Infrequent Mutation of the WTl Gene 77 Wilrns' Turnors

Transcription

1 HUMAN MUTATION 3: (1994) RESEARCH ARTICLE Infrequent Muttion of the WTl Gene 77 Wilrns' Turnors tn M. Gessler*, A. Konig, K. Arden, P. Grundy, s. Orkin, s. Slln, c. Peters, s. Ruyle, J. Mndell, F. Li, w. Cvenee, nd G. Bruns Institut fur Humngenetik der Philipps-Universitiit, Mrburg, Germny (M. G., A. K.), Ludwig Institute for Cncer Reserch nd Deprtment of Medicine, University of Cliforni t Sn Diego, L l oll, Cliforni (K.A., W.c.), Cross Cncer Institute, Edmonton, Albert, Cnd (P.G. ), Division of HemtologylOncology, Children's Hospitl, Deprtment of Peditrics, Hrvrd Medicl School nd Howrd Hughes Medicl Institute, Boston, Ms schusetts (S.O.), Division of Peditric Oncology, Dn Frber Cncer Institute nd Deprtment of Peditrics, Hrvrd Medicl School, Boston, Msschusetts (S.5.), Division of Urology, Deprtment of Surgery, Children's Hospitl, Hrvrd Medicl School, Boston, Msschusetts (c. P., S. R., l. M.), Dn-Frber Cncer Institute, Boston, Msschusetts (F. L.), nd Genetics Division, Children's Hospitl nd Dept. of Peditrics, Hrvrd Medicl School, Boston, Msschusetts (0. B.); Fx: I Communicted by Jurgen Horst Homozygous deletions in Wilms' tumor DNA hve been key step in the identifiction nd isoltion of the WTI gene. Severl dditionl loci re lso postulted to contribute to Wilms' tumor formtion. To ssess the frequency of WTI ltertions we hve nlyzed the WTI locus in pnel of 77 Wilms' tumors. Eight tumors showed evidence for lrge deletions of severl hundred or thousnd kilobsepirs of DNA, some of which were lso cytogeneticlly detected. Additionl intrgenic muttions were detected using more sensitive SSCP nlyses to scn ll 10 WTI exons. Most of these result in premture stop codons or missense muttions tht inctivte the remining WTI llele. The overll frequency of WTI ltertions detected with these methods is less thn 15%. While some muttions my not be detectble with the methods employed, our results suggest tht direct ltertions of the WTI gene re present in only smll frction of Wilms' tumors. Thus, muttions t other Wilms' tumor loci or disturbnce of interctions between these genes likely ply n importnt role in Wilms' tumor development Wiley-Liss. Inc. KEY WORDS: Wilms' tumor, WTI, Zinc finger gene, Tumor suppressor gene, Nephroblstom, Deletion nlysis, SSCP nlysis, Muttion screening INTRODUCTION Wilms tumor, n embryonic renl tumor, is thought to rise through the loss or functionl inctivtion of one or more tumor suppressor genes, first postulted from epidemiologicl dt (Knudson nd Strong, 1972). This concept is supported by deletions including chromosome llp13 found in spordic tumors (Dougls et I., 1985) nd the high incidence (40-60%) of Wilms' tumors in children with constitutionl hemizygous deletions of chromosome bnd 11p13- condition known s the WAGR syndrome (Wilms' tumor, niridi, genitourinry nomlies, nd mentl retrdtion) (Frncke et I., 1979). Studies on loss of heterozygos ity (LOH) in tumor DNA lso showed frequent involvement of chromosome IIp. Lter it could be shown, however, tht this loss of lleles is often limited to chromosome 11p15 where second locus involved in Wilms' tumor formtion, WT2, hs been postulted (Mnnens et I., 1988; Koufos et I., 1989; Reeve et I., 1989; Wdey et I., 1990). More recently, third locus on chromosome 16q ws shown to be lost in bout 20% of Wilms' tumors (Mw et I., 1992). In ddition, none of these loci seems to confer susceptibility to the fmilil form of Wilms' tumor in severl wellstudied kindreds, suggesting the existence of yet Received August 27, 1993; ccepted October 21, *T 0 whom reprint requests/correspondence should be ddressed: Dr. Mnfred Gessler, Theodor-Boveri-Institut fur Biowissenschften, Physiologische Chemie I, Am Hublnd, D WUrzburg, Germny WILEY-LlSS. INC.

2 MUTATION OF THE WTl GENE IN WILMS' TUMORS 213 nother contributing gene (Grundy et I., 1988; Huff et l., 1988, 1992). Until now only the 11p13 locus, WTl, hs been isolted by positionl cloning strtegy using homozygous deletions found in tumor DNA (Cll et I., 1990; Gessler et I., 1990). The gene encodes zinc finger protein tht binds DNA in sequence specific mnner nd cn regulte trnscription of trget genes (Mdden et l., 1991). The role of WT 1 s tumor suppressor gene hs been supported by the detection of intrgenic homozygous deletions in tumor DNA nd more recently by point muttions within the zinc finger domin (Hber et I., 1990; Huff et I., 1991; Ton et I., 1991; Pelletier et l., 1991b; Bird et l., 1992; Brown et l., 1992; Little et l., 1992; Coppes et I., 1993; Gessler et I., 1993). These ltter studies, however, were minly focused on ltertions within the zinc finger domin encoded by exons 7 through 10, nd provided less informtion regrding the entire 5' region of the gene. Despite these cler exmples of inctivtion of the WT 1 gene in Wilms' tumors, the overll frequency of WT 1 ltertions is still uncler. Here we hve chrcterized the type of muttions ffecting the WT 1 gene nd evluted their frequency in pnel of 77 Wilms' tumor DNAs using both, gene dosge studies, nd single-exon SSCP nlysis, supplemented by other pproches in some of the cses. Results on three of the tumors from this pnel, WT8A, PER, nd S (Gessler et I., 1990, 1993), hve lredy been reported previously, nd re included here to provide more complete description of the type of WT 1 muttions we hve found. MATERIALS AND METHODS DNA Smples T umor tissue ws kept t -70 C nd DNA ws extrcted ccording to stndrd protocols (Smbrook et I., 1989). In some cses either norml djcent kidney tissue or blood smples from the respective ptient were vilble for comprison. DNA from norml lymphoblstoid cell lines were used s controls. All hybridiztion probes used hve been described in Gessler et l. (1989, 1990). Gene Dosge Anlysis The preprtion of Southern blot filters, hybridiztion conditions, nd evlution of utordiogrms hve been described previously (Gessler et l., 1989). In brief, tumor DNAs (4 flg) were digested with EeRI nd gel loding ws djusted for ll smples ccording to DNA concentrtions determined by flourometric mesurements. Equl loding ws verified by hybridiztion with non chromosome 11 probes. Filters were hybridized with up to three probes simultneously nd they were reused for subsequent probings to fcilitte comprison of signl strength. Control DNAs nd mtching DNA smples from norml tissue, if vilble, were used for comprison. Evlution of gene dosge ws done by visul inspection nd lser scnning densitometry s described (Gessler et t., 1989). A reduction in signl strength to bout 50% of control vlues ws interpreted s hemizygous deletion. Anlysis of Allele Loss For studies on loss of heterozygosity pirs of norml nd tumor DNA from the sme ptient were nlyzed with polymorphic mrkers s described in Koufos et \. (1989). Allele sttus for HRAS nd TH ws determined by PCR mplifiction of microstellite mrkers (Polymeropoulos et t., 1991; Tnci et l., 1992). RT -PCR Anlysis Preprtion of first strnd cdna from Wilms' tumor RNA, PCR mplifiction of the WT 1 coding region, nd sequencing of the subcloned cdna hve been described in Gessler et \. (1993). A segment corresponding to nucleotides of the WTl cdna sequence (HSWTl) ws nlyzed from three independent plsmid clones. Oligonucleotide Primers All oligonucleotide primers were designed using the PRIMER progrm developed by Lnder et t. (Whitehed Institute), bsed on the genomic sequence ofwtl (EMBL: X61631-X61640; Gessler et I., 1992). Generlly, the primers f lnk one exon with intronic splice consensus sequences to give PCR products of 174 to 253 nucleotides. For exons 1 nd 10 only the coding region ws nlyzed. The sequences of the respective primers re listed in Tble 1. Crude oligonucleotides (MWG Biotech, Ebersberg) were ethnol-precipitted twice nd stored in wter t - 20 C. All sequence mnipultions nd comprisons were done using the GCG/HUSAR sequence nlysis pckge t DKFZ (Heidelberg). SSCP Anlysis DNA frgments were mplified from genomic DNA nd lbeled by ezp]dctp incorportion

3 214 GESSLER ET AL. TABLE 1. Primers for the Amplifiction of WTl Exons Anneling Product temperture length Exon Sense primer Antisense primer (cc) (bp) 1 cggggcgtgcctggcg gcggggtccctggcgc cgggcccgctgcctg ggggctcccttggttccg ccggctcggtctcgtgt ggcccgcgcggc tgcttttggcgttgtg ggggctggtgg gggcttttcctggttctg cctttgctttgcctctcc gtggcccctggccttt ggccggtgtggggg " ggcttgcctcccttcct tgggcctgggggc ggtccccttttccgttc cgctgccgctgg cttgttgggccgggct cttttcctccctctctc tgtgcctgtctctttgttgc gttcccctgtgctgcct mm spermidine must be dded with this primer pir to suppress rtifctul bnds. (modified from Orit et I., 1989). In generl, mster mix for up to 40 rections ws prepred contining 1 X rection buffer (50 mm KCL, 10 mm Tris-HCl ph8, 1.5 mm MgClz)' 20 f.lm ech dgtp, datp, dttp, 2 f.lm dctp, 20 f.lci [uy p]dctp, primers (1 f.lg ech), 50 f.lg/ml BSA, nd 20 units Tq polymerse in totl volume of 380 f.l1. Rections were ssembled on ice by mixing 9.5 f.ll mster mix with 0.5 f.ll DNA ( ng) nd overlyed with minerl oil. Amplifiction ws strted with denturtion t 94 C for 5 min, followed by 30 cycles of 94 C (30 sec), C (30 sec), nd noc (30 sec) nd finl extension t noc for 5 min. One microliter of the PCR products ws diluted in 20 f.llloding buffer (95% formmide, 10 mm NOH, 0.1 % bromphenol blue, 0.1 % xylene cynol) nd dentured for 5 min t 90 e. After quick cooling on ice 2 f.ll of ech smple ws loded on 6% polycrylmide gels nd run in 0.5 X TBE with 30W either t 4 C or with the ddition of 10% glycerol to the gel t room temperture. Gels were dried onto filter pper nd exposed to X-ry film for hr. DNAs from norml lymphoblstoid cell lines served s dditionl controls. Nondentured PCR products were included to identify wek signls from rentured doublestrnded DNA. Direct Sequence Anlysis of per Products For homozygous ltertions ng of genomic DNA were mplified under stndrd conditions in 100 f.ll rection volume. Heterozygous DNA smples were nlyzed by cutting the norml nd berrnt frgments from dried SSCP gels followed by stndrd PCR mplifiction with prt of the gel piece present. In both cses PCR products were purified by chloroform extrction nd binding to glssmilk (BI0101). The size nd mount of DNA products were checked by gel electrophoresis of smll liquot. Generlly 114 of 100 f.ll rection ( ng) ws used for sequence nlysis ccording to the instructions provided with the fmol kit (Promeg). In brief, one of the mplifiction primers (20 ng) ws end-lbeled with h_3zp]atp (1 f.lci) nd the four termintion rections (5 f.ll) were ssembled on ice nd covered with prffin oil. Smples were trnsferred to hot thermoblock (95 C) nd subjected to 30 cycles of liner mplifiction with 30 sec ech t 94, 60, nd n e. Sequencing rections were stopped by dding 4 f.ll of formmide/dye mix nd seprted on denturing polycrylmide gels (8%) followed by drying of the gel nd exposure to X-ry film for 6-24 hr. Deletion Anlysis RESULTS A pnel of 77 Wilms' tumors ws ssembled during this study. The clinicl, pthologicl, nd cytogenetic fetures of cses with WT 1 ltertions re detiled in Tble 2. In some cses DNA from blood or norml kidney of the sme ptient ws vilble for comprison. Initilly, the tumors were exmined for deletions nd gross rerrngements round the WTl locus by Southern blot nlysis with the WT 1 cdna clone nd pnel of hybridiztion probes tht cover 15 Mbp region from llp13-p14 (Gessler et l., 1989, 1990; Gessler nd Bruns, 1989). In ll cses gene dosge ws mesured to detect hemizygous deletions. About 20% of tumors showed vrying degrees of DNA degrdtion nd could not be evluted unmbiguously. Surprisingly, only the two tumors described previously (WT 8A nd PER, Gessler et I., 1990) showed evidence of homozygous deletion of the WT 1 gene. In one cse, PER, both chromosomes

4 MUTATION OF THE WTl GENE IN WILMS' TUMOHS 215 TABLE 2. Clinicl nd Moleculr Fetures of Wilms' Tumors Tumor Sex! Age t Loss of Sttus of 11p/WTl smple Clinicl fetures kryotype dignosis Pthology heterozygosity Allele 1 Allele 2 WT8A Cliniclly Mle 18 m Stge Ill, fvorble n.d. Lrge Lrge norml histology deletion deletion PEH N/A N/A N/A N/A n.d. Deletion, Deletion, 170 kbp 170 kbp S Aniridi, 46XY, 7 yr Blsteml tumor, focl Heterozygous Lrge 1 bp deletion hypospdis, del tubulr differentition, for HHAS, TH deletion in exon 7, cryptorchidism 11pI4.1 no nephroblstomtosis stop codon (WAG) -p13 S87-52 Cliniclly Mle 13 m Stge I, fvorble Heterozygous Lrge c to t, His to norml histology, multicentric for HHAS, deletion Tyr in tumor, multifocl INS, HBB, exon 8 intrlobr CAT nephroblstomtosis S Cliniclly Femle 11.5 m Fvorble histology, Heterozygous Lrge 5 bp deletion norml interstitil nephritis nd for HHAS, deletion in exon 1, moderte INS, CALCA stop codon glomerulosclerosis, no nephroblstomtosis P.N. Cliniclly Mle 1 yr, 10m Stge 11, fvorble n.d. Lrge No muttion norml histology deletion found WT2A Aniridi, 46XY 4 yr, 5 m Stge Ill, fvorble Heterozygous Lrge c to tin exon perinel histology for HHAS, TH deletion 9, stop hypospdis, very likely codon filure of scrotl fusion nd persistent c10c (WAG) WT 12A Low set ers, 46XY, 7m Stge I, fvorble Heterozygous del 11p13 in 5 bp deletion crdiomegly, del histology, possible for HHAS, tumor in exon 2, developmentl 11p13 intrlobr nephrogenic TH, HBB, kryotype stop codon dely, no rests, recurrence fter CALCA, niridi! chemotherpy FSHB BTl Minor foot 46XY 3 yr, 11 m Stge IV, no n.d. ccc to tec; P No muttion nomly nephroblstomtosis to S in found exon 2 S Cliniclly 46 XX 2 yr Bilterl, fvorble Not informtive g to t t - 20, g to t t - 20, norml histology, for HHAS, TH upstrem upstrem nephroblstomtosis, exon 3 exon 3 metsttic recurrence of tumor MHl Cliniclly Mle 3 yr Stge 11, strom-rich n.d. Insertion t No muttion norml tumor - 58, exon found 3 11 showed the identicl deletion of 170 kbp, s probes from the brekpoint region detected only one type of junction frgment with norml copy number. This implies tht homozygos ity for the deletion ws chieved through mitotic recombintion or chromosome loss with dupliction of the deletion chromosome. The second homozygous deletion of WT 1, seen in Wilms' tumor 8A, is fl nked on both sides by lrge regions tht show reduced copy number for multiple probes suggesting hemizygous deletion. The homozygous deletion thus ppers to result from either two independent nd prtilly overlpping deletions or combintion of smller deletion region tht is contined within lrge deletion on the other chromosome (see Fig. 1). In ddition to these homozygous deletions four other tumors (P.N., S87-877, S , nd S87-52) showed evidence of hemizygous deletion of WT 1. The common feture of ll these deletions is their size in the rnge of millions of bse pirs. No smller deletions tht would only encompss the WT 1 gene or single intrgenic restriction frgments were detected.

5 216 GESSLER ET AL. 11 peen WT1 AN2 11 P tel ~ ~ 508 J77 CAT ITR M LFT1 M FSHB "/~(I----~~----~----~----~----~----~----~----~----~----~I/fo ?? DNA probes Mbp P.N.? I.~ '-',;;:. ~, ~ I "",.. -'''',..."'''...,,;;::z,~ M, "., _. ' " I c.0., S.A JJJ " J::w::;;z:, J ? WT8A PER, FIGURE I. Deletions of llp13 in Wilms' tumors spnning the WTl locus. Gene dosge nlysis ws used to estblish the extent of deletions on chromosome IIp. DNA probes used in this study re shown bove the scle br. In most cses severl dditionl DNA probes, some from other chromosomes, were used to confirm nd extend the results depicted in this digrm. Horizontl boxes represent the prts of chromosome IIp mteril present in ech tumor. For tumor WT SA it is uncler whether the res of hemizygous deletion ffect only one chromosome 11 or both. Question mrks bove short boxes indicte uncertinty bout the extent of the deletion outside the mpped re. RNA Anlysis Northern blot nlysis could be performed on RNA from 16 tumors, reveling pprently norml trnscript sizes in ll cses. The mount of WT 1 mrna, however, vried gretly between different tumor smples- phenomenon tht my reflect the different developmentl stge of the cells from which the tumor originted (Beckwith et I., 1990). The deletion of one llele of the WT 1 gene in DNA from four Wilms' tumors led to the ssumption tht the second copy likely suffered more subtle ltertion. In two cses (S nd P.N.) vilble RNA showed norml-sized trnscript. The WT 1 coding region ws then nlyzed by RT-PCR nd sequencing of the mplified nd subcloned frgment. For tumor S deletion of single nucleotide in exon 7 leding to frmeshift muttion ws detected (Gessler et I., 1993). For ptient P.N. no ltertion could be found in the cdna frgment nlyzed (nucleotides ). This, however, does not rule out muttion especilly in the 5'-region of the cdna. This region could not be mplified from the cdna preprtion, perhps due to the high G + C content in tht sequence. For the other two tumors showing hemizygous deletions no tissue ws vilble for RNA nlysis. SSCP Anlysis In order to screen the entire pnel of tumors for subtle ltertions in the WT 1 gene, SSCP nlysis ws employed. Bsed on the genomic sequence of ech of the 10 WTl exons (Gessler et l., 1992, EMBL X61631-X61640) PCR ssys were developed to nlyze single exons with smll mount of flnking intron sequence contining splice donor nd cceptor consensus sequences. Only the coding region ws used nd exon 1 ws divided into two prts to obtin short PCR products ( < 300

6 MUTATION OF THE WTl GENE IN WILMS' TUMORS 217 ) NNNT b) C T A G exon 8 - ZFII 371 K ~ Q R I ~c c c c Q 9 R Q Q R I FIGURE 2. Wilms' tumor S87-52 shows point muttion in exon 8. () SSCP nlysis showed indistinguishble mjor bnds (rrows) in tumor DNA (T) nd norml smples (N). Only dditionl wek bnds displyed ltertions in tumor DNA. (b) Direct sequence nlysis of mplified exon 8 DNA reveled cler c~t substitution shown on the right side with the corresponding mino cid trnsltion. bp) tht give high sensitivity of muttion detection. Due to the high G + C content, the first prt of exon 1 could only be mplified reproducibly from genomic DNA using thermostble Vent polymerse (NEB) t high temperture. Even then, mny tumor nd control DNAs did not give PCR product in repeted experiments nd this prt of the coding region ws therefore not nlyzed ny further. All other primer pirs produced chrcteristic ptterns of two to four bnds upon electrophoresis in nondenturing gels. For exon 7 two different sets of bnds could be distinguished with individuls being either heterozygous or homozygous for one of the vrints (dt not shown). This polymorphism ws lso seen in control DNAs nd hs been recently described s silent A to G muttion in exon 7 by Groves et \. (1992). Severl tumor DNAs exhibited dditionl vrint bnds tht could be due to muttions within the mplified DNA segment. These DNA frgments were then mplified from genomic DNA or cut out from dried gels nd sequenced from both ends using the mplifiction primers. Tumor S87-52, tht ws shown to be hemizygous ly deleted for WT 1, reveled ltered SSCP bnds with primers for exon 8 (Fig. 2). These ltertions were only seen s dditionl wek bnds tht were detected upon prolonged exposure of the gel. The min mplifiction product ppered unltered under different gel running conditions. Direct sequencing of the PCR product reveled point muttion C~T in the remining WTI llele, thereby replcing the first histidine residue of zinc finger 2 by tyrosine. This mino cid residue is key element of zinc binding nd the muttion would be expected to produce nonfunctionl finger structure with concomitnt loss of sequencespecific DNA binding. A second tumor, S87-877, tht ws hemizygously deleted for WT 1 showed very wek nd ltered bnds for exon 1 (Fig. 3). In this cse deletion of 5 bse pirs ws found, leding to reding frme shift tht results in stop codon immeditely fter the deletion with very short residul open reding frme. Interestingly, the deletion involves one copy of direct repet of 5 nucleotides, suggesting polymerse slippge error during repliction. Evidence for WTI inctivting muttions ws pprent in two dditionl cses. Wilms' tumor 12A displyed only ltered SSCP bnds for exon 2 which resulted from 5 bse pir deletion in exon 2, gin leding to premture stop codon within this exon (Fig. 4). In this cse gene dosge nlysis suggested norml copy number for the WT 1 locus, but these results remin tenttive due to pr-

7 218 GESSLER ET AL. N T N N N 2A GAT C exon 1 WT S G Q A R M F P N.. ccggccggccggtgtttcctc ccggccggtgtttcctc.. G Q D V S * FIGURE 3. Deletion of five nucleotide direct repet from exon 1 in Wilms' tumor S SSCP nlysis displyed wek nd ltered bnds in tumor DNA (T). The pentnucleotide stretch deleted in this tumor is depicted in the digrm. A stop codon occurs in the new reding frme fter three mino cids. exon 2 WT 12A N 12A N GAT C.. gccggtcccttcgcgg. S T V T F D G 150 \7 V 5nt.. gccggttcgcgg.. S T V R R DAQLR <:: SHALAPCGAVPQPLIQA* FIGURE 4. SSCP nlysis (left) nd direct sequence nlysis (right) of exon 2 revels five bse pir deletion in Wilms' turn or WT 12A. The reding frme shift leds to premture stop codon within exon 2 (shown below). til degrdtion of the tumor DNA smple. Cytogenetic nlysis of blood cells s well s direct nlysis of short-term cultures from lung metstsis, on the other hnd, reveled 46 XX, del llp13 kryotype. Thus, the microdeletion de- exon 9 C Q R K F ZF III tgtcgcggttc y tg WT2A * FIGURE 5. A stop codon is creted by c->t substitution in exon 9 of Wilms tumor WT 2A. SSCP nlysis (left) showed miniml ltertions in the mobility of the mplified exon strnds from the turn or (2A). Sequence nlysis unmbigu ously identified the introduction of stop codon in exon 9 of the tumor DNA. tected in exon 2 likely represents the second muttion inctivting the remining WT 1 llele in precursor cell. DNA from tumor 2A showed minor ltertions upon SSCP nlysis of exon 9 (Fig. 5). Direct sequencing of the PCR product reveled C to T muttion in cod on 390 of exon 9 resulting in trnsltion stop codon. Agin, gene dosge nlysis in tumor DNA did not yield unmbiguous results due to prtil DNA degrdtion. The clinicl description of the ptient with niridi nd genitourinry nomlies, however, suggests the presence of constitutionl W AGR deletion including both the WT 1 nd AN2 genes. The point muttion in exon 9 would be expected to be the second ltertion tht brogtes WT 1 function in tumor cells. Another muttion in exon 2 ws detected in DNA from Wilms' tumor BTl (Fig. 6). In this cse C ~ T muttion on one of the WT 1 lleles leds to chnge from Pro to Ser in the mino-terminl hlf of the protein. This mino cid replcement my represent dignostic missense muttion of functionlly importnt mino cid residue of the WT 1 polypeptide. As there re no distinct properties ssigned to specific regions of the minoterminl prt of the WT 1 protein it is difficult to test whether some WT 1 functions might be ffected by such muttion bsed solely on sequence informtion. There were dditionl cses where single bsepir chnges in introns were detected by SSCP

8 exon 2 BT1 N N WT BT GATe. E D P M G... gggteeetggge.... tee S FIGURE 6. Hemizygous point muttion in exon 2 of Wilms' tumor BTl. One dditionl bnd of fster mobility cn be observed upon SSCP nlysis in BT! DNA. Sequence nlysis of the nomlous migrting bnd isolted from the SSCP gel reveled c--'>t muttion, resulting in proline to serine chnge. nlysis of tumor DNA: Two of these ffect the region upstrem of exon 3 (Fig. 7). T umor S shows G~ T muttion t nucleotide - 20 (reltive to the splice site). In tumor MRl there is single bse insertion (+ A t - 58, dt not shown). In both cses the significnce of the muttions is uncler. The muttions hve not been found in other tumor DNAs or control smples, but they my well represent rre polymorphic vrints. Sequence requirements for efficient splicing re still poorly defined on the other hnd nd it cnnot be ssessed whether these muttions my ffect correct ssembly of the WT 1 mrn A s there is no RNA vilble from these tumors. Studies on Loss of Heterozygosity It is still uncler whether muttions in WT 1 cn cooperte with ltertions t the other proposed Wilms' tumor genes to override growth control. For severl of the tumors tht were shown to contin WT 1 ltertions LO H studies with polymorphic mrkers for chromosome Ilp15 were performed (Tble 2). In ll informtive cses there ws no loss of lleles t chromosome llp15. Identicl WT I muttions on both chromosomes 11 in tumors PER nd S86-169, however, suggest tht loss of the norml llele hs occurred in these cses. DISCUSSION The detection of homozygous deletions, with some being nonoverlpping nd ffecting only the MUTATION OF THE WTl GENE IN WILMS' TUMORS 219 5' or 3 ' prt of the gene or internl exons hs firmly estblished WTl s the Ilp13 Wilms' tumor gene (Cll et I., 1990; Gessler et I., 1990; Huff et I., 1991 ; Ton et I., 1991). In prllel studies, however, incresing evidence hs been found suggesting the presence of severl dditionl genes tht my be involved in Wilms tumor development. A significnt frction of Wilms' tumors show loss of heterozygosity for chromosome IIp, but limited to the telomeri c bnd p15 where the WT2 locus hs been geneticlly mpped (Mnnens et I., 1988; Koufos et I., 1988; Reeve et I., 1989) nd for which functionl tumor suppression hs been demonstrted (Dowdy et l., 1991). Another locus tht my be involved in the genesis of these tumors hs been mpped by loss of heterozygos ity to chromosome 16q in s mny s 20% of tumors (Mw et I., 1992). Finlly, the loction for the predisposing gene in rre fmilil Wilms' tumors hs been excluded by genetic linkge from ny of these regions (Grundy et I., 1989; Huff et I., 1989, 1992). Only the Ilp13 Wilms' tumor gene, WTl, hs been cloned so fr nd is menble to muttion screening in tumor tissue. Here pnel of 77 Wilms' tumors ws nlyzed by gene dosge nd SSCP nlyses to detect most of the muttions tht my hve occurred t this locus. While gene dosge studies cn be very difficult in tumors showing DNA degrdtion, SSCP nlysis ppers to be the method of choice to nlyze lrge numbers of smples with high sensitivity nd the potentil to detect even single bsepir chnges. SSCP nlysis is postulted to detect round % of ll possible single bse muttions (Sheffield, 1993). Nevertheless, it must be kept in mind tht using only this technique one will inevitbly overlook some of the ltertions present. Exmples of cses tht my well go undetected during SSC P screening re represented by the muttions in exon 9 of tumor WT2A nd especilly in exon 8 of tumor S By scoring the min mplifiction products-s done usully- this exon would hve been clssified s unltered. Only fint dditionl bnds tht could be derived from rre internl priming events or represent shorter nd incomplete products whose conformtion is more sensitive to ltertions identified the muttion in this cse. The results from this study suggest n unexpectedly low frequency of muttions t WT 1 in Wilms' tumors. In 85% of tumors no evidence for ltertions of WT 1 ws found with ny of the methods employed. Tking in ccount tht smll region of

9 220 GESSLER ET AL. WT MR1 Y S * * 5 kb 500 bp I I I 11 I I I I S87-877))\ST1 \ WT 2A S S87-51 zinc fingers ~WT12A mrna FIGURE 7. Locliztion of muttions within the WTl gene. The exon-intron orgniztion of the WTl gene is shown (dpted from Gessler et I., 1992). Muttions within the coding sequence re shown below the cdna. The thin line represents noncoding sequence of the cdna. The two muttions upstrem of exon 3 re indicted bove the genomic sequence. the 5' end of the WTl gene including the promotor nd the 1.3 kbp 3' untrnslted region hve not been screened for subtle muttions it seems likely tht the overll muttion frequency t WT 1 is below 20%. Lrge deletions of 11p13 nd djcent chromosoml regions, tht should lso be cytogeneticlly visible, re present in bout 10% of tumors. These deletions re reminiscent of the typicl W AGR deletions nd three of the ptients either hve these deletions in constitutionl DNA or present clinicl fetures tht mke n Ilp13 deletion very likely. These deletions, however, ffect only one of the chromosomes 11 or if present on both, the region of overlp seems to be limited to much smller re of few hundred kbp, s seen in WT8A nd PER. The low frequency of these deletions is in greement with the pucity of chromosome 11 p 13 deletions found in tumor kryogrms (Dougls et I., 1985; Slter et I., 1992). Also in greement with this is the low overll incidence of smller rerrngements tht cn be detected in tumor DNA upon Southern blot nlysis with WTI probes (Royer-Pokor et l., 1991; Cowell et l., 1991). The second type of muttions in Wilms' tumor DNA-besides lrge deletions tht likely remove severl genes-re subtle ltertions tht directly inctivte the WT 1 gene. Of the totl of six cses with lrger, hemizygous deletions the second WT 1 llele suffered point muttions or smll deletions in five of them. These muttions introduce premture stop codons, either directly or through reding frme shifts, or chnge key mino cid in the protein product. These ltertions would be expected to led to either complete WT 1 loss or to the trnsltion of truncted nd nonfunctionl protein. Unlike the sitution with p53 in different tumor types where number of dignostic missense muttions cn be found, there re few ltertions of this type in Wilms' tumors. Most of the WT 1 muttions pper to ffect the zinc finger domin s in tumor S87-52, where the replcement of the key mino cid histidine by tyrosine should destroy the importnt DNA binding domin. Similr muttions ltering key mino cids in Wilms' tumors nd the Denys-Drsh syndrome hve been described by others (Little et!., 1992; Pelletier et l., 1991). There is only one muttion outside the finger region in exon 2 of tumor BTl where the hemizygous replcement of proline by serine my ffect the proline-rich puttive trnscting domin of the WT 1 protein. To dte functionl domins of WT 1 outside the zinc finger region hve not been chrcterized enough to evlute the significnce of this muttion. It will be interesting, however, to test whether the BT1 muttion represents dominnt "gin of function" muttion tht interferes with the trnscriptionl repression properties of WTI (Mdden et l., 1991). The detection of severl dditionl loci tht my be involved in Wilms' tumor formtion rises the question whether these genes my cooperte in

10 MUTATION OF THE WTl GENE IN WILMS' TUMORS 221 some wy. Henry et l. (1989) described WAGR ptient with constitutionl deletion of 11p13 where studies on loss of heterozygosity reveled llele loss on chromosome 11, but limited to llp15. Although the sttus of the remining WT1 llele hs not been reported, this finding suggested tht there my be some interction between the 11 p 13 nd llp15 loci. Surprisingly, none of the six tumors in our series with WT 1 ltertions tht were lso informtive for 11p15 mrkers showed llele loss. This does not, however, rule out other ltertions of the presumed WT2 gene tht my result in coopertive effect on cell growth. One of the Wilms' tumor DNA smples in the present study ws derived from fmilil Wilms' tumor (ptient IV-14 in Grundy et l., 1988). Both gene dosge nd SSCP nlyses did not revel ny WTl ltertions (dt not shown). This is in greement with the report of Schwrtz et l. (1991) who found no cosegregtion between fmilil predisposition to Wilms' tumors nd the WTI gene. The ssys for WT 1 integrity we hve used here will certinly not revel ll possible cses of WTI inctivtion. Studies of protein expression nd functionl tests of the DNA binding cpcity of the WT 1 protein in tumor extrcts my complement the present pproches. Our nlysis, however, reveled n unexpectedly low frequency of homozygous inctivtion of the WT 1 gene. Thus, the high frequency of llele loss reported for chromosome 11 p my reflect ltertions of the WT2 gene in 11p15. The test of this notion wits the cloning nd nlysis of these other WT loci. ACKNOWLEDGMENTS We thnk Drs. B. Lmpkin (Children's Hospitl Medicl Center, Cincinnti, Ohio), M.F. Chen (Montrel Children's Hospitl), M.G. Levien (The C levelnd C linic Foundtion), C. Eschenbch (Medizinisches Zentrum fur Kinderheilkunde, Mrburg), nd ]. Ruschoff (Medizinisches Zentrum fur Pthologie, Mrburg) for providing clinicl informtion, tumor tissue, nd DNA smples. S.O. is n Investigtor, Howrd Hughes Medicl Institute, C hildren's Hospitl, Boston, MA. This work ws supported by the Deutsche Forschungsgemeinschft (Ge539/3-2) nd the NIH (HGOOI86). REFERENCES Bird PN, Groves N, Hber DA, Housmn DE, Cowell JK (1992) Identifiction of muttions in the WTI gene in tumours from ptients with the WAGR syndrome. Oncogene 7: Beckwith JB, Kivit NB, Bondio JF (1990) Nephrogenic rests, nephroblstomtosis, nd the pthogenesis of Wilms' tumor. Peditr Pthol 10: Brown KW, Wtson JE, Poirier V, Mott MG, Berry PJ, Mitlnd NJ (1992) Inctivtion of the remining llele of the WTI gene in Wilms' tumour from W AGR ptient. Oncogene 7: Cll KM, Glser T, Ito CY, Buckler AJ, Pelletier J, Hbe r DA, Rose EA, Krl A, Yeger H, Lewis WH, et!. (1990) Isoltion nd chrcteriztion of zinc finger polypeptide gene t the humn chromosome II Wilms' tumor locus. Cell 60: C ho LY, Huff V, Tomlinson G, Riccrdi VM, Strong LC, Sunders GF (1993) Genetic mosicism in norml tissues of Wi lms' tumour ptients. Nture Genet 3: Coppes MJ, Liefers GJ, Pul P, Yeger H, Willims BRG (1993) Homozygous somtic WTI point muttions in spordic uni lterl Wilms tumor. Proc Ntl Acd Sci USA 90: Cowell JK, Wdey RB, Hber DA, Cll KM, Housmn DE, Pritchrd J (1991) Structurl rerrngements of the WT I gene in Wilms' tumour ce lls. Oncogene 6: Dougls EC, Wilims JA, Green AA, Look AT (1985) Abnormli ties of chromosomes 1 nd 1I in Wilms' tumors. Cncer Genet Cytogenet 14: Dowdy SF, Fsching CL, Arujo D, Li KM, Livnos E, Weissmn BE, Stnbridge EJ (1991) Suppression of tumorigenicity in Wilms tumor by the pi5.5-pi4 region of chromosome 11. Science 254: Frncke U, Holmes LB, Atkins L, Riccrdi VM (1979) Aniridi Wilms tumor ssocition: Evidence for specific deletion of Ilp13. Cytogenet Cell Genet 24: Gessler M, Bruns GA (1989) A physicl mp round the W AGR complex on the short rm of chromosome 11. Genomics 5: Gessler M, Konig A, Bruns GA ( 1992) The genomic orgniztion nd expression of the WTI gene. Genomics 12: Gessler M, K6nig A, Moore J, Qulmn S, Arden K, Cvenee W, Bruns G (1993) Homozygous inctivtion of WT I in Wilms' tumor ssocited with the WAGR syndrome. Genes C hromosomes Cncer 7: Gessler M, Poustk A, Cvenee W, Neve RL, Orkin SH, Bruns GA (1990) Homozygous deletion in Wilms tumours of zincfinge r gene identified by chromosome jumping. Nture (London) 343: Gessler M, Thoms GH, Couillin P, Junien C, McGillivry BC, Hyden M, Jschek G, Bruns GA (1989) A deletion mp of the WAGR region on chromosome I I. Am J Hum Genet 44: GrovesN, Bird PN, Hogg A, CowellJK (1992) A single bse pir polymorphism in the WTI gene detected by single-strnd conformtion polymorphism nlysis. Hum Genet 90: Grundy P, Koufos A, Morgn K, Li FP, Medows AT, Cvenee WK (1988) Fmilil predisposition to Wilms' tumour does not mp to the short rm of chromosome 11. Nture (London) 366: Hber DA, Buckler AJ, Glser T, Cll KM, Pelletier J, Sohn RL, Douglss EC, Housmn DE (1990) An internl de letion within n I Ip13 zinc finger gene contributes to the development of Wilms' tumor. Cell 6l:l Henry I, Grndjoun S, Couillin P, Brichrd F, Huerre-Jenpierre C, Philip T, Lenoir G, C hussin JL, Junien C (1989) Tumorspecific loss of Ilp15.5 lleles in del Ilp13 Wi lms' tumor nd in fmilil drenocorticl crcinom. Proc Ntl Acd Sci USA 86: Huff V, Compton DA, Cho L-Y, Strong LC, Geiser CF, Sunders GF (1988) Lck of linkge of fmilil Wilms' tumor to duomosoml bnd Ilp13. Nture (London) 336:

11 222 GESSLER ET AL. Huff V, Miw H, Hber DA, Cll KM, Housmn D, Strong LC, Sunde rs G F (1991) Evidence for WTl s Wilms tumor (WT) ge ne: Intrgenic germinl deletion in bilterl WT. Am J Hum Genet 48: Huff V, Reeve AE, Leppert M, Strong LC, Douglss EC, Geiser C F, Li FP, Medows A, Cllen DF, Lenoir G, Sunders GF (1 992 ) Nonlinkge of 16q mrkers to fmilil predisposition to Wilms' tumor. Cncer Res 52: Knudson AG, Strong LC (1 972) Muttion nd cncer: A model for Wilms' tumor of the kidney. J Ntl Cncer Inst 48: Koufos A, G rundy P, Morgn K, Aleck KA, Hdro T, Lmpkin BC, Klbkji A, Cvenee WK (1 989) Fmilil Wiedemnn Beckwith syndrome nd second Wilms tumor locus both mp to IlpI 5.5. Am J Hum Genet 44: Little MH, Prosser J, Condie A, Smith PJ, Vn-Heyningen V, Hstie ND (1 992 ) Zinc finger point muttions within the WTl gene in Wilms tumor ptients. Proc Ntl Acd Sci USA 89: Mdden SL, Cook DM, Morris JF, Gshler A, Sukhtme VP, Ruscher FJ, III (1 991) Trnscriptionl repress ion medited by the WTl Wilms tumor ge ne product. Science 253: Mnnens M, Slter RM, Heyting C, Bliek J, de Krker J, Cod N, de Pgter-Holthuizen P, Person PL (1988) Moleculr nture of genetic chnges resulting in loss of heterozygosity of chromosome 11 in Wilms' tumors. Hum Genet 8 1 : Mw MA, G rundy PE, Millow LJ, Eccles MR, Dunn RS, Smith PJ, Feinberg AP, Lw DJ, Pterson MC, Telzerow PE, et l. (1 992 ) A third Wilms' tumor locus on chromosome 16q. Cncer Res 52: O rit M, Suzuki Y, Sekiy T, Hyshi K (1989) Rpid nd sensi tive detection of point muttions nd DNA polymorph isms using the polymerse chin rection. G enomics 5: Pelletier J, Bruening W, Kshtn C E, Muer SM, Mnivel JC, Striegel JE, Houghton DC, Junien C, Hbib R, Fouser L, et l. (l99 1) Germline muttions in the Wilms' tumor suppressor gene re ssocited with bnorml urogenitl development in Denys-Drsh syndrome. Cell 67: Pelletier J, Bruening W, Li FP, Hber DA, Glser T, Housmn DE ( b) WT 1 muttions contribute to bnorml genitl system development nd hereditry Wilms' tumor. Nture (London) 353: Ping AJ, Reeve A, Lw DJ, Young MR, Boehnke M, Feinberg AP (1989) Genetic linkge of Beckwith-Wiedemnn syndrome to 11p1 5. Am J Hum Genet 44: Polymeropoulos MH, Xio H, Rth DS, Merril C R (1 99 1) Tetrnucleotide polymorphism t the humn tyrosine hydroxylse gene (TH). Nucl Acids Res 19: Reeve AE, Sih SA, Rizis AM, Feinberg AP (1 989) Loss of llelic heterozygosity t second locus on chromosome 11 in spordic Wilms' tumor cells. Mol Cellulr Bioi 9: Royer-Pokor B, Rgg S, Heckl -Ostreicher B, Held M, Loos U, Cll K, G lser T, Housmn D, Sunders G, Zbel B, et l. (1991) Direct pulsed field gel electrophoresis of Wilms' tumors shows tht DNA deletions in 11 p 13 re rre. Genes Chromosomes Cncer 3: Smbrook J, Fritsch EF, Mnitis T (1 989) Moleculr C loning: A Lbortory Hndbook. Cold Spring, NY: Cold Spring Hrbor Lbortory Press. Schroeder WT, C ho L-Y, Do DD, Strong LC, Pthk S, Riccrdi V, Lewis WH, Sunders G F (1 987) Nonrndom loss of mternl chromosome 11 lleles in Wilms tumors. Am J Hum Genet 40: Schwrtz CE, Hber DA, Stnton VA, Strong LC, Skolnick MH, Housmn DE (1 99 1) Fmilil predisposition to Wilms' tumor does not segerg te with the WTl gene. Genomics 10: Sheffield VC, Beck JS, Kwitek AE, Sndstrom DW, Stone EM (1993) The sensitivity of single-strnded conformtion polymorphism nlysis for the detection of single bse substitutions. Genomics 16: Slter RM, Mnnens MM (1 992 ) C ytogenetics nd moleculr genetics of Wilms' tumor of childhood. Cncer Genet Cytogenet 61: Tnci P, Genurd i M, Sntini SA, Neri G (1 992 ) PC R detection of n insertion/deletion polymorphism in intron 1 of the HRAS l locus. N ucl Acids Res 20: Ton CC, Huff V, Cll KM, Cohn S, Strong LC, Housmn DE, Sunders GF (1 99 1) Smllest region of overlp in Wilms tumor deletions uniquely implictes n 11 p13 zinc fin ger gene s the disese locus. Genomics 10: Wdey RB, Pl N, Buckel B, Yeomns E, Pritchrd J, Cowell JK (1990) Loss of heterozygosity in Wilms' tumour in vo lves two distinct regions of chromosome 11. O ncogene 5: