Supplementary Information

Size: px
Start display at page:

Download "Supplementary Information"

Transcription

1 1 Supplementary Information Human TSC2 Null Fibroblast-Like Cells Induce Hair Follicle Neogenesis and Hamartoma Morphogenesis Shaowei Li 1, Rajesh L. Thangapazham 1, Ji-an Wang 1, Sangeetha Rajesh 1, Tzu-Cheg Kao 2, Leonard Sperling 1, Joel Moss 3, & Thomas N. Darling 1 1 Department of Dermatology, Uniformed Services University of the Health Sciences, Bethesda, MD 20814, USA 2 Preventive Medicine and Biometrics, Uniformed Services University of the Health Sciences, Bethesda, MD 20814, USA and the 3 Cardiovascular and Pulmonary Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892, USA

2 2 Supplementary Figures Supplementary Figure S1. Xenograft model for TSC skin hamartomas. Fibroblast-like cells from a skin hamartoma and neonatal foreskin keratinocytes are incorporated into a dermal-epidermal composite that is grafted onto the back of a nude mouse. The schematic shows hair follicle microanatomy that develops in grafts constructed with TSC2-null fibroblast-like cells. Hamartomatous features of tumour grafts are not shown, including increased angiogenesis and mononuclear phagocytes.

3 Supplementary Figure S2. Characterization of hair follicles in grafts with TSC2-null cells from an angiofibroma. TSC2-null fibroblast-like cells from an angiofibroma and neonatal foreskin keratinocytes were incorporated into dermalepidermal composites and grafted onto mice. (a) Cells in the dermis, epidermis, and hair follicles are reactive with a pan-human HLA class I monoclonal antibody. Scale bar, 65 µm. (b) Frozen sections of grafts were hybridized with a fluorescent probe of human Y chromosome. Red signals are observed in the nuclei of epidermal and follicular epithelial cells, but no signals are observed in dermal fibroblast-like cells from a female patient. Scale bar, 65 µm. 3

4 Supplementary Figure S3. Histological and immunohistological differences between TSC fibrous plaques and normal-appearing skin. (a) H & E stained section of TSC normal skin. (b) H & E stained section of fibrous forehead plaque. (c) In TSC normal skin, immunoreactivity for ps6 is faint and located mostly in the upper layers of the epidermis. (d) In fibrous plaques, immunoreactivity for ps6 is located in dermal fibroblast-like cells and the overlying epidermis. (e) In TSC normal skin, scattered cells in the basal layer of the epidermis are immunoreactive with Ki-67. (f) In fibrous plaques, the cells immunoreactive with Ki-67 are almost confluent in the basal layer of the epidermis. (g) In TSC normal skin, scattered cells in the dermis are immunoreactive with anti-cd68 antibodies, a marker of mononuclear phagocytes. (h) In fibrous plaques, immunoreactive cells are frequent in the dermis. (i) In TSC normal skin, CD-31 positive vessels are typically small in size and few in number. (j) In fibrous plaques, CD-31 positive vessels are prominent in number and size. The chromagen used for immunohistochemical studies was Vector Red, except Ki-67 staining, which used DAB (brown). Scale bar, 35 µm. Similar results were obtained using fibrous plaques from 4 patients. 4

5 Supplementary Figure S4. Presence of human cells in xenografts following 12 weeks treatment with rapamycin. (a) HLA immunostaining of xenografts containing fibroblasts or TSC2-null cells from patient 4 demonstrates human cells in epidermis and dermis of xenografts. NV, TSC normal fibroblasts with vehicle treatment; NR, TSC normal fibroblasts with rapamycin treatment; TV, TSC2-null cells with vehicle treatment; TR, TSC2-null cells with rapamycin treatment. Scale bar, 35 µm. (b) HLA positivity was quantified as fluorescence intensity in the dermis relative to the dermal area. Numbers of mice were 13 for NV, 14 for NR, 12 for TV, and 15 for TR. Results are mean ± SE. **p<

6 6 Supplementary Table Supplementary Table S1. Dermal Papilla Genes (DPG) overexpressed by fibroblast-like cells from angiofibromas at levels twofold or more those in fibroblasts from patients normal-appearing skin. DPG1 # DPG2 ## DPG1&2 ### CD302 TCEAL1 ABCA1 GALNT7 RPS6KA5 ASPH CDH11 TMEM100 ACTG2 GNAQ RUNX1 CRABP2 DPYD TMEM2 ACTN1 GNL2 RUNX2 CTBP2 DRAM1 TRPS1 ANKRD28 HCK RUNX3 FGFR1 FGFR2 TWIST1 APPL2 HDAC6 SLC1A1 GFRA1 FST VCAM1 ARID4B HSD17B7 SLC5A3 IGFBP3 GRB14 B3GNT2 IGFBP4 SLC6A6 LTBP1 LEPR B4GALT6 JAG1 SMS NDP LPAR1 BNIP2 JAK2 SOX11 PDGFRA MAGED2 C5ORF30 KAZ SPSB1 PRSS12 MDK C7ORF23 KIF5A TENC1 RGNEF MYST4 CAMK2N1 KLHDC2 TMOD3 SHOX2 NAGA CDC14B NID2 TNN SLC16A2 PAPPA CLCF1 NPTX2 TRIM24 TGFBR1 PBX1 COL8A2 NTRK3 UBE2M WNT5A PTGER3 CRYBG3 OMD VEGFA PTGFR DAAM2 PER2 ZBTB11 RAB40B DMXL2 PHF3 ZMYM5 RSRC1 EIF2C1 PLAG1 ZSCAN18 SERPINF1 ELAVL1 PPM1A SH2B2 EPHB6 PRKAR1B SH3BP5 ETNK1 PRRX1 SPOCK1 ETS1 QKI SSBP2 FAM49B RC3H2 STEAP1 FLRT2 RIOK2 # Genes overexpressed by angiofibroma cells that are common with DPGs from Rendl et al ## Genes overexpressed by angiofibroma cells that are common with DPGs from Driskell et al ### Genes overexpressed by angiofibroma cells that are common with DPGs from both Rendl et al and Driskell et al Genes are listed alphabetically. Bold font indicates p <0.05 for two tailed t-test comparing expression in angiofibroma cells to paired patient fibroblasts.

Supplementary Information

Supplementary Information Supplementary Information Figure S1: Follicular melanocytes in the wound peripheral area migrate to the epidermis in response to wounding stimuli. Dorsal skin of Trp2-LacZ mice stained with X-gal and analyzed

More information

Nipple angiofibromas with loss of TSC2 are associated with tuberous sclerosis complex

Nipple angiofibromas with loss of TSC2 are associated with tuberous sclerosis complex Nipple angiofibromas with loss of TSC2 are associated with tuberous sclerosis complex The Harvard community has made this article openly available. Please share how this access benefits you. Your story

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

B16F1 B16F10 Supplemental Figure S1

B16F1 B16F10 Supplemental Figure S1 B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood

More information

Supplement Results, Figures and Tables

Supplement Results, Figures and Tables Supplement Results, Figures and Tables Results PET imaging The SUV was significantly higher in tumours of the parental HSC-3 cell line than tumours of the EV and the MMP-8 overexpressing cell lines (Figure

More information

4 Skin and Body Membranes Study Guide

4 Skin and Body Membranes Study Guide Name: SKIN AND BODY MEMBRANES: 4 Skin and Body Membranes Study Guide Period: Body membranes, which cover body surfaces, line its cavities, and form protective sheets around organs, fall into two major

More information

Lab 7: Integumentary System Hamilton ANSWERS TO PRE- LAB ASSIGNMENTS

Lab 7: Integumentary System Hamilton ANSWERS TO PRE- LAB ASSIGNMENTS Lab 7: Integumentary System Hamilton ANSWERS TO PRE- LAB ASSIGNMENTS Pre-Lab Activity 1: 1. a. epidermis b. dermis c. hypodermis d. adipose tissue e. hair f. sebaceous gland g. sweat gland 2. a Pre-Lab

More information

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative

More information

Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each

Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm

More information

Supplemental Material

Supplemental Material Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

The Utility Of Congo Red Stain And Cytokeratin Immunostain In The Detection Of Primary Cutaneous Amyloidosis

The Utility Of Congo Red Stain And Cytokeratin Immunostain In The Detection Of Primary Cutaneous Amyloidosis ISPUB.COM The Internet Journal of Pathology Volume 17 Number 1 The Utility Of Congo Red Stain And Cytokeratin Immunostain In The Detection Of Primary Cutaneous A,A Citation A, A.. The Internet Journal

More information

Experiment Note the locations of the epidermis, dermis, dermal papillae, and the sweat glands. Note that fat cells that comprise the

Experiment Note the locations of the epidermis, dermis, dermal papillae, and the sweat glands. Note that fat cells that comprise the Experiment 1 Examining Skin, Bones and Muscle Histology Experiment Inventory Skin Digital Slide Images Cortical (Compact) Bone Digital Slide Image Trabecular (Spongy) Bone Digital Slide Image Cardiac Muscle

More information

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation

More information

Effect of Propecia on the Hair Follicle in Male Androgenetic Alopecia: A Confocal Laser Scanning Microscopy and Video Imaging Study

Effect of Propecia on the Hair Follicle in Male Androgenetic Alopecia: A Confocal Laser Scanning Microscopy and Video Imaging Study Effect of Propecia on the Hair Follicle in Male Androgenetic Alopecia: A Confocal Laser Scanning Microscopy and Video Imaging Study Investigators: Department of Dermatology, University of Minnesota, Minneapolis,

More information

Supporting Information

Supporting Information Supporting Information CD200 Expressing Human Basal Cell Carcinoma Cells Initiate Tumor Growth Chantal S Colmont 1, Antisar BenKetah 1, Simon H Reed 2, Nga Voong 3, William Telford 3, Manabu Ohyama 4,

More information

Supporting Information

Supporting Information Supporting Information Plikus et al. 10.1073/pnas.1215935110 SI Text Movies S1, S2, S3, and S4 are time-lapse recordings from individually cultured Period2 Luc vibrissa follicles show that circadian cycles

More information

Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)

Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.

More information

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

Histopathology: skin pathology

Histopathology: skin pathology Histopathology: skin pathology These presentations are to help you identify, and to test yourself on identifying, basic histopathological features. They do not contain the additional factual information

More information

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast

More information

BSD 2015 Case 19. Female 21. Nodule on forehead. The best diagnosis is:

BSD 2015 Case 19. Female 21. Nodule on forehead. The best diagnosis is: BSD 2015 Case 19 Female 21. Nodule on forehead. The best diagnosis is: A. mixed tumour of skin B. porocarcinoma C. nodular hidradenoma D. metastatic adenocarcinoma BSD 2015 Case 19 Female 21 Nodule on

More information

Supplementary Figures for

Supplementary Figures for mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,

More information

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

More information

Malignant tumors of melanocytes: Part 1. Deba P Sarma, MD., Omaha

Malignant tumors of melanocytes: Part 1. Deba P Sarma, MD., Omaha Malignant tumors of melanocytes: Part 1 Deba P Sarma, MD., Omaha The melanocytic tumor is one of the most difficult and confusing areas in Dematopathology. It is true that most (95%) of such lesions are

More information

The Beauty of the Skin

The Beauty of the Skin The Beauty of the Skin Rose-Anne Romano, Ph.D Assistant Professor Department of Oral Biology School of Dental Medicine State University of New York at Buffalo The Big Question How do approximately 50 trillion

More information

Skin (Integumentary System) Wheater, Chap. 9

Skin (Integumentary System) Wheater, Chap. 9 Skin (Integumentary System) Wheater, Chap. 9 Skin (Integument) Consists of skin and associated derivatives Largest organ of body (21 ft 2 ; 9 lbs.; has 11 miles of blood vessels) Functions: Protection

More information

1. Introduction (Open your text to the image of a cross section of skin) i. Organ of the Integument. Connective Tissues. Epithelial Tissues

1. Introduction (Open your text to the image of a cross section of skin) i. Organ of the Integument. Connective Tissues. Epithelial Tissues Integumentary System 1. Introduction (Open your text to the image of a cross section of skin) A. Integumentary System i. Organ of the Integument a. Tissues Connective Tissues * Tissue / Location Relationships

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration

More information

Accepted Manuscript. Stephanie Kao, BA, Alexi Kiss, MD, Tatiana Efimova, PhD, Adam Friedman, MD

Accepted Manuscript. Stephanie Kao, BA, Alexi Kiss, MD, Tatiana Efimova, PhD, Adam Friedman, MD Accepted Manuscript An ex-vivo evaluation of cytotoxicity and melanocyte viability after A-101 hydrogen peroxide topical solution 40% or cryosurgery treatment in Seborrheic Keratosis lesions Stephanie

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces

More information

Lymphoma and Pseudolymphoma

Lymphoma and Pseudolymphoma Lymphoma and Pseudolymphoma Laura B. Pincus, MD Co-Director, Cutaneous Lymphoma Clinic Associate Professor Dermatology and Pathology University of California, San Francisco I HAVE NO RELEVANT RELATIONSHIPS

More information

Basal cell carcinoma 5/28/2011

Basal cell carcinoma 5/28/2011 Goal of this Presentation A practical approach to the diagnosis of cutaneous carcinomas and their mimics Thaddeus Mully, MD University of California San Francisco To review common non-melanoma skin cancers

More information

Differential neuronal vulnerability identifies IGF-2 as a protective factor in

Differential neuronal vulnerability identifies IGF-2 as a protective factor in Supplementary Information Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS Ilary Allodi 1,3, Laura Comley 1,3, Susanne Nichterwitz 1,3, Monica Nizzardo 2, Chiara Simone

More information

Anatomy and Physiology I Student Outline The Integumentary System. Integumentary System. Page 1

Anatomy and Physiology I Student Outline The Integumentary System. Integumentary System. Page 1 Anatomy and Physiology I Student Outline The Integumentary System Integumentary System Page 1 Have a very clear understanding of the each particular tissue and their unique functions in each layer of the

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

More information

Chapter 6: Skin and the Integumentary System

Chapter 6: Skin and the Integumentary System Shier, Butler, and Lewis: Hole s Human Anatomy and Physiology, 10 th ed. Chapter 6: Skin and the Integumentary System Chapter 6: Skin and the Integumentary System I. Skin and Its Tissues A. Introduction

More information

Lions and Tigers and Bears.Oh My!

Lions and Tigers and Bears.Oh My! Lions and Tigers and Bears.Oh My! TAKING THE FEAR OUT OF GENETIC TESTING Lisa Butterfield, MS, CGC Genetic Counselor Clinical Assistant Professor University of Kansas Health System Why is Genetic Testing

More information

Chapter 6: Integumentary System

Chapter 6: Integumentary System Shier, Butler, and Lewis: Hole s Human Anatomy and Physiology, 12 th ed. Chapter 6: Skin and the Integumentary System Chapter 6: Integumentary System I. Introduction 1. The skin is composed of of tissues.

More information

Cytological and Histological Study of Adult and Neonate Epidermis in Thick and Thin Skin of Various Anatomical Sites

Cytological and Histological Study of Adult and Neonate Epidermis in Thick and Thin Skin of Various Anatomical Sites Available online on www.ijpqa.com International Journal of Pharmaceutical Quality Assurance 218; 9(2); 174-179 doi: 1.25258/ijpqa.v9i2.13642 ISSN 975 956 Research Article Cytological and Histological Study

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10860 Supplementary Discussion It remains unclear why H3K9 demethylation appeared to be more sensitive to suppression than at least some other histone methylation marks as a result of

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Introduction. Skin and Body Membranes. Cutaneous Membranes Skin 9/14/2017. Classification of Body Membranes. Classification of Body Membranes

Introduction. Skin and Body Membranes. Cutaneous Membranes Skin 9/14/2017. Classification of Body Membranes. Classification of Body Membranes Introduction Skin and Body Membranes Body membranes Cover surfaces Line body cavities Form protective and lubricating sheets around organs Classified in 5 categories Epithelial membranes 3 types- cutaneous,

More information

Supplementary Figure 1!

Supplementary Figure 1! a!!gt-cre x Twist LoxP/LoxP!!GT-Cre x Twist LoxP/LoxP! x RosaLSLEYFP!!GT-Cre x Snail LoxP/LoxP!!GT-Cre x Snail LoxP/LoxP! x RosaLSLEYFP! Supplementary Figure!!GT-Cre x Twist LoxP/LoxP! x RosaLSLEYFP x

More information

2/5/2019. Organ System: Skin or Integumentary System. Hypodermis (or superficial fascia) Integumentary System - Learn and Understand

2/5/2019. Organ System: Skin or Integumentary System. Hypodermis (or superficial fascia) Integumentary System - Learn and Understand Integumentary System - Learn and Understand Skin is an organ comprised of all four tissues Each layer of the skin contributes to one or more of its numerous functions Skin is both strong and flexible Keratinization

More information

ALL PHOTOS ARE IDENTIFIED IN THE LOWER RIGHT CORNER WITH THE MAGNIFICATION POWER THAT THE PHOTO WAS TAKEN WITH. SCAN - THIS IS A VERY LOW POWER IMAGE

ALL PHOTOS ARE IDENTIFIED IN THE LOWER RIGHT CORNER WITH THE MAGNIFICATION POWER THAT THE PHOTO WAS TAKEN WITH. SCAN - THIS IS A VERY LOW POWER IMAGE ALL PHOTOS ARE IDENTIFIED IN THE LOWER RIGHT CORNER WITH THE MAGNIFICATION POWER THAT THE PHOTO WAS TAKEN WITH. SCAN - THIS IS A VERY LOW POWER IMAGE THAT WE USE WHEN A SAMPLE IS SO BIG THAT YOU CAN T

More information

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

More information

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina

More information

Case Report Nevus Lipomatosus Superficialis with a Folliculosebaceous Component: Report of 2 Cases

Case Report Nevus Lipomatosus Superficialis with a Folliculosebaceous Component: Report of 2 Cases SAGE-Hindawi Access to Research Pathology Research International Volume 2011, Article ID 105973, 4 pages doi:10.4061/2011/105973 Case Report Nevus Lipomatosus Superficialis with a Folliculosebaceous Component:

More information

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate

More information

Unit 4 The Integumentary System

Unit 4 The Integumentary System Unit 4 The Integumentary System I. Classification of Body Membranes A. Epithelial Membranes (3) 1. Cutaneous Membrane > Stratified Squamous > Sits on Dense Connective Tissue > Skin: Epidermis & Dermis

More information

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB. Friday, February 13, :30 am 11:00 am

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB. Friday, February 13, :30 am 11:00 am MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB Friday, February 13, 2009 9:30 am 11:00 am FACULTY COPY GOALS: Describe the basic clinical and morphologic features of various

More information

BI 121 LAB. WEEK 2: Tissues (continued); Integumentary System

BI 121 LAB. WEEK 2: Tissues (continued); Integumentary System BI 121 LAB 2-1 WEEK 2: Tissues (continued); Integumentary System This week you will 1) Review the four major tissue types 2) Review the characteristics of epithelial tissues. 3) Learn the major characteristics

More information

Observations on the Pathology of Lesions Associated with Stephanofilaria dinniki Round, 1964 from the Black Rhinoceros (Diceros bicornis)

Observations on the Pathology of Lesions Associated with Stephanofilaria dinniki Round, 1964 from the Black Rhinoceros (Diceros bicornis) Journal of Helminthology, ~ol. XXXVIII, Nos. 1/2, 1964, pp. 171-174. Observations on the Pathology of Lesions Associated with Stephanofilaria dinniki Round, 1964 from the Black Rhinoceros (Diceros bicornis)

More information

Nature Neuroscience: doi: /nn.2275

Nature Neuroscience: doi: /nn.2275 Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

DEBRIDEMENT: ANATOMY and PHYSIOLOGY. Professor Donald G. MacLellan Executive Director Health Education & Management Innovations

DEBRIDEMENT: ANATOMY and PHYSIOLOGY. Professor Donald G. MacLellan Executive Director Health Education & Management Innovations DEBRIDEMENT: ANATOMY and PHYSIOLOGY Professor Donald G. MacLellan Executive Director Health Education & Management Innovations ANATOMY and PHYSIOLOGY Epidermal Layers ECM Structure Dermis Structure Skin

More information

The site of action of the ichthyosis locus (ic) in the mouse, as determined by dermal-epidermal recombinations

The site of action of the ichthyosis locus (ic) in the mouse, as determined by dermal-epidermal recombinations /. Embryol. exp. Morph. Vol. 32, 3, pp. 715-721, 1974 715 Printed in Great Britain The site of action of the ichthyosis locus (ic) in the mouse, as determined by dermal-epidermal recombinations BY MARGARET

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.

More information

Study the Effect of Illumination Time Parameter of Diode Laser on Wound Healing Process

Study the Effect of Illumination Time Parameter of Diode Laser on Wound Healing Process The 1 st Regional Conference of Eng. Sci. NUCEJ Spatial ISSUE vol.11, No.2, 2008 pp 536-543 Study the Effect of Illumination Time Parameter of Diode Laser on Wound Healing Process Assist. Prof. Dr. Munqith

More information

Deconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression

Deconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2017 Supplementary Information for: Deconvolution of Heterogeneous Wound Tissue Samples into

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

VivoSight Imaging for Dermatologists

VivoSight Imaging for Dermatologists VivoSight Imaging for Dermatologists VivoSight: The new real time imaging tool VivoSight Image of Skin Stratum corneum 160 µm Stratum granulosum Stratum spinosum Epidermis-dermis junction Papillary dermis

More information

HYPOXIA INDUCIBLE FACTOR-1 (HIF-1) ALPHA IN PSORIATIC PATIENTS

HYPOXIA INDUCIBLE FACTOR-1 (HIF-1) ALPHA IN PSORIATIC PATIENTS HYPOXIA INDUCIBLE FACTOR-1 (HIF-1) ALPHA IN PSORIATIC PATIENTS Ahmed W. Amer; Sameh Fawzy Fahmy; Mohammed Al Said Faheem and Osama Abdel Azeem Ibrahim Dermatology department; Al-Azhar Faculty of Medicine

More information

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Fibrinogen-induced perivascular microglial clustering is required for the. development of axonal damage in neuroinflammation

Fibrinogen-induced perivascular microglial clustering is required for the. development of axonal damage in neuroinflammation SUPPLEMENTARY INFORMATION Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation Dimitrios Davalos, Jae Kyu Ryu, Mario Merlini, Kim

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

II. Skin and Its Tissues. I. Introduction. Unit Two. Integument URLs.

II. Skin and Its Tissues. I. Introduction. Unit Two. Integument URLs. 6 Integument URLs http://www.nurseminerva.co.uk/integ.html http://www.aap.org/policy/s010116.html Chapter 6 Karen Webb Smith Unit Two I. Introduction A. Organs are body structures composed of two or more

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,

More information

Supplementary Data. Supplementary Methods:

Supplementary Data. Supplementary Methods: Supplementary Data Supplementary Methods: Release kinetics of from collagen sponges in vivo. 2μg of human recombinant 165 was labeled with lexafluor 555 (Microscale Protein Labeling Kit; Invitrogen) as

More information

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Chapter 6 Skin and the Integumentary System. Skin Cells. Layers of Skin. Epidermis Dermis Subcutaneous layer beneath dermis not part of skin

Chapter 6 Skin and the Integumentary System. Skin Cells. Layers of Skin. Epidermis Dermis Subcutaneous layer beneath dermis not part of skin Chapter 6 Skin and the Integumentary System Composed of several tissues Maintains homeostasis Protective covering Retards water loss Regulates body temperature Houses sensory receptors Contains immune

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

BJD British Journal of Dermatology. Summary DERMATOPATHOLOGY

BJD British Journal of Dermatology. Summary DERMATOPATHOLOGY DERMATOPATHOLOGY BJD British Journal of Dermatology CD10 and CD34 in fetal and adult human hair follicles: dynamic changes in their immunohistochemical expression during embryogenesis and hair cycling

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

ABCD rule. apocrine glands. arrector pili. ceruminous glands. contact dermatitis

ABCD rule. apocrine glands. arrector pili. ceruminous glands. contact dermatitis ABCD rule assessing moles: asymmetric, broder irregularity, color, diameter (larger than 6mm) apocrine glands arrector pili sweat glands in the pubic and underarm areas that secrete thicker sweat, that

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang

More information

Thermal Dermal Burn Modeling in Rats and Minipigs

Thermal Dermal Burn Modeling in Rats and Minipigs Thermal Dermal Burn Modeling in Rats and Minipigs Comparative Biosciences, Inc. 786 Lucerne Drive Sunnyvale, CA 94085 Telephone: 408.738.9261 www.compbio.com Premier Preclinical Contract Research Organization

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

EXPERIMENTAL THERMAL BURNS I. A study of the immediate and delayed histopathological changes of the skin.

EXPERIMENTAL THERMAL BURNS I. A study of the immediate and delayed histopathological changes of the skin. EXPERIMENTAL THERMAL BURNS I A study of the immediate and delayed histopathological changes of the skin. RJ Brennan, M.D. and B. Rovatti M.D. The purpose of this study was to determine the progressive

More information

Dr Narmeen S. Ahmad. Lab 1

Dr Narmeen S. Ahmad. Lab 1 Dr Narmeen S. Ahmad Lab 1 1 Tissues are groups of cells with a common structure (form) and function (job). There are (4) types of tissue: 1. Epithelial 2. Connective 3. Muscle 4. Nervous 2 Epithelial cells

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information