Ethylene treatment improves diosgenin accumulation in in vitro cultures of Dioscorea zingiberensis via up-regulation of CAS and HMGR gene expression

Transcription

1 Eletroni Journl of Biotehnology ISSN: DOI: /vol16-issue5-fulltext-9 RESEARCH ARTICLE Ethylene tretment improves diosgenin umultion in in vitro ultures of Diosore zingierensis vi up-regultion of CAS nd HMGR gene expression Ske T. Dirr 1 Ji He 1 Jino Wng 1 Jiru Li 1 1 Wuhn University, College of Life Sienes, Stte Key Lortory of Hyrid Rie, Wuhn, PR Chin Corresponding uthor: jrli@whu.edu.n Reeived Ferury 1, 2013 / Aepted July 28, 2013 Pulished online: Septemer 15, y Pontifii Universidd Ctóli de Vlpríso, Chile Astrt Bkground: The perennil mediinl her Diosore zingierensis is very importnt plnt used for steroid drug mnufturing for its high level of diosgenin in rhizome. Although the stimultion of diosgenin umultion y ethylene hs een reported in few of plnt speies, its regultion is not yet hrterized t the moleulr level, the underlying moleulr mehnism remins elusive. Results: In this study, the effets of ethylene on diosgenin iosynthesis in in vitro ultures of D. zingierensis were desried. The results showed tht, in smples treted with ethylene t onentrtion E3 (10 4 dilution of 40% ethephon), the diosgenin iosynthesis ws signifintly promoted in omprison with the ontrol smples. Tretment with high onentrtions of ethylene hd inhiitory effet, wheres with low onentrtion of the gs eliitor rought out no detetle deleterious effet on the growth rte nd diosgenin ontent of the ultures. The onsiderle inrese of diosgenin level in in vitro ultured Diosore zingierensis y ethylene pplition is ompnied y the onomitnt inrese of solule proteins nd hlorophyll ontent. The gene expressions of ylortenol synthse nd 3-hydroxy-3-methylglutryl-CoA redutse ut not of squlene synthse or frnesyl pyrophosphte synthse were up-regulted y pplied ethylene. Conlusions: Our results suggest tht ethylene tretment enhned diosgenin umultion vi upregultion of the gene expressions of ylortenol synthse nd 3-hydroxy-3-methylglutryl-CoA redutse. Keywords: diosgenin, Diosore zingierensis, ethylene, gene expression. INTRODUCTION Diosgenin, (25R)-Spirost-5-en-3β-ol (Figure 1), is steroidl spogenin isolted from the plnts (Mrker et l. 1940). It is one of the most importnt rw mterils for steroid drugs mnufturing. Diosgenin represents the min strting mteril for ommeril synthesis of sex drugs nd ortiosteroids suh s ortisone, testosterone, nd progesterone. Estrogeni, progesterogeni nd nti-inflmmtory effets hve een hypothesized for diosgenin due to its struturl similrity to estrogen nd progesterone preursors (Dewik, 2002). Antiner tivity, ontrolling hyperlipidemi, inhiiting melnogenesis, delying skin ging t the time of limteri hve lso een demonstrted (Lee et l. 2007; Td et l. 2009; Yn et l. 2009; Gong et l. 2010). The perennil mediinl her Diosore zingierensis is very importnt plnt used for steroid drug mnufturing for its high level of diosgenin in rhizome (Hui et l. 1989; Ding et l. 1991; Cheng et l. 2008).

2 Dirr et l. Fig. 1 The iosynthesis pthwy nd struture of diosgenin. MVA: mevloni id; GA-3-P: glyerldehyde-3- phosphte; DXP: 1-deoxy-D-xylulose-5-phosphte; MEP: 2-C-methyl-D-erythritol-4-phosphte; HMG-CoA: 3- hydroxy-3-methylglutryl-coa; HMGR: 3-hydroxy-3-methylglutryl-CoA redutse; HMGR: 3-hydroxy-3- methylglutryl-coa redutse; IPP: isopentenyl diphosphte; DMAPP: dimethylllyl diphosphte; FPP: frnesyl diphosphte; FPPS: FPP synthse; SQS: Squlene synthse; CAS: Cylortenol synthse. In generl, the mount of diosgenin nturlly umulted in plnt tissues is smll, ut n e inresed y vrious eliittors (Rdmn et l. 2003; Nmdeo, 2007). The gseous phytohormone ethylene hs wide rnging effets on plnt growth nd developmentl proesses, inluding senesene sission, florl trnsition, fruit ripening, germintion nd morphogeni response in seedlings (Kieer, 1997). Severl line of evidene indited the stimulting effet of ethylene on diosgenin ontent nd enzymes tivities in Trigonell foenum-greum (Onin et l. 2002; De nd De, 2003; Gómez et l. 2004) nd in D. floriund (De nd De, 2005). Four enzymes, i.e., ylortenol synthse (CAS), squlene synthse (SQS), frnesyl pyrophosphte synthse (FPPS), nd 3-hydroxy-3-methylglutryl oenzyme A redutse (HMGR), re well reognized s key enzymes responsile for the iosynthesis of triterpene diosgenin in plnts (Figure 1). The synthesis of steroidl spogenins nd lkloids involves yliztion of squlene 2, 3-epoxide, medited y ylortenol synthse, with the formtion of tetryli, C 30-ompound- ylortenol (Brown, 1998). It hs een well doumented tht CAS plys essentil roles in the plnt ell viility, nd in the regultion of triterpenoid iosynthesis. SQS is ifuntionl enzyme tht tlyzes the ondenstion of two moleules of frnesyl diphosphte (FPP) to give presqulene diphosphte (PSPP) nd the susequent rerrngement of PSPP to squlene, key preursor for the sterol nd triterpene iosynthesis (Hung et l. 2007; Lee nd Poulter, 2008). FPPS is essentil for the orgn development in plnts lthough it hs not previously een identified s key regultory enzyme in triterpene iosynthesis (Kim et l. 2010). The enzyme HMGR tlyzes the first ommitted step of isoprenoids iosynthesis in MVA pthwy (Wng et l. 2007). Aumulting reserh results suggested tht plnt HMGRs re enoded y gene fmily memers nd regulted y light, growth regultors, wounding nd tretment with pthogen or eliitors (Prk et l. 1992; Mldondo-Mendoz et l. 1997). Severl studies hve een done to ssess the stimulting effets on diosgenin prodution y ethylene or other eliitors, ut the possile genes responsile for the stimultion re lrgely unknown. The im of this present work is to understnd the moleulr mehnism of ethylene indued diosgenin umultion nd the gene expression ptterns of CAS, SQS, FPPS, nd HMGR in in vitro ultures of D. zingierensis. DOI: /vol16-issue5-fulltext-9 2

3 Ethylene tretment improves diosgenin umultion in Diosore zingierensis MATERIALS AND METHODS Plnt mterils The in vitro ultures were estlished from Diosore zingierensis C. H. Wright whih ws originlly olleted from Wudng Mountin, Huei Provine, Chin. The ultures were mintined on Murshige nd Skoog (1962) slt medium (MS medium) ontining 1 mg/l 6-BA, 25 g/l surose nd 8 g/l gr. The ph of the medium ws djusted to 5.8. The medium ws sterilized t 121ºC for 20 min. The tissue ultures were grown nd mintined in ulture hmer t 25ºC with 12 hrs light photoperiod, provided y fluoresent tues (Philips, 3000Lx); nd were suultured t 4 week intervls. Diosgenin nd BSA were from the Sigm Compny. Methnol nd ethephon (40% ethylene) were from Fisher Sientifi nd Sihun Guo Gung Compny, respetively. All other hemils nd regents used were of the highest purity ommerilly ville. Agilent 1100 worksttion ws used for HPLC nlysis. Hormonl tretment After four weeks of suulture, the in vitro ultures were moved into new MS medium whih ws 6-BA free. Ethephon were diluted 10 2, 10 3, 10 4, 10 5 times with sterilized distilled wter, nd mrked s E1 to E4 respetively. The ethephon solution ws sterilized y filtrtion through sterile 0.22 μm memrne filter. The ontrol smples (CK) were treted with distilled wter only. For ethylene ddition, 1 m-wide strips of sterilized filter pper were soked in eliitor solution nd pled on the wll of the ulture oxes. Three replites of 20 oxes (60 plntlets) were done for eh tretment. In order to reord the initil weight of the mterils, the ulture ottles were weighed efore nd fter the tissues were moved into the medium. These ultures were inuted under onditions s desried ove for 40 dys efore used in further experimentl investigtions. Growth mesurement The treted nd ontrol plntlets were hrvested fter 40 dys ulturing, the fresh weight (FW) ws determined, nd then dried to onstnt weight t 60ºC for severl dys nd used to mesure dry weight (DW). The dried mterils were used to ssess the diosgenin ontent. Mesurement of diosgenin ontent nd yields Preprtion of smples nd the indiret ompetitive ELISA ssy method ws performed s previously desried (Li et l. 2010). Diosgenin yields in 10 oxes ulture were mesured using the following formul, Diosgenin yields = diosgenin ontent (% DW) x DW of 10 oxes ulture (mg). Mesurement of solule protein Totl solule proteins were extrted with 100 mm sodium phosphte uffer (ph 7.5) ontining 2 mm sorte nd 0.5 mm ethylene dimine tetreti id (EDTA), nd were quntified ording to Brdford (1976), using ovine serum lumin s stndrd. Mesurement of hlorophyll ontent The hlorophyll ontent ws mesured spetrophotometrilly in 80% etone extrts s desried y Arnon (1949). Totl hlorophyll (Ct) were lulted using the eqution Ct = 1000* A652/34.5. RNA isoltion nd semi-quntittive RT-PCR nlysis Cultures treted with ethephon t onentrtion E3 were used to exmine the expression level of genes involved in diosgenin iosynthesis in omprison with the ontrol smples. DOI: /vol16-issue5-fulltext-9 3

4 Dirr et l. Totl RNA from the treted nd ontrol smples, ws isolted using TRI plnt Totl RNA Fst Extrtion Kit (Spin-olumn) (BioTeke Corportion, Beijing) ording to mnufturer s instrutions. Frgments ontining oding zones of different genes were mplified y RT-PCR. Semi-quntittive PCR retions were performed using 31 yles for CAS (GenBnk ession no. AM697885), 33 yles for SQS (GenBnk ession no. JN693497), 31 yles for FPPS (GenBnk ession no. JN693498), 28 yles for HMGR (GenBnk ession no. DQ017377) nd 27 yles for tin (GenBnk ession no. JN693499), the quntittive primers were designed ording to known sequene listed in the Tle 1. PCR retions were rried out in n ABI thermoyler using Tq DNA polymerse (Ferments) under the following onditions: n initil 5 min denturing t 94ºC, followed y yles of 94ºC 20 se, 58ºC 20 se, nd 72ºC 30 se. PCR produts were smpled t the forementioned speified yles nd nlyzed y 1.5% grose gel eletrophoresis. Tle 1. Primer sets used for the semi-quntittive RT-PCR. Gene nme Aession numer Primer nme Primer sequene (5 to 3 ) HMGR DQ HMGR-qF HMGR-qR GTTTCCAAGGGTGTCCAAAA GCCCCACAGACAACTGATTT FPPS JN FPS-qF FPS-qR TAAGGTGGGCCTTATTGCTG TCGCAAGGTCTTGTTCTCCT SQS JN SQS-qF SQS-qR ATTCCGGCTGATGTCAAAGT ATAACCTTTGCCAAGCTCCA CAS AM CAS-qF CAS-qR CATCCGGAAAGCTTGTGATT AAGCGCTAACATGACCCAAC Atin JN Atin-qF Atin-qR ATGCCATTCTTCGTTTGGAC CTACTCTTGGCGGTTTCCAG Sttistil nlysis Differenes etween the tretments nd the ontrols of the dt were nlyzed y n nlysis of vrine, nd the post ho Dunn s multiple rnge test ws used when pproprite. Person s orreltion test ws rried out etween diosgenin nd other prmeters. All sttistil nlyses were performed using the SPSS pkge (SPSS In., Chigo, IL) nd were onsidered signifint t P < RESULTS Effets of ethylene on the growth of in vitro ultures of D. zingierensis Higher onentrtions of ethephon (E1, E2, nd E3) hd inhiitory effet on the growth of ultures (Figure 2), wheres the lower (E4) onentrtion didn t indue ny evident hnges in the treted smples ompred with the ontrol smples. The FW deresed in ethephon-treted plnts with derement of 26%, 24%, 14%, nd 18% in E1, E2, E3 nd E4 ompred to CK. Ethephon tretment lso signifintly lowered dry mss with the highest derement in E1 (25% ompred to CK) nd then E3 (23% ompred to CK) (Figure 3). DOI: /vol16-issue5-fulltext-9 4

5 Biomss (g) Ethylene tretment improves diosgenin umultion in Diosore zingierensis Fig. 2 Effet of ethylene on the phenotypi shpe of in vitro ultures of D. zingierensis C C B B A E1 E2 E3 E4 CK Ethylene onentrtion FW DW Fig. 3 Effet of ethylene on iomss in vitro ultures of D. zingierensis. The fresh mss (FW) nd dry mss (DW) were mesured in 10 oxes ulture plnts. Vlues re the mens ± SD (n = 3). Vlues with different smll letters (FW) or pitl letters (DW) re signifintly different t the p < 0.05 level, ording to Dunn s multiple rnge test. Effets of ethylene on diosgenin ontent in ultures The results (Figure 4) show tht with the derese of ethephon onentrtion, the diosgenin level in treted smples temporrily inresed nd then deresed. The highest level of diosgenin (inrese of 149.8% over tht of the ontrol smples) ws hieved with onentrtion E3. When expressed with yield, the E3 nd E2 showed signifint inrese (93% nd 21% ompred to CK) in 10 oxes ulture plnts (Figure 4). Effets of ethylene on solule protein nd hlorophyll ontent The umultion of solule protein hd similr trend of diosgenin umultion (Figure 5). Their levels inresed together with diosgenin, whih suggests tht determined level of protein umultion is required for diosgenin iosynthesis in plnt tissue. High ethylene onentrtion inhiited hlorophyll umultion, wheres plnts with E 3 tretment inresed hlorophyll ontent y 33% (Figure 5). DOI: /vol16-issue5-fulltext-9 5

6 Diosgenin yields (mg) Diosgenin (% DW) Dirr et l. 1,8 1,6 1,4 1,2 1 0,8 0,6 0,4 0,2 0 d E1 E2 E3 E4 CK e d 5 0 E1 E2 E3 E4 CK Fig. 4 Effet of ethylene on diosgenin ontent nd diosgenin yields (10 oxes) in in vitro ultures of D. zingierensis. Vlues re the mens ± SD (n = 4). Vlues with different letters re signifintly different t the p < 0.05 level, ording to Dunn s multiple rnge test. Effet of ethylene on genes expression The results shown in Figure 6 indited tht in omprison with the ontrol smples, the expression of ylortenol synthse (CAS) gene ws up-regulted t ll time points, nd HMGR gene show signifint response to 8 hrs ethylene tretment. FPPS gene is only slightly up-regulted fter 4 hrs eliitor pplition. However, ethylene tretment didn t indue ny evident hnges in the expression of squlene synthse (SQS) gene. DISCUSSION The mehnism of the ethylene effet on the diosgenin synthesis nd umultion is still not lerly understood. This study investigted enhnement effet of ethylene on the umultion of diosgenin in D. zingierensis ultures, nd the gene expressions of key omponents involved in diosgenin iosynthesis to delinete the moleulr mehnisms governing the proess. The diosgenin iosynthesis nd umultion re very omplex proesses whih re tightly regulted y primry metolism. Our results showed tht the pplition of ertin onentrtions of ethylene n improve diosgenin iosynthesis in in vitro ultures of D. zingierensis (Figure 4) whih is onsistent with existing findings (De nd De, 2003). Reently, Gómez et l. (2004) reported the inrese in diosgenin iosynthesis nd umultion when the fenugreek ells suspension ws treted with ethephon. The diosgenin ontent first inresed with the derese of ethephon onentrtion, nd then deresed. The derese of diosgenin ontent indued y lower nd higher onentrtion of ethylene my e due to the indution of other metoli pthwys whose tivities n inhiit or slow down the diosgenin iosynthesis pthwy. In the mentime, derese of iomss ws oserved in ethylene DOI: /vol16-issue5-fulltext-9 6

7 Chlorophyll ontent (mg g-1 FW) Solule protein (mg g-1 FW) Ethylene tretment improves diosgenin umultion in Diosore zingierensis treted ultures (Figure 2, Figure 3), whih is in greement with other reports in Trigonell foenumgreum (De nd De, 2003; Gómez et l. 2004) e d 1 0 E1 E2 E3 E4 CK 1,8 1,6 1,4 1,2 1 0,8 0,6 0,4 0,2 0 E1 E2 E3 E4 CK Fig. 5 Ethylene indued hnges in solule proteins nd hlorophyll ontent. Vlues re the mens ± SD (n = 3). Vlues with different letters re signifintly different t the p < 0.05 level, ording to Dunn s multiple rnge test. Fig. 6 Anlysis of the effet of ethylene on the expression of CAS, SQS FPPS, nd HMGR genes in ultures of D. zingierensis. The effet of ethylene on diosgenin ontent is losely relted to the solule protein nd hlorophyll ontent (Figure 5). Diosgenin prodution is kind of plnt response to stress, in whih de novo proteins synthesis is required. Nrul et l. (2005) oserved the inrese of diosgenin nd protein ontent in D. ulifer llus ultures grown under ioti stress onditions. Dt for ethylene treted nd ontrol plnts were grouped together to determine the possile orreltions etween diosgenin nd other trits (Tle 2). It ws showed tht diosgenin ontent ws signifintly nd positively orrelted with solule protein (p < 0.01), s well s hlorophyll (p < 0.01). Ehmke nd Eilert (1993) demonstrted positive DOI: /vol16-issue5-fulltext-9 7

8 Dirr et l. orreltion etween solsodine level nd hlorophyll ontent in suspension ultures of Solnum dulmr, whih is in greement with our results. Tle 2. Correltions etween diosgenin nd other prmeters. The tle shows the Person orreltion oeffiient (*: P < 0.05; **: P < 0.01). FW DW Diosgenin Diosgenin yield Solule Protein Chlorophyll FW 1 DW 0.77** 1 Diosgenin Diosgenin yield ** 1 Solule protein ** 0.77** 1 Chlorophyll 0.53* ** 0.84** 0.57* 1 Mny studies show tht trnsriptionl modultion of relted genes is ommon response to pthogens or eliitor signls. Inspetions on DNA sequenes of eliitors (for exmple, JA nd ethylene) responsive genes hve identified severl eliitor response elements in these genes whih re involved in the iosynthesis of seondry metolites (Zho et l. 2005). We provided evidene here tht gene expressions of, CAS, HMGR, nd FPPS in in vitro ultures of D. zingierensis were indued y ethylene pplitions whih led to the improvement of diosgenin iosynthesis (Figure 6). The enzymes CAS re responsile for triterpene iosynthesis tlyzing the formtion of ylortenol whih is then onverted into holesterol, the most importnt preursor of diosgenin (Friedmn et l. 1997; Arnqvist et l. 2003). Kim et l. (2011) nd Hn et l. (2006) reported the eliitor MJ indued upregultion of CAS in Bupleurum fltum, nd Pnx ginseng, respetively. Lee et l. (2004) reported tht overexpression of the squlene synthse gene ws followed y up-regultion of CAS gene in trnsgeni P. ginseng. However, Kim et l. (2011) found tht methyl jsmonte tretment redued the expression of CAS gene in the roots of wild Bupleurum fltum. HMGR, tlyzing the onversion of HMG-CoA to mevloni id, is onsidered s rte-limiting enzyme in holesterol synthesis, nd it lso plys ritil role in ontrolling isoprenoid derivtives relted pthwys (Chen et l. 2012). Cools et l. (2011) found tht ethylene tretment ould inrese in the expression of HMGR gene in onion. HMGR gene expression ws indued y eliitor in Miheli hpensis (Co et l. 2011). In our study, the hnges in HMGR gene expression seemed to e time-dependent, nd the highest level ppered 8 hrs ethylene tretment (Figure 6). FPPS hs not een identified s key regultory enzyme in triterpene iosynthesis (Kim et l. 2010). In this work, its expression is time-dependent (Figure 6). Ding et l. (2008) estlished tht FPPS gene possessed vrious potentil regultory elements ssoited with physiologil nd environmentl ftors. A down-regultion of SQS gene is oserved in ethylene treted smples (Figure 6). This finding is similr with wht reported y Devrenne et l. (2002), who found tht solute level of the SQS mrna deresed pproximtely 5-fold in the eliitortreted ells, suggesting deresed trnsription of the SQS gene. In onlusion, our results suggest tht ethylene tretment enhned diosgenin umultion y onsiderly ffeting the expression of CAS nd HMGR gene in the present study. Further investigtions will e neessry to eluidte the speifi role of eh gene involved in diosgenin iosynthesis regultion, nd to fix the mehnism y whih CAS nd HMGR n e involved in triterpenes iosyntheti pthwy. Finnil support: This work ws supported y the Ntionl Nturl Siene Foundtion of Chin ( ) nd the Chinese 111 projet (B06018). DOI: /vol16-issue5-fulltext-9 8

9 Ethylene tretment improves diosgenin umultion in Diosore zingierensis REFERENCES ARNON, D.I. (1949). Copper enzymes in isolted hloroplsts. Polyphenoloxidse in Bet vulgris. Plnt Physiology, vol. 24, no. 1, p [CrossRef] ARNQVIST, L.; DUTTA, P.C.; JONSSON, L. nd SITBON, F. (2003). Redution of holesterol nd glyolkloid levels in trnsgeni potto plnts y overexpression of type 1 sterol methyltrnsferse DNA. Plnt Physiology, vol. 131, no. 4, p [CrossRef] BRADFORD, M.M. (1976). A rpid nd sensitive method for the quntittion of mirogrm quntities of proteinutilizing the priniple of protein-dye inding. Anlytil Biohemistry, vol. 72, no. 1-2, p [CrossRef] BROWN, G.D. (1998). The iosynthesis of steroids nd triterpenoids. Nturl Produt Reports, vol. 15, no. 6, p [CrossRef] CAO, X.Y.; LI, C.G.; MIAO, Q.; ZHENG, Z.J. nd JIANG, J.H. (2011). Moleulr loning nd expression nlysis of lef-speifi expressing 3-hydroxy-3-methylglutryl-CoA (HMG-CoA) redutse gene from Miheli hpensis Dndy. Journl of Mediinl Plnts Reserh, vol. 5, no. 16, p CHEN, X.; WANG, X.; LI, Z.; KONG, L.; LIU, G.; FU, J. nd WANG, A. (2012). Moleulr loning, tissue expression nd protein struture predition of the porine 3-hydroxy-3-methylglutryl-oenzyme A redutse (HMGR) gene. Gene, vol. 495, no. 2, p [CrossRef] CHENG, J.; HU, C.Y.; PANG, Z.J. nd XU, D.P. (2008). Isoltion nd struture identifition of steroidl sponin from Diosore zingierensis. Chinese Trditionl Her Drugs, vol. 39, no. 2, p COOLS, K.; CHOPE, G.A.; HAMMOND, J.P.; THOMPSON, A.J. nd TERRY, L.A. (2011). Ethylene nd 1- methylylopropene differentilly regulte gene expression during onion sprout suppression. Plnt Physiology, vol. 156, no. 3, p [CrossRef] DE, D. nd DE, B. (2003). Effet of ethephon on ntioxidnt enzymes nd diosgenin prodution in seedlings Trigonell foenum-greum. Food Chemistry, vol. 82, no. 2, p [CrossRef] DE, D. nd DE, B. (2005). Eliittion of diosgenin prodution in Diosore floriund y ethylene-generting gent. Fitoterpi, vol. 76, no. 2, p [CrossRef] DEVARENNE, T.P.; GHOSH, A. nd CHAPPELL, J. (2002). Regultion of squlene synthse, key enzyme of sterol iosynthesis, in too. Plnt Physiology, vol. 129, no. 3, p [CrossRef] DEWICK, P.M. (2002). Mediinl Nturl Produts: A Biosyntheti Approh. Seond Edition, John Wiley & Sons, Chihester, UK, p DING, Z.Z.; ZHOU, X.L. nd WANG, Y.C. (1991). Study of influening ftors of diosgenin in Diosore zingierensis. Chinese Trditionl Her Drugs, vol. 12, p DING, Y.X.; OU-YANG, X.; SHANG, C.H.; REN, A.; SHI, L.; LI, Y.X. nd ZHAO, M.W. (2008). Moleulr loning, hrteriztion, nd differentil expression of frnesyl-diphosphte synthse gene from the sidiomyetous fungus Gnoderm luidum. Biosiene, Biotehnology nd Biohemistry, vol. 72, no. 6, p [CrossRef] EHMKE, A. nd EILERT, U. (1993). Solnum dulmr L. (Bittersweet): Aumultion of steroidl lkloids in the plnt nd different in vitro systems. In: BAJAJ, Y.P.S. ed. Biotehnology in Agriulture nd Forestry 21. Mediinl nd Aromti Plnts IV. Springer Berlin Heidelerg. p [CrossRef] FRIEDMAN, M.; MCDONALD, G.M. nd FILADELFI-KESZI, M. (1997). Potto glyolkloids: Chemistry, nlysis, sfety, nd plnt physiology. Critil Reviews in Plnt Sienes, vol. 16, no. 1, p [CrossRef] GÓMEZ, P.; ORTUÑO, A. nd DEL RÍO, J.A. (2004). Ultrstruturl hnges nd diosgenin ontent in ell suspensions of Trigonell foenum-greum L. y ethylene tretment. Plnt Growth Regultion, vol. 44, no. 2, p [CrossRef] GONG, G.; QIN, Y.; HUANG, W.; ZHOU, S.; WU, X.; YANG, X.; ZHAO, Y. nd LI, D. (2010). Protetive effets of diosgenin in the hyperlipidemi rt model nd in humn vsulr endothelil ells ginst hydrogen peroxideindued poptosis. Chemio-Biologil Intertions, vol. 184, no. 3, p [CrossRef] HAN, J.Y.; JUNG, S.J.; KIM, S.W.; KWON, Y.S.; YI, M.J.; YI, J.S. nd CHOI, Y.E. (2006). Indution of dventitious roots nd nlysis of ginsenoside ontent nd the genes involved in triterpene iosynthesis in Pnx ginseng. Journl of Plnt Biology, vol. 49, no. 1, p [CrossRef] HUAI, Z.P.; DING, Z.Z.; HE, S.A. nd SHENG, C.G. (1989). Reserh on orreltions etween limti ftors nd diosgenin ontent in Diosore zingierensis wright. At Phrmologi Sini, vol. 24, no. 9, p HUANG, Z.; JIANG, K.; PI, Y.; HOU, R.; LIAO, Z.; CAO, Y.; HAN, X.; WANG, Q.; SUN, X. nd TANG, K. (2007). Moleulr loning nd hrteriztion of the yew gene enoding squlene synthse from Txus uspidt. Journl of Biohemistry nd Moleulr Biology, vol. 40, no. 5, p [CrossRef] KIEBER, J.J. (1997). The ethylene response pthwy in Aridopsis. Annul Review of Plnt Physiology nd Plnt Moleulr Biology, vol. 48, no. 1, p [CrossRef] KIM, O.T.; BANG, K.H.; JUNG, S.J.; KIM, Y.C.; HYUN, D.Y.; KIM, S.H. nd CHA, S.W. (2010). Moleulr hrteriztion of ginseng frnesyl diphosphte synthse gene nd its up-regultion y methyl jsmonte. Biologi Plntrum, vol. 54, no. 1, p [CrossRef] KIM, O.T.; KIM, S.H.; OHYAMA, K.; MURANAKA, T.; CHOI, Y.E.; LEE, H.Y.; KIM, M.Y. nd HWANG, B. (2010). Upregultion of phytosterol nd triterpene iosynthesis in Centell siti hiry roots overexpressed ginseng frnesyl diphosphte synthse. Plnt Cell Reports, vol. 29, no. 4, p [CrossRef] KIM, Y.S.; CHO, J.H.; PARK, S.; HAN, J.Y.; BACK, K. nd CHOI, Y.E. (2011). Gene regultion ptterns in triterpene iosyntheti pthwy driven y overexpression of squlene synthse nd methyl jsmonte eliittion in Bupleurum fltum. Plnt, vol. 233, no. 2, p [CrossRef] DOI: /vol16-issue5-fulltext-9 9

10 Dirr et l. LEE, M.H.; JEONG, J.H.; SEO, J.W.; SHIN, C.G.; KIM, Y.S.; IN, J.G.; YANG, D.C.; YI, J.S. nd CHOI, Y.E. (2004). Enhned triterpene nd phytosterol iosynthesis in Pnx ginseng overexpressing squlene synthse gene. Plnt nd Cell Physiology, vol. 45, no. 8, p [CrossRef] LEE, J.; JUNG, K.; KIM, Y.S. nd PARK, D. (2007). Diosgenin inhiits melnogenesis through the tivtion of phosphtidylinositol-3-kinse pthwy (PI3K) signling. Life Sienes, vol. 81, no. 3, p [CrossRef] LEE, S. nd POULTER, C.D. (2008). Cloning, soluiliztion, nd hrteriztion of squlene synthse from Thermosynehoous elongtus BP-1. Journl of Bteriology, vol. 190, no. 11, p [CrossRef] LI, J.; YANG, D.; YU, K.; HE, J. nd ZHANG, Y. (2010). Determintion of diosgenin ontent in mediinl plnts with enzyme-linked immunosorent ssy. Plnt Medi, vol. 76, no. 16, p [CrossRef] MALDONADO-MENDOZA, I.E.; VINCENT, R.M. nd NESSLER, C.L. (1997). Moleulr hrteriztion of three differentilly expressed memers of the Cmptothe uminte 3-hydroxy-3-methylglutryl CoA redutse (HMGR) gene fmily. Plnt Moleulr Biology, vol. 34, no. 5, p [CrossRef] MARKER, R.E.; TSUKAMOTO, T. nd TURNER, D.L. (1940). Sterols. C. Diosgenin. Journl of the Amerin Chemil Soiety, vol. 62, no. 9, p [CrossRef] MURASHIGE, T. nd SKOOG, F. (1962). A revised medium for rpid growth nd io ssys with too tissue ultures. Physiologi Plntrum, vol. 15, no. 3, p [CrossRef] NAMDEO, A.G. (2007). Plnt ell eliittion for prodution of seondry metolites: A review. Phrmognosy Reviews, vol. 1, no. 1, p NARULA, A.; KUMAR, S. nd SRIVASTAVA, P.S. (2005). Aioti metl stress enhnes diosgenin yield in Diosore ulifer L. ultures. Plnt Cell Reports, vol. 24, no. 4, p [CrossRef] ONCINA, R.; DEL RI O, J.A.; GÓMEZ, P. nd ORTUÑO A. (2002). Effet of ethylene on diosgenin umultion in llus ultures of Trigonell foenum-greum L. Food Chemistry, vol. 76, no. 4, p [CrossRef] PARK, H.; DENBOW, C.J. nd CRAMER, C.L. (1992). Struture nd nuleotide sequene of tomto HMG2 enoding 3-hydroxy-3-methylglutryl oenzyme A redutse. Plnt Moleulr Biology, vol. 20, no. 2, p [CrossRef] RADMAN, R.; SÁEZ, T.; BUCKE, C. nd KESHAVARZ, T. (2003). Eliittion of plnts nd miroil ell systems. Biotehnology nd Applied Biohemistry, vol. 37, no. 1, p [CrossRef] TADA, Y.; KANDA, N.; HARATAKE, A.; TOBIISHI, M.; UCHIWA, H. nd WATANABE, S. (2009). Novel effets of diosgenin on skin ging. Steroids, vol. 74, no. 6, p [CrossRef] WANG, Y.; GUO, B.; ZHANG, F.; YAO, H.; MIAO, Z. nd TANG, K. (2007). Moleulr loning nd funtionl nlysis of the gene enoding 3-hydroxy-3-methylglutryl oenzyme A redutse from hzel (Corylus velln L. Gswy). Journl of Biohemistry nd Moleulr Biology, vol. 40, no. 6, p [CrossRef] YAN, L.L.; ZHANG, Y.J.; GAO, W.Y.; MAN, S.L. nd WANG, Y. (2009). In vitro nd in vivo ntiner tivity of steroid sponins of Pris polyphyll vr. yunnnensis. Experimentl Onology, vol. 31, no. 1, p ZHAO, J.; DAVIS, L.C. nd VERPOORTE, R. (2005). Eliitor signl trnsdution leding to prodution of plnt seondry metolites. Biotehnology Advnes, vol. 23, no. 4, p [CrossRef] How to referene this rtile: DIARRA, S.T.; HE, J.; WANG, J. nd LI, J. (2013). Ethylene tretment improves diosgenin umultion in in vitro ultures of Diosore zingierensis vi up-regultion of CAS nd HMGR gene expression. Eletroni Journl of Biotehnology, vol. 16, no DOI: /vol16-issue5-fulltext-9 10 Note: Eletroni Journl of Biotehnology is not responsile if on-line referenes ited on mnusripts re not ville ny more fter the dte of pulition. Supported y UNESCO / MIRCEN network.