Supplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in

Size: px

Start display at page:

Download "Supplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in"

Jasmin Grant
5 years ago
Views:

1 Supplementary Data Saline Vehicle Control P7 Low Dose P7 High Dose P13 High Dose HGB(g/L) HCT(%) MCV(fL) MCHC(g/L) PLT( 10 9 /L) Neut(%) Lymph(%) Parameters SUPPLEMENTARY FIG. S1. Effect of human mesenchymal stem cells on routine hematological parameters in cynomolgus monkeys. HGB, hemoglobin; HCT, hematocrit; MCV, mean corpusular volume; MCHC, mean corpusular hemoglobin concentration; PLT, platelet; Neut, neutrophilicgranulocyte; Lymph, lymphocyte Control Saline Vehicle Control P7 Low Dose P7 High Dose P13 High Dose ALT(U/L) AST(U/L) TP(g/L) ALB(g/L) A/G TBiL(µmol/L) ALP(U/L) GGT(U/L) CK(U/L) SUPPLEMENTARY FIG. S2. Cynomolgus monkeys (1). Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in

200 180 160 140 Control Saline Vehicle Control P7 Low Dose P7 High Dose P13 High Dose 120 100 60 40 20 * * 4 2 0 GLU(mmol/L) BUN(mmol/L) CREA(µmol/L) CHOL(mmol/L) TG(mmol/L) Ca(mmol/L) Na(mmol/L)

2 Control Saline Vehicle Control P7 Low Dose P7 High Dose P13 High Dose * * GLU(mmol/L) BUN(mmol/L) CREA(µmol/L) CHOL(mmol/L) TG(mmol/L) Ca(mmol/L) Na(mmol/L) K(mmol/L) Cl(mmol/L) SUPPLEMENTARY FIG. S3. Cynomolgus monkeys (2). Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in Amount (Cells/ml) Amount (Cells/ml) Time (hour) SUPPLEMENTARY FIG. S4. Concentration-time curve of human mesenchymal stem cells in Cynomolgus monkeys in the group. UC-MSC, umbilical cord mesenchymal stem cell Time (hour) SUPPLEMENTARY FIG. S5. Concentration-time curve of human mesenchymal stem cells in Cynomolgus monkeys in the P13 High dose group. SUPPLEMENTARY FIG. S6. Induced differentiation of h. (A) Osteogenic induction was confirmed by Von Kossa staining (40 ) (B) Adipocytes were stained by Oil Red O (200 ).

3 SUPPLEMENTARY FIG. S7. Surface molecules analysis of h.

4 Supplementary Table S1. Effect of Human Mesenchymal Stem Cells on Body Weight (kg) Before treatment week after the first treatment weeks after the first treatment weeks after the first treatment weeks after the first treatment weeks after the first treatment weeks after the first treatment week after the last treatment weeks after the last treatment weeks after the last treatment weeks after the last treatment weeks after the last treatment weeks after the last treatment UC-MSC, umbilical cord mesenchymal stem cell. Supplementary Table S2. Effect of Human Mesenchymal Stem Cells on Body Temperature 3 days before the first treatment After the first treatment After the last treatment The end of the recovery period Body temperature of all monkeys was rectally determined at the same time of the day. Supplementary Table S3. Effect of Human Mesenchymal Stem Cells on Heart Rate (Beats/min) Prior to treatment After the first treatment After the last treatment End of the recovery period Supplementary Table S4. Effect of Human Mesenchymal Stem Cells on PR Interval (s) Prior to treatment After the first treatment After the last treatment End of the recovery period PR, the interval from the beginning of the P wave to the beginning of the QRS complex in a electrocardiogram (ECG).

5 Supplementary Table S5. Effect of Human Mesenchymal Stem Cells on QRS-Complex (s) Prior to treatment After the first treatment After the last treatment End of the recovery period QRS, the combination of Q wave, R wave and S wave in a ECG. Supplementary Table S6. Effect of Human Mesenchymal Stem Cells on QT Interval (s) Prior to treatment After the first treatment After the last treatment End of the recovery period QT, the interval from the beginning of the QRS complex to the end of the T wave in a ECG. Supplementary Table S7. Effect of Repeat Administration of Human Mesenchymal Stem Cells on Coagulation Group Prior to treatment After the second treatment After the last treatment End of the recovery period PT (S) APTT (S) PT, prothrombin time; APTT, activated partial thromboplastin time. Supplementary Table S8. Concentration of Human Mesenchymal Stem Cells in Mesnechymal Stem Cells P7 Low Dose Group at Different Time Point (Cells/mL) Animal no. Time (h) E E E E E E E E E E E E E E E E E E ND ND ND ND ND ND

6 Supplementary Table S9. Concentration of Human Mesenchymal Stem Cells in Mesnechymal Stem Cells P7 High Dose Group at Different Time Point (Cells/mL) Animal no. Time (h) E E E E E E E E E E E E E E E E E E E E E E E E ND 7.61E + 03 ND ND ND ND ND ND 8 ND ND ND ND ND ND ND ND Supplementary Table S10. Concentration of Human Mesenchymal Stem Cells in Mesnechymal Stem Cells P13 High Dose Group at Different Time Point (Cells/mL) Animal no. Time (h) E E E E E E E E E E E E E E E E E E E E + 04 ND ND ND ND 8 ND ND ND ND ND ND Supplementary Table S11. Concentration of Human Mesenchymal Stem Cells in Cynomolgus Monkeys at Different Time Point (Cells/mL) Time (h) Group Dose (cell/kg) Index (cell/ml) P7 Mean 2.38E E E + 03 ND ND SD 1.16E E E + 03 ND ND CV(%) ND ND P7 Mean 2.43E E E E + 03 ND SD 1.00E E E + 04 ND ND CV(%) ND ND P13 Mean 1.01E E E E + 04 ND SD 4.55E E E E + 03 ND CV(%) ND CV, coefficient of variation; Supplementary Table S12. Distribution of Human Mesenchymal Stem Cells in the Tissues of Cynomolgus Monkeys Group Animal no. Tissue Concentration (cells/g of tissue) Heart 9.06E Brain 1.31E Liver 2.30E Heart 4.22E Lung 2.68E Quadriceps 1.02E Bone marrow 1.58E + 04

7 Supplementary Table S13. Effect of Human Mesenchymal Stem Cells on Anatomic Pathology in Cynomolgus Monkeys Group Animal Number Time of Euthanasia Ovarian Cyst Mononuclear Infiltration in Myocardium Mononuclear Infiltration in Kidney Fresh Hemorrhage in Lung Mononuclear Infiltration in Liver Thymic Cyst Focal Hemorrhage in Brain Focal Hemorrhage in Spinal Cord Blood Vessel Damage in Infusion Site Perivascular Hemorrhage and Inflammatory Cells Infiltration in Infusion Site Control Saline Vehicle Control Mesenchymal stem cells P7 low dose Mesenchymal stem cells P7 high dose Mesenchymal stem cells P13 high dose T T T NA T NA R R NA T T T NA T NA P R R NA T T P T NA T NA R R NA T T T NA T NA R1 P R1 NA R P R NA T a T T NA T NA R P R NA T indicated that the monkeys were euthanized after the last administration; R indicated that the monkeys were euthanized 6 weeks after the last administration; R1 indicated that the monkeys were euthanized 2 weeks after the last administration; pathologic changes were shown by +, ++, +++, ++++ from mild to severe; - indicates there was no pathologic change; P indicated grade classification is not available for the pathologic change; NA indicated the absence of the tissue on the animal (eg, Ovarian for male monkey). a Obsolete hemorrhages.

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC