm sorte, 0.1 mm H 2 O 2 nd 0.1 mm EDTA, potssium phosphte uffer(ph = 7) nd 10 μl of enzyme extrt. Derese in sorption ws oserved spetrophotometerilly t 290 nm t 25 C. One unit of enzyme tivity ws expressed s the mount of enzyme required to oxidise 1 μm of sorte/minute/g tissue. d) GR ssy (EC ) The speifi tivity of GR is determined y nlysing the derese in sorne t 340 nm [26]. 1 ml retion mixture used for the ssy hd 50 mm potssium phosphte uffer (ph = 7.8), 1 mm EDTA, 1 mm oxidized glutthione (GSSG) nd 25 μl enzyme extrt. The retion ws strted y dding 0.1 mm NADPH t lst. Enzyme tivity ws expressed s μmol of NADPH oxidised min -1 mg protein -1. e) GPX ssy (EC ) The tivity of GPX is oserved y mesuring the inrese in sorne t 436 nm [26]. The retion mixture ws prepred in 50 mm potssium phosphte uffer (ph = 7) hving 9 mm guiol, 10 mm H 2 O 2 nd 33 μl of enzyme extrt. The enzymti tivity of GPX is expressed s the mount of enzyme required to produe 1 μmol guiol dehydrogention produt min -1 mg protein -1. f) DHAR ssy (EC ) The speifi tivity of DHAR ws estimted y mesuring the inrese in sorne t 25 C due to the formtion of sorte from dehydrosorte t 265 nm [26]. The retion mixture of 1 ml onsisted of 50 mm of potssium phosphte uffer (ph = 7), 0.1 mm EDTA, 0.5 mm dehydrosorte, 2.5 mm GSH nd 25 μl of enzyme extrt. One unit of enzyme tivity ws expressed s mount of enzyme required to produe 1 μmol of sorte min -1 mg protein -1. g) MDHAR ssy (EC ) The speifi tivity of MDHAR ws determined t 25 C y mesuring the inrese in sorne t 340 nm [26]. The 1 ml retion mixture used for this estimtion onsisted of 50 mm Tris-HCl uffer (ph = 7.6), 0.15 units of sorte oxidse enzyme, 2.5 mm sori id nd 0.2 mm NADPH/NADH. One unit of enzyme tivity ws given s the mount of enzyme required to oxidse 1 μmol of NADPH min -1 mg protein -1. Expression nlysis of ntioxidnt enzymes For the gene expression studies of vrious ntioxidnt genes, semi quntittive primers were designed using the IDT softwre ( (Tle 3). Totl RNA from the 14 d plnts ws extrted using the trizol method s per the mnufturer s instrutions. A totl of 3 μg of RNA ws used for the DNA preprtion with ommeril DNA synthesis kit. Gene expression ws studied in 50 μl of polymerse hin retion (PCR) using 50 ng of DNA templte. The PCR prmeters used were: predenturtion t 94 C for 4 min, followed y 35 yles of 94 C for 1 min, 55 C for 1 min, 72 C for 1 min, with finl extension step of 72 C for 7 min. Rie elongtion ftor ef1α ws used s internl ontrol. All the PCR s were performed t lest with three independent smples nd intensity of the produts ws onfirmed with 1 % grose gel with ethidium romide. The reltive level of trnsript in eh PCR retion ws determined using the integerted density vlue (IDV), with Alph 2000TM Imge Anlyzer softwre. In-gel SOD ssy For in-gel SOD ssy, 100 mg of fresh seedling tissue of eh ultivr ws homogenized with 50 mm Tris HCl
11 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 11 of 13 Tle 3 List of primers for RT-PCR S. No. Nme of the gene Dtse Aession numer Primer sequene 1 EF1α GenBnk D F: 5 0 -GTACAAGATCGGTGGTATT-3 0 R: 5 0 -GGGTACTCAGAGAAGGTCT Cu/Zn-SOD GenBnk L F: 5 0 -CCTCAAGCCTGGTCTCCAT-3 0 R:5 0- CAGCCTTGAAGTCCGATGAT Fe-SOD GenBnk AY F: 5 0 -CTTGATGCCCTGGAACCTTA-3 0 R: 5 0 -GCCAGACCCCAAAAGTGATA Mn-SOD GenBnk L F: 5 0 -GCCATTGATGAGGATTTTGG-3 0 R: 5 0 -CAAGCAGTCGCATTTTCGTA CAT GenBnk D F: 5 0 -GTTCGGTTCTCCACAGTCGT-3 0 R: 5 0 -CCCTCCATGTGCCTGTAGTT APX GenBnk D F: 5 0 -CCAAGGGTTCTGACCACCTA-3 0 R: 5 0- CAGTTCGGAGAGCTTGAGGT GR GenBnk AB F: 5 0- AACAGCCGATGGCATAAAAG-3 0 R:5 0 -CAACCACCAGTTTCATGACG-3 0 uffer (ph = 7.5). The homogente ws entrifuged t rpm for 15 min t 4 C [38]. The protein ontent ws quntified in the superntnt using Brdford ssy with BSA s stndrd. Ntive-PAGE nlysis ws rried out with 50 μg protein of eh ultivr t 80 V stking nd 100 V resolving. The gel ws then stined ording to Ruinsk s method using 2.45 mm NBT prepred in 50 mm potssium phosphte uffer for 20 min in drk [39]. The gel ws gin wshed with utolved wter followed y immersion in potssium phosphte (50 mm, ph 7.8) ontining TEMED (28 mm) nd rioflvin (3 μm) for 15 min. The gel ws then kept on dry white illumintion try till the gel eme uniformly lue exept t positions ontining SOD nd mximum ontrst etween the hromti zones nd generl lue olour ws hieved. Asorte ontent The ontent of sori id ws estimted using the Dutilleul s method with minor modifitions [40]. 1 g of fresh lef tissues of four ultivrs ws homogenized with 3 % metphosphori id (3 %) ontining EDTA (1 mm). The homogente ws entrifuged t 8000 g for 15 min. 0.1 ml of superntnt ws tken nd ws mixed with 1 ml itrte phosphte uffer (0.1 M, ph 2.1). The sorne ws tken t 265 nm nd 1 unit of APX ws dded. The solution ws inuted for 5 min t room temperture nd sorne ws gin noted t 265 nm. The differene in two redings of sorne ws lulted tht indited the redued sorte ontent utilized speifilly y APX. For the estimtion of totl sorte ontent, 0.1 ml of DTT (0.1 M) ws dded in nother set nd sorne ws red t 265 nm fter 5 min. 1 unit of APX ws dded nd sorne ws tken fter 5 min. For the determintion of oxidized sorte ontent, redued sorte ontent ws sutrted from the totl sorte ontent. Clirtion urve ws prepred using grded onentrtion of L-sori id in 3 % HPO 3. The rtio of redued sorte nd oxidized sorte ws lso determined. Proline ontent Proline ontent ws determined using the method given y Btes [41]. 0.5 g of totl seedlings were rushed in liquid nitrogen nd homogenised in 3 % queous sulfosliyli id. The smples were then entrifuged t rpm for 15 min nd 2 ml of the superntnt ws tken in test tue. Equl mount of id ninhydin nd glil eti id ws dded to the superntnt nd the retion mix ws kept in oiling wter for 1 h. The retion ws stopped y keeping the tues on ie. Added 4 ml of toluene to the retion mixture nd toluene lyer seprted from the queous phse ws olleted. The proline ontent ws determined y mesuring the sorne of the toluene t 520 nm. The mount of proline ws estimted using the proline stndrd urve nd ws expressed s μmoles gfw -1. Lipid peroxidtion The level of lipid peroxidtion ws determined using the TBARS ssy [42]. 1 g of tissue smple ws homogenised in 3 ml of 0.1 % of hilled trihloroeti id (TCA) nd 3 ml of solution ontining 0.5 % TBA (Thiorituri id) in 20 % TCA ws dded to it. The retion mixture ws inuted t 95 C for 30 min nd the retion ws stopped y keeping the tue on ie. Centrifuged the mixture t 10,000 rpm for 15 min. The superntnt
12 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 12 of 13 ws olleted nd its sorne ws mesured t 532 nm, with reding t 600 nm sutrted from it to ount for nonspeifi turidity. 155 mm -1 m -1 extintion oeffiient ws used for the quntifition of MDA- TBA omplex nd ws expressed s μmoles gfw -1. Chlorophyll ontent Chlorophyll ontent ws estimted using the method given y Arnon with some modifitions [43]. 100 mg of fresh leves of eh ultivr were tken nd were homogenised in liquid nitrogen. To the homogenised tissue smple, 1.5 ml of 80 % etone ws dded nd the retion ws inuted in drk for 1 h. Smples were entrifuged t 15,000 rpm for 3 min. The superntnt ws olleted nd the sorne ws mesured spetrophotometrilly t 645 nd 663 nm ginst 80 % etone s lnk. The hlorophyll ontent ws determined s follows: Totl hlorophyll ðμg=mlþ ¼ 20:2 ða 645 Þ þ 8:02ðA 663 Þ Chlorophyll ðμg=mlþ ¼ 12:7 ða 663 Þ 2:69ðA 645 Þ Chlorophyll ðμg=mlþ ¼ 22:9 ða 645 Þ 4:68ðA 663 Þ Sttistil nlysis Dt from different experiments ws nlysed sttistilly with one-wy nlysis of vrine (ANOVA). The vlue of different prmeters is expressed s men ± SE of three independent replites. The Tukey LSD test ws pplied for multiple omprisons using Sigm stt version 3.5, nd signifine of differene etween the ultivrs were set s p Arevitions APX, sorte peroxidse; CAT, tlse; DAB, 3, 3-diminoenzidine; DHAR, dehydrosorte redutse; GPX, guiol peroxidse; GR, glutthione redutse; H 2 DCFDA, 2',7'-dihlorodihydrofluoresein diette; H 2 O 2,hydrogen peroxide; MDA, mlondildehyde; MDHAR, monodehydrosorte redutse; NADPH, niotinmide denine dinuleotide phosphte hydrogen; NBT, nitrozolium lue; O 2-, superoxide ions; PCR, polymerse hin retion; PIC, protese inhiitory oktil; PMSF, phenylmethylsulfonyl fluoride; ROS, retive oxygen speies; semi-rt, semi quntittive reverse trnsriptse; SOD, superoxide dismutse; XTT, sodium3-[1-[phenylmino-ronyl]-3,4-tetrzolium]-is(4-methoxy-6-nitro)enzenesulfoni id hydrte Aknowledgements Nvdeep Kur is thnkful to the Deprtment of Biotehnology (Government. of Indi) for Senior Reserh Fellowship. We thnk the Deprtment of Genetis IARI, New Delhi, Indi for providing the seeds of IR64 nd Pus Bsmti-1 nd Diretor, CRRI, Odish, Indi for providing the seeds of Lun Snkhi nd Lun Suvrn. Authors knowledge the Deprtment of Biotehnology, Government of Indi for finnil support (Projet No. BT/PR13965/BRB/10/883/2010). Avilility of dt nd mterils All the dt supporting the findings is ontined within the mnusript. Authors ontriutions NK, PKP nd IS oneived nd designed the experiments. NK nd MD performed the experiments. PKP nd NK nlysed nd interpreted the dt. NK rried out sttistil nlysis. PKP, NK nd IS wrote the mnusript. All uthors red nd pproved the finl mnusript. Competing interests The uthors delre tht they hve no ompeting interests. Consent for pulition Not pplile. Ethis pprovl nd onsent to prtiipte Not pplile. Author detils 1 Deprtment of Biotehnology, Guru Nnk Dev University, Amritsr , Punj, Indi. 2 Deprtment of Orl iology, August University, August, GA, USA. Reeived: 13 April 2016 Aepted: 27 My 2016 Referenes 1. Onyngo AO. Exploring options for improving rie prodution to redue hunger nd poverty in Keny. World Environ. 2014;4: Thkur P, Kumr S, Mlik JA, Berger JD, Nyyr H. Cold stress effets on reprodutive development in grin rops: n overview. Environ Exp Bot. 2010;67: Mntri N, Ptde V, Penn S, Ford R, Png E. Aioti stress responses in plnts: present nd future. In: Ahmd P, Prsd MNV, editors. Aioti stress responses in plnts: metolism, produtivity nd sustinility. New York: Springer; p Todk D, Nkshim K, Shinozki K, Ymguhi SK. Towrds understnding trnsriptionl regultory networks in ioti stress responses nd tolerne in rie. Rie. 2012;5:6. 5. Gupt B nd Hung B. Mehnism of slinity tolerne in plnts: physiologil, iohemil, nd moleulr Chrteriztion. Int J Genomis doi:org/ /2014/ Bose J, Rodrigo MA nd Shl S. ROS homeostsis in hlophytes in the ontext of slinity stress tolerne. J Exp Bot doi: /jx/ert Choudhury S, Pnd P, Shoo L, Pnd SK. Retive oxygen speies signling in plnts under ioti stress. Plnt Signl Behv doi: /ps Jji I, Srn T, Strzlk K. Senesene, stress, nd retive oxygen speies. Plnts. 2015;4: Bxter A, Mittler R, Suzuki N. ROS s key plyers in plnt stress signlling. J Exp Bot doi: /jx/ert Srivstv AK, Srivstv S, Lokhnde HV, Souz SFD, Suprsnn P. Slt stress revels differentil ntioxidnt nd energeti responses in glyophyte (Brssi june L.) nd hlophyte (Sesuvium portulstrum L.). Front Environ Si doi: /fenvs Kundl A, Rojs CM, Mysore KS. Mesurement of NADPH oxidse tivity in plnts. Bio-Protool Kur G, Shrm A, Guruprsd K, Pti PK. Verstile roles of plnt NADPH oxidses nd emerging onepts. Biotehnol Adv. 2014;32: Shrwi HE, Kumr B, Kul T, Reddy MK, Singl P, Sopory SK. Redox homeostsis, ntioxidnt defense, nd methylglyoxl detoxifition s mrkers for slt tolerne in Pokkli rie. Protoplsm. 2010;245: Slw AO, Mon GD, Slmn SR. Comprtive study etween the physiologil role of hydrogen peroxide nd sliyli id in lleviting the hrmful effet of low temperture on tomto plnts grown under sndponi ulture. Si Agri. 2015;9: Sofo A, Sop A, Nuzzi M, Vitti A. Asorte peroxidse nd CAT tivities nd their geneti regultion in plnts sujeted to drought nd slinity stresses. Int J Mol Si. 2015;16: Shl S, Wu H, Bose J. Slt stress sensing nd erly signlling events in plnt roots: Current knowledge nd hypothesis. Plnt Si. 2015;241: Dodd AN, Kudl J, Snders D. The lnguge of lium signling. Annu Rev Plnt Biol. 2010;61: Cuypers A, Smeets K, Ruytinx J, Opdenkker K, Keunen E, Remns T, et l. The lnguge of lium signling. Annu Rev Plnt Biol. 2010;61: Ozgur R, Uzildy B, Sekmen AH, Turkn I. Retive oxygen speies regultion nd ntioxidnt defene in hlophytes. Funt Plnt Biol. 2013;40:
13 Kur et l. BMC Plnt Biology (2016) 16:131 Pge 13 of Shrm I, Bhrdwj R, Pti PK. Exogenous pplition of 28-homorssinolide modultes the dynmis of slt nd pestiides indued stress responses in n elite rie vriety Pus Bsmti-1. J Plnt Growth Regul doi: / s Kosová K, Prášil IT, Vítámvás P. Protein ontriution to plnt slinity response nd tolerne quisition. Int J Mol Si. 2013;14: Rdyukin NL, Krtshov AV, Ivnov YV, Shevykov NI, Kuznetsov VV. Funtioning of defense systems in hlophytes nd glyophytes under progressing slinity. Russ J Plnt Physiol. 2007;54: Szdos L, Svouré A. Proline: multifuntionl mino id. Trends Plnt Si. 2010;15: Signorelli S, Coitiño EL, Borsni O, Monz J. Moleulr mehnisms for the retion etween OH rdils nd proline: insights on the role s retive oxygen speies svenger in plnt stress. J Phys Chem. 2013;118: André DAN1, José TP, Joquim EF, Crlos EBdA, Enés GF. Effet of slt stress on ntioxidtive enzymes nd lipid peroxidtion in leves nd roots of slt-tolernt nd slt-sensitive mize genotypes. Environ Exp Bot. 2006;56: Shrm I, Ching E, Sini S, Bhrdwj R, Pti PK. Exogenous pplition of rssinosteroid offers tolerne to slinity y ltering stress responses in rie vriety Pus Bsmti-1. Plnt Physiol Biohem. 2013;69: Li J, Hu L, Zhng L, Pn X, Hu X. Exogenous spermidine is enhning tomto tolerne to slinity lklinity stress y regulting hloroplst ntioxidnt system nd hlorophyll metolism. BMC Plnt Biol doi: /s Chen XB, Zho XH, Zhu Y, Gong YD, Li LB, Zhng JP, et l. Hydrogen peroxide-indued hlorophyll lehing in the ytohrome 6f omplex: simple nd effetive ssy for stility of the omplex in detergent solutions. Photosynth Res. 2006;90: Lonov AV, Rutsov NA, Vedeneev YA, Komissrov GG. Phototlyti tivity of hlorophyll in hydrogen peroxide genertion in wter. Dokl Chem. 2008;421: Merzlyk MN, Gitelson AA, Pogosyn SI, Likhimen L, Chivkunov OB. Lightindued pigment degrdtion in leves nd ripening fruits studied in sity with refletne spetrosopy. Physiol Plnt. 1998;104: Gregorio GB, Islm MR, Vergr GV, Thirumeni S. Reent dvnes in rie siene to design slinity nd other ioti stress tolernt rie vrieties. SABRAO J Breed Genet. 2013;45: Wu GL, Cui J, To L, Yng H. Fluroxypyr triggers oxidtive dmge y produing superoxide nd hydrogen peroxide in rie (Oryz stiv). Eotoxiology. 2010;19: Kim A, Poul EJ, In MM, Alexnder S. Monitoring retive oxygen speies formtion nd lolistion in living ells y use of the fluoresent proe CM-H 2 DCFDA nd onfol lser mirosopy. Physiol Plnt. 2009;136: Shrm A, Vts SK, Pti PK. Post-infetionl dynmis of lef spot disese in Withni somnifer. Ann Appl Biol. 2013;165: Brdford M. A rpid nd sensitive method for the quntittion of mirogrm quntities of protein utilizing the priniple of protein-dye inding. Anl Biohem. 1976;72: Beuhmp CU, Fridovih I. Improved ssys for superoxide dismutse nd n ssy pplile to polyrylmide gels. Anl Biohem. 1971;44: Aei H. CAT in vitro. Methods Enzymol. 1984;105: Kuo WY, Hung CH, Liu AC, Cheng CP, Li SH, Chng WC, et l. Chperonin 20 medites iron superoxide dismutse (FeSOD) tivity independent of its o-hperonin role in Aridopsis hloroplsts. New Phytol. 2013;197: Ruinsk R, Wplk S, Gwozdz E. Free rdil formtion nd tivity of ntioxidnt enzymes in lupin roots exposed to led. Plnt Physiol Biohem. 1999;37: Dutilleul C, Grmier M, Notor G, Mthieu C, Chetrit P, Foyer CH, et l. Lef mitohondri modulte whole ell redox homeostsis, set ntioxidnt pity, nd determine stress resistne through ltered signling nd diurnl regultion. Plnt Cell. 2003;15: Btes LS, Wldeen RP, Tere ID. Rpid determintion of free proline for wter stress studies. Plnt Soil. 1973;39: Hodges MD, DeLong JM, Forney CF, Prnge RK. Improving the thiorituri id-retive-sustnes ssy for estimting lipid peroxidtion in plnt tissues ontining nthoynin nd other interfering ompounds. Plnt. 1999;207: Arnon DI. Copper enzymes in isolted hloroplsts. Polyphenoloxidse in Bet vulgris. Plnt Physiol. 1949;24:1 15. Sumit your next mnusript to BioMed Centrl nd we will help you t every step: We ept pre-sumission inquiries Our seletor tool helps you to find the most relevnt journl We provide round the lok ustomer support Convenient online sumission Thorough peer review Inlusion in PuMed nd ll mjor indexing servies Mximum visiility for your reserh Sumit your mnusript t
P AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationJOURNAL OF ENVIRONMENTAL SCIENCES 34 (2015) Available online at ScienceDirect
JOURNAL OF ENVIRONMENTAL SCIENCES 4 (5) 9 99 Aville online t www.sienediret.om SieneDiret www.journls.elsevier.om/journl-of-environmentl-sienes Effets of nitrogen dioxide nd its id mist on retive oxygen
More informationSalinity and drought represent serious problems worldwide negatively
PERIODICUM BIOLOGORUM UDC 57:61 VOL. 11, No 3, 93 99, 1 CODEN PDBIAD ISSN 31-536 Originl sientifi pper Effets of osmoti stress on ntioxidtive system of dukweed (Lemn minor L) SANDRA RADI] BRANKA PEVALEK-KOZLINA
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationToxicity effects of seven Cu compounds/nps in Lettuce (Lactuca sativa) and Alfalfa (Medicago sativa)
Toxiity effets of seven Cu ompounds/nps in Lettue (Ltu stiv) nd Alflf (Medigo stiv) Jie Hong, Lijun Zho, Cyren Rio, Jose R Perlt-Vide, Jorge Grde-Torresdey The University of Texs t El Pso UC-CEIN Theme
More informationEffects of exogenous nitric oxide on cadmium toxicity and antioxidative system in perennial ryegrass
Journl of Soil Siene nd Plnt Nutrition, 218, 18 (1), 129-143 RESEARCH ARTICLE Effets of exogenous nitri oxide on dmium toxiity nd ntioxidtive system in perennil ryegrss Chen, Weifeng 1, Dong, Yunjie 1*,
More informationCadmium-induced oxidative damage in rice leaves is reduced by polyamines
Plnt Soil (27) 291:27 37 DOI 1.17/s1114-6-9171-7 ORIGINAL PAPER Cdmium-indued oxidtive dmge in rie leves is redued y polymines Yi Ting Hsu Æ Ching Huei Ko Reeived: 12 June 26 / Aepted: 23 Novemer 26 /
More informationEffects of putrescine on oxidative stress induced by hydrogen peroxide in Salvinia natans L.
Journl of Plnt Intertions ISSN: 1742-9145 (Print) 1742-9153 (Online) Journl homepge: https://www.tndfonline.om/loi/tjpi2 Effets of putresine on oxidtive stress indued y hydrogen peroxide in Slvini ntns
More informationEFFECTS OF CADMIUM-ADDED ON ASCORBATE-GLUTATHIONE CYCLE OF YOUNG CITRUS SEEDLINGS UNDER SELENITE OR SELENOMETHIONINE-ENRICHED SOIL
Pk. J. Bot., 5(4): 1291-1295, 218. EFFECTS OF CADMIUM-ADDED ON ASCORBATE-GLUTATHIONE CYCLE OF YOUNG CITRUS SEEDLINGS UNDER SELENITE OR SELENOMETHIONINE-ENRICHED SOIL XIEPING SUN 1,2, GUOQIANG HAN 1, YOUJIN
More informationMoukette et al. Biological Research (2015) 48:15 DOI /s
Moukette et l. Biologil Reserh (2015) 48:15 DOI 10.1186/s40659-015-0003-1 RESEARCH ARTICLE Open Aess In vitro ntioxidnt properties, free rdils svenging tivities of extrts nd polyphenol omposition of non-timber
More informationWhangarei District Council Class 4 Gambling Venue Policy
Whngrei Distrit Counil Clss 4 Gmling Venue Poliy April 2013 Whngrei Distrit Counil Clss 4 Gmling Venue Poliy Tle of ontents Introdution... 3 1 Ojetives of the poliy in so fr s promoted y the Gmling At
More informationExogenous catechin increases antioxidant enzyme activity and promotes flooding tolerance in tomato (Solanum lycopersicum L.)
Plnt Soil (2011) 344:213 225 DOI 10.1007/s11104-011-0741-y REGULAR ARTICLE Exogenous tehin inreses ntioxidnt enzyme tivity nd promotes flooding tolerne in tomto (Solnum lyopersium L.) Jinn-Chin Yiu & Menq-Jiu
More informationChemosphere 84 (2011) Contents lists available at ScienceDirect. Chemosphere. journal homepage:
Chemosphere 84 (211) 63 69 Contents lists ville t SieneDiret Chemosphere journl homepge: www.elsevier.om/lote/hemosphere Clium protets roots of Sedum lfredii H. ginst dmium-indued oxidtive stress Shengke
More informationAlleviation of oxidative stress induced by drought stress through priming by β- aminobutyric acid (BABA) in Rapeseed (Brassica napus L.
223 Allevition of oxidtive stress indued y drought stress through priming y β- minoutyri id (BABA) in Rpeseed (Brssi npus L.) plnts Ned Mohmdi 1,2, Amin Bghizdeh 3*, Sr Sdtmnd 1, Zhr Asrr 4 1. Deprtment
More informationInfluence of Si Supplementation on Growth and Some Physiological and Biochemical Parameters in Salt- Stressed Tobacco (Nicotiana rustica L.
Journl of Sienes, Islmi Repuli of Irn 25(3): 205-217 (2014) University of Tehrn, ISSN 1016-1104 http://jsienes.ut..ir Influene of Si Supplementtion on Growth nd Some Physiologil nd Biohemil Prmeters in
More informationEFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN. Research Report to Northarvest Bean Growers, January 19, 2009
EFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN Reserh Report to Northrvest Ben Growers, Jnury 19, 29 Berlin D. Nelson, Susilo Poromrto, n Ruell Goswmi, Dept. Plnt Pthology, NDSU Ojetive: Determine
More informationEffect of salt stress on physiological and morphological parameters of rapeseed cultivars
Journl of Sientifi Reserh nd Development 2 (5): 111-117, 2015 Avilble online t www.jsrd.org ISSN 1115-7569 2015 JSRAD Effet of slt stress on physiologil nd morphologil prmeters of rpeseed ultivrs Rozbeh
More informationNaCl-PRIMING MITIGATES OXIDATIVE DAMAGE AND Na + ACCUMULATION AND ENHANCES SALT TOLERANCE IN SORGHUM PLANTS
NCl-PRIMING MITIGATES OXIDATIVE DAMAGE AND N + ACCUMULATION AND ENHANCES SALT TOLERANCE IN SORGHUM PLANTS R. S. Mirnd 1, S. O. Pul 2, G. S. Arújo 3, I. N. Vlenç, S. R. N. Mirnd 5, E. Gomes-Filho 6 ABSTRACT:
More informationJournal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect. , ZHU Dan-shi
Journl of Integrtive griulture 17, 1(): 345-7 ville online t www.sienediret.om SieneDiret RESERCH RTICLE Effets of thimine on Trihotheium nd lternri rots of muskmelon fruit nd the possile mehnisms involved
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationChanges in Protein Content, Protease Activity, and Amino Acid Content Associated with Heat Injury in Creeping Bentgrass
J. MER. SOC. HORT. SCI. 130(6):842 847. 2005. Chnges in Protein Content, Protese tivity, nd mino id Content ssoited with Het Injury in Creeping entgrss Yli He College of griulturl nd iologil Siene, Shnghi
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationBIOREMEDIATION OF DROUGHT STRESSED WHEAT (TRITICUM AESTIVUM L.) SEEDLINGS
Indin Journl of Plnt Sienes ISSN: 319 384(Online) An Open Aess, Online Interntionl Journl Aville t http://www.iteh.org/jps.htm 16 Vol.5 (4) Otoer-Deemer, pp. 83-93/Aou-Zeid nd Adel-Ltif Reserh Artile BIOREMEDIATION
More informationCONCENTATION OF MINERAL ELEMENTS IN CALLUS TISSUE CULTURE OF SOME SUNFLOWER INBRED LINES
CONCENTATION OF MINERAL ELEMENTS IN CALLUS TISSUE CULTURE OF SOME SUNFLOWER INBRED LINES M. Sri 1, Drgn Vsi, Lj. Vsiljevi, D. Skori, Snezn Mezei nd Sloodnk Pjevi 2 ABSTRACT Conentrtion of minerl elements
More informationThe effect of manure, zeolite and soil ageing in the dynamics of hexavalent chromium in Cichorium spinosum
1 3 4 6 7 8 9 1 11 1 13 14 1 16 17 18 19 1 3 4 6 7 8 9 3 31 3 33 34 3 The effet of mnure, zeolite nd soil geing in the dynmis of hexvlent hromium in Cihorium spinosum V. Antonidis, T. Polyzois, S. Petropoulos,
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationAlleviating sunburn injury in apple fruit using natural and fertilizer forms of S-abscisic acid and its underlying mechanism
WFL Pulisher Siene nd Tehnology Meri-Rstilntie, FI-9 Helsinki, Finlnd e-mil: info@world-food.net Journl of Food, griulture & Environment Vol. () : 446-4. 9 www.world-food.net lleviting sunurn injury in
More informationZinc enrichment in wheat genotypes under various methods of zinc application
Plnt Soil Environ. Vol. 61, 215, No. 4: 171 175 doi: 1.17221/41/215-PSE Zin enrihment in whet genotypes under vrious methods of zin pplition B. Mthpl 1, P.C. Srivstv 2, D. Shnkhdhr 1, S.C. Shnkhdhr 1 1
More informationAll organisms that exist within natural environments are subjected
PERIODICUM BIOLOGORUM UDC 57:6 VOL., No, 5 58, CODEN PDBIAD ISSN -56 Originl sientifi pper Differentil esterse tivity in leves nd roots of Centure rgusin L. s onsequene of slinity SANDRA RADI] BRANKA PEVALEK-KOZLINA
More informationIranian Food Science and Technology Research Journal Vol. 6, No. 3, Fall, 2010.
Irnin Food Siene nd Tehnology Reserh Journl Vol. 6, No. 3, Fll, 2010. rvghi.mrym@gmil.om C ( AOAC 920.87 AOAC 942.05 AOAC 962.09 AOAC 922.06 AOAC 925.10 AACC 1- Extrusion-Expelling 2- Protein Dispersiility
More informationSimplified Methods for Microtiter Based Analysis of In Vitro Antioxidant Activity. Somanjana Khatua, Sandipta Ghosh, Krishnendu Acharya*
ORIGINAL ARTICLE Simplified Methods for Mirotiter Bsed Anlysis of In Vitro Antioxidnt Ativity Somnjn Khtu, Sndipt Ghosh, Krishnendu Ahry* Moleulr nd Applied Myology nd Plnt Pthology Lortory, Deprtment
More informationStomatal behavior and components of the antioxidative system in coffee plants under water stress
Antioxidtive system in offee plnts under wter stress 77 Stomtl ehvior nd omponents of the ntioxidtive system in offee plnts under wter stress Sidnei Deuner 1 ; José Donizeti Alves 2 *; Ilisndr Znndre 3
More informationSuperoxide dismutase isozyme activity and antioxidant responses of hydroponically cultured Lepidium sativum L. to NaCl stress
Journl of Plnt Intertions ISSN: 1742-9145 (Print) 1742-9153 (Online) Journl homepge: https://www.tndfonline.om/loi/tjpi2 Superoxide dismutse isozyme tivity nd ntioxidnt responses of hydroponilly ultured
More informationResearch Article The Protection of Hepatocyte Cells from the Effects of Oxidative Stress by Treatment with Vitamin E in Conjunction with DTT
Hindwi Pulishing Corportion Journl of Biomediine nd Biotehnology Volume 21, Artile ID 486267, 7 pges doi:1.1155/21/486267 Reserh Artile The Protetion of Heptoyte Cells from the Effets of Oxidtive Stress
More informationBioactive Constituents from Triguero Asparagus Improve the Plasma Lipid Profile and Liver Antioxidant Status in Hypercholesterolemic Rats
Int. J. Mol. Si. 213, 14, 21227-21239; doi:1.339/ijms141121227 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Biotive Constituents from Triguero Asprgus Improve
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationChanges in Protease Activity and Proteins in Naked Oats (Avena nuda L.) during Germination
Asin Journl of Agriulture nd Food Sienes (ISSN: 2321 1571) Chnges in Protese Ativity nd Proteins in Nked Ots (Aven nud L.) during Germintion Ling-Ling Zhng 1 nd Jin-Guo Xu *1,2 1 College of Life Sienes,
More informationChanges in SOD isozyme in mycorrhizal asparagus inoculated with Fusarium oxysporum
www.plntroot.org 26 Originl reserh rtile Chnges in SOD isozyme in myorrhizl sprgus inoulted with Fusrium oxysporum Ji Liu 1 nd Yoh-ihi Mtsur 2 1 The United Grdute Shool of Agriulturl Siene, Gifu University,
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationThe Study of Nano-silica effects on qualitative and quantitative performance of potato (Solanum tuberosum L.)
ISSN No. (Print): 975-113 ISSN No. (Online): 2249-3239 The Study of Nno-sili effets on qulittive nd quntittive performne of potto (Solnum tuberosum L.) Shiv Tlebi*, Ahmd Mjd*, Msoumeh Mirzi*, SyehJfri*
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationPropagation of Blue Honeysuckles (Lonicera caerulea L.) in In Vitro Culture
164 Journl of Bsi & Applied Sienes, 214, 1, 164-169 Propgtion of Blue Honeysukles (Lonier erule L.) in In Vitro Culture Krup-M kiewiz Mrelin 1,* nd Ohmin Ireneusz 2 1 Deprtment of Plnt Genetis, Breeding
More informationGibberellins regulate iron deficiency-response by influencing iron transport and translocation in rice seedlings (Oryza sativa)
nnls of otny 119: 95 956, 17 doi:1.19/o/mw5, ville online t www.o.oxfordjournls.org Gierellins regulte iron defiieny-response y influening iron trnsport nd trnslotion in rie seedlings (Oryz stiv) oln Wng
More informationGrowth, gas exchange and function of antioxidant defense system in two contrasting rice genotypes under Zn and Fe deficiency and hypoxia
Volume 52(2):283-294, 28 At Biologi Szegedieis http://www.si.u-szeged.hu/abs Artile Growth, gs exhnge nd funtion of ntioxidnt defee system in two ontrsting rie genotypes under Zn nd Fe defiieny nd hypoxi
More informationLysine enhances methionine content by modulating the expression of S-adenosylmethionine synthase
The Plnt Journl (7) 5, 85 86 doi:./j.365-33x.7.384.x ine enhnes methionine ontent y modulting the expression of S-denosylmethionine synthse Yel Hhm,, Luhu Song, Gdi Shuster nd Rhel Amir,3, Lortory of Plnt
More informationPhysiological and Biochemical Responses of Common Bush Bean to Drought
demipres ville online: www.notuleotnie.ro Print ISSN 255-965X; Eletroni 1842-439 Not Bot Horti groo, 218, 46(2):393-41. DOI:1.15835/nh4621965 Originl rtile Notule Botnie Horti grootnii Cluj-Npo Physiologil
More informationThe Effect of Cooking Conditions on Hydrophilic Antioxidants in Brussels Sprouts
Funtionl Plnt Siene nd iotehnology 1 Glol Siene ooks The Effet of Cooking Conditions on Hydrophili ntioxidnts in russels Sprouts nn Pods dek * Dorot Sosnowsk rr nders Institute of Tehnil iohemistry, Fulty
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationJournal of Chemical and Pharmaceutical Research, 2013, 5(2): Research Article
Aville online www.jopr.om Journl of Chemil nd Phrmeutil Reserh, 213, 5(2):148-157 Reserh Artile ISSN : 975-7384 CODEN(USA) : JCPRC5 In vitro ntioxidtive nd inhiitory tions of phenoli extrt of some tropil
More informationOPTIMIZATION OF GROWTH CONDITIONS OF DIFFERENT ALGAL STRAINS AND DETERMINATION OF THEIR LIPID CONTENTS ABSTRACT
Munir et l., The Journl of Animl & Plnt Sienes, 25(2): 2015, Pge: J. 546-553 Anim. Plnt Si. 25(2):2015 ISSN: 1018-7081 OPTIMIZATION OF GROWTH CONDITIONS OF DIFFERENT ALGAL STRAINS AND DETERMINATION OF
More informationBritish Journal of Nutrition
(1), 11, 8 87 q The Authors 1 doi:1.117/s711117x Chnges in plsm mino id profiles, growth performne nd intestinl ntioxidnt pity of piglets following inresed onsumption of methionine s its hydroxy nlogue
More informationPlant Physiology Preview. Published on February 21, 2017, as DOI: /pp
Plnt Physiology Preview. Pulished on Ferury 21, 217, s DOI:1.114/pp.16.1928 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 Running title: Spliing regultor STA1 in het stress dpttion Corresponding Author:
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationChemosphere 88 (2012) Contents lists available at SciVerse ScienceDirect. Chemosphere. journal homepage:
Chemosphere 88 (212) 224 228 Contents lists ville t SiVerse SieneDiret Chemosphere journl homepge: www.elsevier.om/lote/hemosphere Tehnil Note Chlorpyrifos degrdtion in iomixture of ioed t different mturity
More informationThe response and protein pattern of spring rapeseed genotypes to sodium chloride stress
Afrin Journl of Agriulturl Reserh Vol. 7(5), pp. 755-763, 5 Ferury, 2012 Aville online t http://www.demijournls.org/ajar DOI: 10.5897/AJAR11.1631 ISSN 1991-637X 2012 Ademi Journls Full Length Reserh Pper
More informationAbortion frequency (%) Ovary position on ear Ovary volume (mm 3 )
ortion frequeny (%) 5 1 Ovry position on er 3 1 WW WD pex Bse Ovry volume (mm 3 ) Figure S1. Ovry volume (thik lines) n ortion frequeny (thin lines) s funtion of position long the er, 15 ys fter silk emergene
More informationNazi Nadernejad, Ali Ahmadimoghadam, Javad Hosseinifard and Shahram Pourseyedi
Amerin-Eursin J. Agri. & Environ. Si., 2 (6): 87-84, 22 ISSN 88-6769 IDOSI Pulitions, 22 DOI:.5829/idosi.ejes.22.2.6.746 Phenyllnin Ammoni-Lyse Ativity, Totl Phenoli nd Flvonoid Content in Flowers, Leves,
More informationEffect of Glycerol and Glucose on the Enhancement of Biomass, Lipid and Soluble Carbohydrate Production by Chlorella vulgaris in Mixotrophic Culture
62 W.B. KONG et l.: Chlorell vulgris Cultivtion on Glyerol nd Gluose, Food Tehnol. Biotehnol. 51 (1) 62 69 (213) ISSN 133-962 (FTB-297) originl sientifi pper Effet of Glyerol nd Gluose on the Enhnement
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationInfluence of arbuscular mycorrhizal fungi on uptake of Zn and P by two contrasting rice genotypes
Influene of rusulr myorrhizl fungi on uptke of Zn nd P y two ontrsting rie genotypes R. Hjiolnd 1, 3, N. Alisghrzd, R. Brzeghr 1 1 Plnt Siene Deprtment, University of Triz, Triz, Irn Soil Siene Deprtment,
More informationKiwanis Dawn Busters of Metairie of the Louisiana Mississippi West Tennessee District of Kiwanis International
Clu of Dwn Busters Kiwnis Dwn Busters of Metirie of the Louisin Mississippi West Tennessee Distrit of Kiwnis Interntionl KIWANIS MOTTO: Serving the Children of the World DEFINING STATEMENT OF KIWANIS:
More informationLipid Composition of Egg Yolk and Serum in Laying Hens Fed Diets Containing Black Cumin (Nigella sativa)
Interntionl Journl of Poultry Siene 5 (6): 574-578, 2006 ISSN 682-8356 Asin Network for Sientifi Informtion, 2006 Lipid Composition of Egg Yolk nd Serum in Lying Hens Fed Diets Contining Blk Cumin (Nigell
More informationIndian Journal of Pharmaceutical and Biological Research (IJPBR)
Indin J. Phrm. Biol. Res. 216; 4(1):63-73 Originl Reserh Artile Neuroprotetive Effet of Cinmomum zeylnium in streptozotoin indued dietes in Mie Joshi Vndn *, Kumr Arun, Kothiyl Preeti CODEN (USA): IJPB7
More informationANTIOXIDANT CAPACITY AND TOTAL PHENOLIC CONTENT OF LEMONGRASS (CYMBOPOGON CITRATUS) LEAVE
ANTIOXIDANT CAPACITY AND TOTAL PHENOLIC CONTENT OF LEMONGRASS (CYMBOPOGON CITRATUS) LEAVE Sin Yen Sh 1, Chiw Mei Si 1, Sui Kit Chng 2, Yee Kwng Ang 1, Hip Seng Yim 1* 1 Deprtment of Food Siene nd Nutrition,
More informationA AOAC Official Method Fat (Total, Saturated, Unsaturated, and Monounsaturated) in Cereal Products
32.2.02A AOAC Offiil Method 996.01 Ft (Totl, Sturted, Unsturted, nd Monounsturted) in Cerel Produts Aid Hydrolysis Cpillry Gs Chromtogrphi Method First Ation 1996 (Applile for determintion of ft in erel
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationThe Protection of Anthrodia camphorata against Acute Hepatotoxicity of Alcohol in Rats
177 Journl of Food nd Drug Anlysis, Vol. 11, No. 3, 23, Pges 177-185 The Protetion of Anthrodi mphort ginst Aute Heptotoxiity of Alohol in Rts YU-YUN DAI, CHENG-HUNG CHUANG, CHIN-CHUAN TSAI, HOK-MAN SIO,
More informationThe protective role of ascorbic acid (vitamin C) against chlorpyrifos-induced oxidative stress in Oreochromis niloticus
Fish Physiol Biohem (2012) 38:635 643 DOI 10.1007/s10695-011-9544-6 The protetive role of sori id (vitmin C) ginst hlorpyrifos-indued oxidtive stress in Oreohromis nilotius Ferl Özkn Sun Gül Gündüz Mehmet
More informationPlant Growth and Photosynthesis Response to Low Potassium Conditions in Three Lettuce (Lactuca sativa) Types
The Hortiulture Journl 86 (2): 229 237. 217. doi: 1.253/hortj.OKD-8 JSHS The Jpnese Soiety for Hortiulturl Siene http://www.jshs.jp/ Plnt Growth nd Photosynthesis Response to Low Potssium Conditions in
More informationWesternBright Quantum
WesternBright Quntum Quntify hemiluminesent Western lots over wie ynmi rnge WesternBright Quntum is new hemiluminesent regent speilly formulte for CCD imging. This novel Horserish peroxise (HRP) sustrte
More informationEthylene treatment improves diosgenin accumulation in in vitro cultures of Dioscorea zingiberensis via up-regulation of CAS and HMGR gene expression
Eletroni Journl of Biotehnology ISSN: 0717-3458 http://www.ejiotehnology.info DOI: 10.2225/vol16-issue5-fulltext-9 RESEARCH ARTICLE Ethylene tretment improves diosgenin umultion in in vitro ultures of
More informationPTSE RATES IN PNNI NETWORKS
PTSE RATES IN PNNI NETWORKS Norert MERSCH 1 Siemens AG, Hofmnnstr. 51, D-81359 Münhen, Germny Peter JOCHER 2 LKN, Tehnishe Universität Münhen, Arisstr. 21, D-80290 Münhen, Germny Lrs BURGSTAHLER 3 IND,
More informationEvaluation of antioxidant properties of a new compound, pyrogallol-phloroglucinol -6,6'-bieckol isolated from brown algae, Ecklonia cava
Nutrition Reserh nd Prtie (Nutr Res Prt) 211;5(6):495-52 http://dx.doi.org/1.4162/nrp.211.5.6.495 Evlution of ntioxidnt properties of new ompound, pyrogllol-phlorogluinol -6,6'-iekol isolted from rown
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationArchives of Biochemistry and Biophysics
Arhives of Biohemistry nd Biophysis 483 (29) 16 11 Contents lists ville t SieneDiret Arhives of Biohemistry nd Biophysis journl homepge: www.elsevier.om/lote/yi Protetion ginst oxidtive stress in Esherihi
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationCHROMIUM ACCUMULATION BY PHYTOREMEDIATION WITH MONOCOT WEED PLANT SPECIES AND A HYDROPONIC SAND CULTURE SYSTEM
Journl of Environmentl Reserh And Development Vol. 4 No. 3, Jnury-Mrh 21 CHROMIUM ACCUMULATION BY PHYTOREMEDIATION WITH MONOCOT WEED PLANT SPECIES AND A HYDROPONIC SAND CULTURE SYSTEM Pntwt Smpnpnish *1,2,
More informationFRAMEstar. 2-Component PCR Plates
FRAMEstr -Component Pltes FrmeStr two-omponent tehnology redues evportion from pltes, improving results nd llowing for volume redutions to sve on expensive regents. FrmeStr pltes mximise therml stility
More informationReduction in albumin binding function following liver resection in patients with and without cirrhosis
Originl Artile Redution in lumin inding funtion following liver resetion in ptients with nd without irrhosis Penglei Ge 1,2, Wenjun Lio 1, Huyu Yng 1, Jingfen Lu 3, Wei Xu 1, Dndn Hu 1, Shund Du 1, Hifeng
More informationA AOAC Official Method Fructans in Food Products
45.4.06A AOAC Offiil Method 997.08 Frutns in Food Produts Ion Exhnge Chromtogrphi Method First Ation 1997 Finl Ation 1999 (Applile to the determintion of dded frutns in proessed foods.) See Tle 997.08A
More informationSeedling treatments and phosphorus solution concentrations affect nodulation and nodule functions in soybean (Glycine max L.)
Seedling tretments nd phosphorus solution onentrtions ffet nodultion nd nodule funtions in soyen (Glyine mx L.) S.J. Mio 1, 2, 3, X.Z. Hn 1, X.B. Liu 1, Y.F. Qio 1 1 Northest Institute of Geogrphy nd Agrio-Eology,
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationAntioxidant Activity of Hydrolysates Prepared from Flaxseed Cake Proteins Using Pancreatin. Magdalena Karamać*, Anna Kulczyk, Katarzyna Sulewska
Originl rtile Setion: Food Qulity nd Funtionlity Pol. J. Food Nutr. Si., 2014, Vol. 64, No. 4, pp. 227 233 DOI: 10.2478/pjfns-2013-0023 http://journl.pn.olsztyn.pl Antioxidnt Ativity of Hydrolystes Prepred
More informationEffect of High Levels of Ammonium or Nitrate on Growth and Nitrogen Metabolism in Roots and Leaves of Sorghum (Sorghum sudangrass) Plants
Amerin-Eursin J. Agri. & Environ. Si., 15 (9): 1860-1867, 2015 ISSN 1818-6769 IDOSI Pulitions, 2015 DOI: 10.5829/idosi.ejes.2015.15.9.95303 Effet of High Levels of Ammonium or Nitrte on Growth nd Nitrogen
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationA protective role for nitric oxide and salicylic acid for arsenite phytotoxicity in rice (Oryza sativa L.)
Aepted Mnusript A protetive role for nitri oxide nd sliyli id for rsenite phytotoxiity in rie (Oryz stiv L.) Amit Pl Singh, Grim Dixit, Amit Kumr, Seem Mishr, Nvin Kumr, Smeer Dixit, Prdyumn Kumr Singh,
More informationINFLUENCE OF CADMIUM ON ANTIOXIDATIVE DEFENCE SYSTEM, PHOTOSYNTHESIS, LEVEL OF OSMOLYTES AND IONS UPTAKE IN BRASSICA JUNCEA
Interntionl Journl of Phrmy nd Phrmeutil Sienes ISSN- 0975-1491 Vol 8, Issue 10, 2016 Originl Artile INFLUENCE OF CADMIUM ON ANTIOXIDATIVE DEFENCE SYSTEM, PHOTOSYNTHESIS, LEVEL OF OSMOLYTES AND IONS UPTAKE
More informationEffect of Nitrogen-containing Compounds on Growth Characteristic of the Oleaginous Microalga Chlorella ellipsoidea SD-0701
ejbio Eletroni Journl of Biology, 215, Vol. 11(1):1-7 Effet of Nitrogen-ontining Compounds on Growth Chrteristi of the Oleginous Mirolg Chlorell ellipsoide SD-71 Lili Liu 1,2, *, Wenyu Luo 1, Yihen Zhng
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationOZONE TREATMENT REDUCES MARKERS OF OXIDATIVE AND ENDOTHELIAL DAMAGE IN AN EXPERIMENTAL DIABETES MODEL IN RATS
Phrmologil Reserh, Vol. 44, No. 5, 21 doi:1.16/phrs.21.867, ville online t http://www.idelirry.om on OZONE TREATMENT REDUCES MARKERS OF OXIDATIVE AND ENDOTHELIAL DAMAGE IN AN EXPERIMENTAL DIABETES MODEL
More informationa SpringerOpen Journal
Kumr et l. SpringerPlus 213, 2:639 SpringerOpen Journl RESEARCH Open Aess Enhned glyemi ontrol, pnres protetive, ntioxidnt nd heptoprotetive effets y umelliferon-α-d-gluopyrnosyl-(2 I 1 II )-α-dgluopyrnoside
More information